HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Boucontet, L. Articles by Pereira, P. Search for Related Content PubMed PubMed Citation Articles by Boucontet, L. Articles by Pereira, P.

Mechanisms Controlling Termination of V-J Recombination at the TCR Locus: Implications for Allelic and Isotypic Exclusion of TCR Chains¹

Laurent Boucontet^*, Nuno Sepúlveda, Jorge Carneiro and Pablo Pereira^2,*

^* Unité du Développement des Lymphocytes, Centre National de la Recherche Scientifique Unité de Recherche Associée 1961, Institut Pasteur, Paris, France; Instituto Gulbenkian de Ciencia, Oeiras, Portugal

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Analyses of V-J rearrangements producing the most commonly expressed TCR chains in over 200 TCR⁺ thymocytes showed that assembly of TCR V-region genes display properties of allelic exclusion. Moreover, introduction of functionally rearranged TCR and transgenes results in a profound inhibition of endogenous TCR rearrangements in progenitor cells. The extent of TCR rearrangements in these cells is best explained by a model in which initiation of TCR rearrangements at both alleles is asymmetric, occurs at different frequencies depending on the V or J segments involved, and is terminated upon production of a functional TCR. Approximately 10% of the cells studied contained two functional TCR chains involving different V and J gene segments, thus defining a certain degree of isotypic inclusion. However, these cells are isotypically excluded at the level of cell surface expression possibly due to pairing restrictions between different TCR and chains.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Exons encoding the variable regions of lymphocyte receptors for Ag are assembled during lymphocyte ontogeny from clusters of V, (D), and J segments in a process known as V(D)J recombination (1). T cell precursors can rearrange up to four different loci (, , , and ) and express either of two different TCR ( and ), thus defining two T lymphocyte populations (the and the T cell populations). Most TCR, TCR, and TCR rearrangements take place in a population of thymocytes known as pre-T cells which is characterized by low expression of CD44, high expression of CD25, and lack of expression of the CD4 or CD8 markers (2, 3, 4), whereas most V to J rearrangements occur later in development in cells coexpressing the CD4 and CD8 molecules (5, 6). Functionally rearranged TCR chains associate with the nonrearranging surrogate -chain (pre-T) forming the pre-TCR (7). Only cells expressing the pre-TCR efficiently traverse a developmental checkpoint usually referred to as TCR selection (8) and further differentiate into the T cell pathway (9). Such differentiation is accompanied by down-regulation of RAG-1/2 expression, silencing of TCR transcription (thus avoiding expression of a TCR in lineage cells), acquisition of the CD4 and CD8 markers and up-regulation of RAG-1/2 expression allowing the initiation of rearrangements at the TCR locus (10). In contrast, no surrogate chains for lineage cells have been identified and evidence suggest that simultaneous expression of functional TCR and TCR chains that can efficiently pair are required for differentiation along the T cell lineage (11, 12, 13).

Because lymphocytes are diploid cells, the recombination process could, theoretically, result in the production of two productively rearranged TCR alleles and, therefore, in the expression at the cell surface of more than one TCR specificity. Analyses of a relatively large number of T cells and clones have shown that, as a rule, mature T cells contain only one productive TCR rearrangement, whereas the second allele is either nonproductively rearranged or contain their V gene segments in germline configuration (14, 15, 16). In contrast, most mature T cells contain two TCR rearrangements and 20–30% of them bear two productively rearranged TCR chains (15, 16). Thus, assembly of TCR chain V region is regulated in a way that allows only one of the two alleles to be expressed in each cell (a phenomenon usually referred to as allelic exclusion or genotypic allelic exclusion) whereas that of TCR chain V-region genes is regulated differently permitting allelic inclusion. Posttranslational mechanisms appear to limit T cells carrying two functional TCR rearrangements to the expression of a single TCR chain at the cell surface (17) (a phenomenon usually referred to as phenotypic allelic exclusion). Together, these mechanisms ensure that most T cells express a unique TCR at the cell surface that may be essential for the generation of specific immune responses and for effective tolerance mechanism based on the elimination or inactivation of developing cells reacting with self-Ags.

To explain allelic exclusion at the TCR locus it has been postulated that the product of a successful V to DJ recombination prevents further rearrangements at the same locus via a feedback mechanism (15), similar to what was proposed earlier for the Ig H chain locus in developing B cells (18, 19). Together with the postulate that rearrangement starts initially in one of the two alleles, this hypothesis correctly predicts the extent of TCR rearrangement found in mature T cells (15). Also in support of a feedback mechanism are data showing that lymphocytes from TCR transgenic (Tg)³ mice that express the transgene early in development are almost completely devoid of endogenous V to DJ rearrangements (20). More recent experiments analyzing the proportion of progenitor cells containing two completed TCR gene rearrangements in normal, pre-T-deficient, or SLP-76-deficient mice have indicated an essential role for signals mediated by the pre-TCR in TCR allelic exclusion (16, 21).

Analyses of TCR rearrangements in a panel of T cell hybridomas derived from splenic T cells showed a high percentage of cells carrying two productively rearranged TCR chains, indicating that assembly of TCR V-region genes, like that of TCR V-region genes, is not regulated in the context of allelic exclusion (22). In support of this notion, Tg mice carrying a functionally rearranged TCR chain showed no evident inhibition of rearrangements at the endogenous TCR locus (23). Whether posttranslational mechanisms limit the number of TCR chains that may be expressed at the cell surface in T cells is not known, although pairing preferences observed between individual TCR and TCR chains may contribute to the monoallelic expression of TCR chains at the cell surface (24, 25).

Whether assembly of TCR V-region genes is regulated in a context of allelic exclusion is a matter of debate. Analyses of human T cell lines have shown that a variable proportion (1–6%) of cells coexpress two functional TCR chains at the cell surface (26) and this has been taken to imply that assembly of TCR genes is not subjected to allelic exclusion mechanisms. In contrast, analyses of TCR rearrangements in mouse thymocyte clones showed that most thymocytes contained only one functionally rearranged allele for most of the TCR isotypes (13), which suggests that assembly of TCR genes in the mouse may be regulated in the context of allelic exclusion.

To understand the mechanisms regulating assembly of TCR V-region genes one needs to take into consideration the genomic structure of the TCR locus, which differs greatly between humans and mice. Thus, whereas a human progenitor cell can produce a maximum of two functionally rearranged TCR chains, a mouse progenitor cell could, theoretically, produce six to eight functional TCR chains, depending on the mouse strain (13, 27). This is due to the fact that the mouse TCR locus is organized in four clusters of V, J, and C regions containing seven V gene segments, four J gene segments, and four C regions (hereafter referred to as V1 to V7, J1 to J4, and C1 to C4, respectively, according to the nomenclature of Heilig and Tonegawa; Ref. 28). Each cluster contains a C region, linked to a single J element and one to four V gene segments, which rearrange preferentially to the J segment present in the same cluster. Thus, if expression of more than one TCR chain at the cell surface of T cells is to be prevented, TCR chains must be regulated not only to avoid simultaneous expression of the two alleles, but also to avoid expression of different TCR isotypes. Here we show that assembly of mouse TCR V-region genes is regulated in a manner compatible with allelic exclusion mediated by a TCR that can be expressed at the cell surface. Moreover, isotypic exclusion is regulated genotypically, at least in part, as evidenced by the fact that different V and J gene segments display distinct probabilities to participate in a recombination reaction and by the different frequencies at which a rearrangement involving particular V and J gene segments produce a functional chain. Further phenotypic isotypic exclusion results from the different capacity of TCR isotypes to pair with a more or less restricted pool of TCR chains.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Mice

C57BL/6JIco (B6) mice were obtained from Iffa-Credo. B6 mice Tg for a functionally rearranged V1J4C4 (Tg-; Ref. 29), B6 mice Tg for the same V chain together with a functionally rearranged V6D2J1 chain (Tg-; Ref. 30), and B6 TCR-deficient mice (31) were maintained in our animal facilities. B6 mice deficient in the TCR enhancer (E^–/–; Ref. 32). were obtained from Dr. P. Ferrier (Centre d’Immunologie de Marseille-Luminy, Marseille, France) and also maintained in our animal facilities. All animals were used between 6 and 8 wk of age unless otherwise indicated.

Abs, flow cytometry, and cell sorting

Abs, FACS analyses, and cell sorting were performed as described (13).

Cell cultures

Cloning of individually sorted thymocytes was performed as described (13). Sorted V1⁺ and V4⁺ cells were cloned in plates coated with anti-V1 mAb or anti-V4 mAb, respectively, thus providing a second control for the TCR chain expressed at the cell surface.

Single cell and single clone PCRs, cloning, and sequencing

The single clone PCR to detect the rearrangement status of the TCR locus have been described in detail (13). The protocol was identical except that only primers specific for the V1 and V4 V regions were used, and the germline status was only analyzed for the V1 and the V4 regions. Reverse primers for the germline V4 region were: VG4GLext CTGAACAGCAGGTGGTTGCC and VG4GLint CCAAGCTAAGAAGGATGTGG. Single cell PCR was performed as described (33) using the VG1: CCGGCAAAAAGCAAAAAAGTT and JG4: GCAAATATCTTGACCCATGA primers

	Results

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
Most T cells express one Ag receptor at the cell surface

To quantitate the proportion of thymocytes expressing two different TCR or TCR chains at the cell surface we used the available anti-V and anti-V mAbs. Cells staining simultaneously with an anti-V1 and a mixture of anti-V4 and anti-V7 mAbs are rare, representing <1% of all thymocytes in B6 mice (Fig. 1A). Because together, these Abs recognize >90% of the thymocytes in this strain, these data demonstrate that the vast majority of T cells express only one TCR isotype at the cell surface.

View larger version (23K): [in this window] [in a new window]   FIGURE 1. Most thymocytes bear a unique TCR at the cell surface. CD4–CD8– thymocytes were stained with anti--PE, CD3-allophycocyanin, and either with 2.11-biotin and anti-V4-FITC plus anti V7-FITC (A) or anti-V4-biotin and anti-V5-FITC plus anti-V6-FITC (B), followed by streptavidin-PerCP, and analyzed in a FACSCalibur. C, Putative dual-expressors in B (4% in this particular experiment) were sorted, expanded in vitro for 4 days, and reanalyzed as in B. Data are shown as dot-plots of the log10 of fluorescence intensity of the indicated mAbs in electronically gated CD3++ cells. Numbers denote the fraction of cells in each quadrant.

Extent of allelic and isotypic inclusion of the functionally most relevant V4 and V1 gene segments

To quantitate the extent of genotypic allelic and isotypic inclusion at the TCR locus and to gain a better understanding on the mechanisms controlling assembly of TCR V-region genes, we analyzed the rearrangement status of the V1 and V4 genes in progenies of a total of 234 thymocytes (141 V1⁺ and 93 V4⁺) using a previously described two-step PCR (Fig. 2 and Ref. 13). Cells bearing at the cell surface either V1 or V4 chains represent >80% of the thymocytes in B6 mice (25). For simplicity we only analyzed V1 to J4 and V4 to J1 rearrangements, as well as the germline status of the V1 and V4 gene segments. This was based on our previous observation that in adult thymocytes >98% of the rearrangements involving the J4 gene segment also involved the V1 gene segment and >90% of the rearrangements involving the J1 gene segment also involved the V4 gene segment (13). These analyses also showed that about half of the V1⁺ and V4⁺ thymocytes bear functional V2-J2 rearrangements and the mechanisms precluding detectable expression of V2 chains at the cell surface of these cells have been previously discussed (13). The PCR amplification products of the rearrangements were sequenced to determine their functionality and a summary of the results is shown in Fig. 2.

View larger version (42K): [in this window] [in a new window]   FIGURE 2. Rearrangement status of the J1 and J4 regions in progenies of individual V4+ and V1+ thymocytes. A, Schematic representation of the genomic organization of the mouse TCR locus. The map is not drawn to scale. Arrows indicate transcriptional orientation. B, Primers used for the analyses of the rearrangement status of the TCR locus in progenies of individual T cells. Primers inside a box are meant to imply that they are used together in the same PCR, whereas isolated primers denote individual PCRs. C, Individually sorted V4+ and V1+ thymocytes were expanded and analyzed for the rearrangement status of the J1 and J4 regions as described in Materials and Methods. Each of the two boxes under every J gene segment represents one allele without any intentional order. The colors denote the V gene involved in the rearrangement. Lack of the box denotes deletion of a particular allele due to recombination of V and J segments present in different clusters. Filled boxes denote productive rearrangements. Hatched boxes denote unproductive rearrangements. Empty boxes denote lack of rearrangement at that allele. Light colored boxes in V4+ clones 88–92 denote that the rearrangement status of these alleles could not be determined unambiguously. These five clones were excluded from the statistical analyses.

Expression of a functionally rearranged TCR inhibits rearrangements at the endogenous TCR locus

The low frequency of allelically included cells may suggest that the products of functionally rearranged V1-J4 or V4-J1 gene segments are involved in the termination of TCR rearrangements in progenitor cells. They could do so by participating in a signaling complex either alone, together with a putative surrogate TCR chain, or together with a TCR chain with which they can form a TCR. In either case, it will be expected that introduction of a functionally rearranged TCR chain in progenitor cells will result in a certain degree of inhibition of TCR rearrangements at the endogenous loci. Moreover, comparison of the extent of inhibition resulting from ectopic expression of either a functional TCR chain alone or together with a functional TCR chain will be indicative of whether a surrogate receptor containing a TCR chain or a complete TCR is involved in this process.

We have previously produced mice Tg for a functionally rearranged V1J4C4 chain (Tg-) or for the same TCR- chain together with a functionally rearranged V6DJ chain (Tg-) (29, 30). Because among all TCR chains V1 chains are known to pair with the largest number of TCR chains (24, 25), these animals are most suitable to analyze this issue. Because a large majority of V1⁺ thymocytes contain at least one V4-J1 rearrangement (Fig. 2) we analyzed and compared the occurrence of this type of rearrangement in V1⁺ thymocytes isolated from wild-type, Tg- and Tg- mice. Introduction of a functionally rearranged V1 chain reduced the frequency of endogenous V4-J1 rearrangements by 3-fold (Fig. 3). A further 3-fold reduction was observed when a functional TCR chain was coexpressed with the same TCR chain, resulting in a 84% inhibition of endogenous V4-J1 rearrangements in T cells from Tg- mice (Fig. 3). This extent of inhibition of endogenous TCR rearrangements is of a similar magnitude to that previously observed in endogenous V to DJ rearrangements as the result of early expression of a functionally rearranged TCR transgene (34). These data strongly suggest that both TCR and TCR chains participate in the regulation of TCR V-region gene assembling. The inhibition observed following expression of a Tg TCR chain alone could reflect the increased probability of progenitor cells in Tg- mice to express a TCR.

View larger version (11K): [in this window] [in a new window]   FIGURE 3. Inhibition of endogenous V4-J1 rearrangements by TCR transgenes. Single sorted V1+ cells isolated from the indicated mouse strains were expanded in vitro and their DNA was analyzed for V4-J1 rearrangements and for the presence of unrearranged V4 genes as described in Materials and Methods. Data are shown as the number of V4-J1 rearrangements per cell. Numbers over the histograms denote the number of T cell clones analyzed. Clones from wild-type mice are the same as in Fig. 2.

T cell progenitors do not attempt all possible TCR rearrangements

The low frequency (12.8%) of V1⁺ cells harboring rearrangements at the two J4 alleles (Fig. 2) indicates that T cell progenitors do not attempt all possible TCR rearrangements. This could result from the low probability at which the V1 and J4 gene segments rearrange in progenitor cells in a given period of time (13). Also, a receptor different from the TCR may signal back to stop further rearrangements at the TCR locus. An obvious candidate will be the pre-TCR, which may be expressed in T cell precursors that produce a functional TCR chain and that is known to be essential in the process of allelic exclusion at the TCR locus (16). To investigate whether signals through the pre-TCR inhibit rearrangements at the TCR locus and, if so, to examine the relevance of such mechanism in and T cell fate decisions, we quantitated, by single cell PCR, the frequency of cells containing two V1-J4 rearrangements in sorted V1⁺ cells isolated from wild-type mice and from mice deficient in the TCR enhancer (E^–/–). This mutation completely inhibits rearrangement at the TCR- locus and, therefore, T cells in these mice develop in the absence of putative pre-TCR mediated signals. Moreover, comparison between these two strains of mice also eliminates competition between the TCR and the TCR loci for components of the V(D)J recombinase as an explanation for possible differences.

Nine of 71 (12.7%) V1⁺ cells from wild-type mice contained two V1-J4 rearrangements (Table I). This frequency is nearly identical to that found in the V1⁺ clones shown in Fig. 2, indicating that the culture step did not bias the experimental sample. In contrast, 18 of 78 (23.1%) of the V1⁺ cells isolated from E^–/– mice harbored two V1-J4 rearrangements. The differences between the two V1⁺ populations are statistically significant (p = 0.04 according to a Fischer’s exact test), demonstrating a quantitatively minor but evident role of the pre-TCR in the termination of rearrangements at the TCR locus in T cell progenitors.

View this table: [in this window] [in a new window]   Table I. Limited role of the pre-TCR in the termination of V to J rearrangements

The extent of TCR rearrangements found in T cells is best explained by a model in which initiation of TCR rearrangements at both alleles is asymetric and is terminated upon production of a functional TCR

Whereas the feedback mechanism certainly contributes to the inhibition of rearrangements at the second allele, it alone cannot explain allelic exclusion unless the rearrangement step is generally very inefficient (35). This is due to the fact that the product of a rearrangement must be tested for its ability to encode a functional chain. Attempting to calculate the rates of different TCR rearrangements and to investigate whether other mechanisms regulate TCR V-gene assembly, we constructed probabilistic models and compared the extent of V1 to J4 and V4 to J1 rearrangements found in V1⁺ and V4⁺ thymocytes with those predicted by the models (36). Models that only take into consideration the time given to a progenitor cell to rearrange and a feedback mechanism to stop further rearrangements, although compatible with the experimental data, only gave marginal statistical significance, strongly suggesting that additional mechanisms regulate TCR V-gene assembly. Interestingly, a very accurate match between the experimental data and the expected values was observed when a differential accessibility of the two TCR alleles was imposed in the model, assuming that after a period during which only one allele is accessible both alleles become accessible (36). Thus, on statistical basis, the experimental data is compatible with the hypothesis that assembly of TCR V-region genes is regulated by the products of functional TCR rearrangements and the experimental data is better explain if the two alleles do not become accessible to the V(D)J recombinase simultaneously. Importantly, the models make a number of predictions that can be experimentally analyzed and used to test their robustness. Thus, the best fitting model predicts that a progenitor cell will rearrange the V4 gene 12 times more often than the V1 gene, what compares well with the value of 11 found experimentally (13). Moreover, the model also predicts a ratio betweenV4⁺ and V1⁺ cells of 1.4, which also compares well with the ratio of 1.67 obtained by staining thymocytes with V-specific mAbs ex vivo. Finally, the model predicts that 0.5% of the V1⁺ cells will contain two functional V1-J4 rearrangements, compatible with the 0.7% found in the clones analyzed here (Fig. 2). Interestingly, the model also predicts that 44% of the progenitor cells will produce functional V1 or V4 chains. Given that a few more progenitor cells may produce functional V2 or V7 chains, the expected value of T cell precursors that will produce a functional TCR chain may not differ significantly from the maximum of 56% of the T cell precursors expected to produce a functional TCR chain (15).

The number of thymocytes correlates with the probability of producing a selectable TCR

A proper comparison of the models with the data requires that newly differentiated T cells do not expand in the thymus or, if they do, that this expansion is independent of the TCR isotype they express. Although it is generally believed that formation of a selectable TCR in -lineage progenitor cells induces maturation of the cells in a process that involves little or no proliferation (37), it was important to ascertain that this was indeed the case. If maturation of thymocytes occurs without significant expansion, it would be expected that the number of T cells present in the thymus is a direct function of the probability of assembling a selectable TCR. Therefore, we quantified and compared thymocyte numbers in mice carrying only one functional allele of the C chain and in wild-type littermates. As shown in Fig. 4, TCR^+/– mice contained about half the number of thymocytes than their wild-type littermates, demonstrating that the number of thymocytes is a linear function of the probability of a progenitor cell to produce a functional TCR, and suggesting that no homeostatic mechanism regulates T cell numbers in the thymus.

View larger version (11K): [in this window] [in a new window]   FIGURE 4. The number of thymocytes correlates with the probability of producing a functional TCR in progenitor cells. Thymocytes from back-crossed (B6 x TCR–/–) x B6 mice were stained with anti--PE and anti-CD3-allophycocyanin and analyzed in a FACSCalibur. Data are shown as the number of thymocytes present in individual mice analyzed at 4 wk of age and separated on the basis of having one or two functional alleles of the C region. Numbers denote the mean values of thymocytes on each group.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

For signaling through a TCR to be effective in ensuring allelic exclusion at the TCR locus it is required that, in general, TCR rearrangements precede TCR rearrangements in progenitor cells. Although complete rearrangements at both loci are found at the same developmental stage (3, 4), indirect evidence suggests that this may indeed be the case. Thus, cells with rearrangements at the TCR locus and with the TCR locus in germline configuration were easily found in fetal thymocyte hybridomas (38). Moreover, analyses of thymocytes from SCID mice (39) showed that rearrangements at the TCR locus exceed by far those occurring at the TCR or TCR loci (40). SCID mice produce dsDNA breaks mediated by the RAG proteins at the initiation of the recombination process at normal levels (41) but their defect in the DNA-dependent protein kinase catalytic subunit protein, which is involved in the resolution of coding ends, precludes the formation of V(D)J coding joints at appreciable frequency. Therefore, the SCID mice data provide evidence for a different accessibility of the TCR and TCR loci to participate in a recombination reaction in early progenitor cells. It should be pointed out that we are not implying a strict temporal order in the rearrangements at both loci, but just an increased probability of a TCR chain to be rearranged (or expressed) before a TCR chain in progenitor cells. Absence of a strict temporal order in the rearrangement at both loci is suggested by the isolation of fetal hybridomas containing rearrangements at the TCR locus and the TCR locus in germline configuration (38) and by our data showing that ectopic expression of a functionally rearranged TCR chain only partially inhibits endogenous rearrangements at the TCR locus.

Although the feedback mechanism certainly contributes to the inhibition of rearrangements at the second allele, it alone cannot explain allelic exclusion unless the rearrangement step is generally very inefficient (35). This is due to the fact that the product of a rearrangement must be tested for its ability to encode a functional chain. The actual frequencies of B and T lymphocytes containing, respectively, V(D)J rearrangements at the two IgH or TCR alleles were shown to be very close to those expected if rearrangements at the two alleles were attempted sequentially and every progenitor cell had enough time to rearrange both alleles (15, 19). These results prompted the generalized notion that accessibility to the recombination machinery differs between two identical alleles. However, the same results would be predicted if the efficiency of recombination is generally low but the time given to a progenitor cell to recombine is long, because these experiments analyze a single recombination event (V to DJ) on each chromosome. The genomic organization of the TCR locus in the mouse, permitting multiple V to J rearrangements in the same chromosome, allows us to differentiate between these two possibilities. This is due to the fact that, although the initiation of recombination at different V and J segments is likely to be independent from each other (see below), the fact that the products of these recombination events terminates recombination in the whole locus results in their functional dependence. In other words, the extent of V1-J4 rearrangements will depend not only on the probability of producing a functional V1 chain, but also on that of producing a functional V4 chain in the same progenitor cell and vice versa. In this scenario, a feedback mechanism together with a limited time given to the progenitor cell to rearrange their TCR genes fail to fit the experimental data because they always overestimate the number of cells containing the two alleles rearranged. Fitting the extent of expected rearrangements to the experimental values at one J region invariably results in predicted values for rearrangements at the other J region higher than those observed experimentally, indicating that other mechanisms participate in the process of allelic exclusion at the TCR locus. Imposing a different accessibility of the two alleles to the action of the V(D)J recombinase result in an almost perfect match between the observed and expected values, suggesting that this is one of the mechanisms by which allelic exclusion is achieved. In this line, recent experiments have shown the existence of differential epigenetic modifications at two Ig alleles, established early during embryonic development, that lead to a preferential accessibility of one of the alleles to the V(D)J recombinase (42). These epigenetic modifications are clonally transmitted and also correlate with the asynchronous replication of different TCR and Ig alleles in mature lymphocytes, with Ig rearrangements in mature B cells found preferentially in the early replicating allele (42, 43). Interestingly, DNA demethylation, which is one of the epigenetic modifications increasing chromatin accessibility, was shown to occur with different kinetics in both Ig alleles in a manner compatible with a different probability of each allele to be demethylated, more than with a specific mechanism imposing demethylation at a single allele (44). Independent evidence for the stochastic nature of the preferential accessibility of one of the alleles has also been obtained in studies analyzing the chromatin structure surrounding the transcriptional enhancers associated with the Ig locus (45).

Even if the two chromosomes become accessible to the action of the V(D)J recombinase with different probabilities, that will only have a limited effect on the isotypic exclusion of mouse TCR genes due to the genomic structure of the mouse TCR locus (Fig. 2). Possible mechanisms of isotypic exclusion of IgL chains have been extensively discussed and two general models (a sequential model and a probabilistic model) have been proposed (46). The most relevant difference between the two models is that, whereas the sequential model proposes that rearrangements are regulated by rearrangements, the probabilistic model presumes complete independence of both loci. By analogy with the IgL chain loci, the same two general models could be proposed to explain isotypic exclusion at the TCR locus in the mouse. However, the fact that a fraction of V1⁺ cells contain the two J1 alleles in germline configuration (Fig. 2), argues against a strict temporal order in the rearrangements at different J regions and strongly suggests that rearrangements at different J regions initiate independently. In these conditions, concomitant rearrangement of two or more isotypes and, therefore, expression of two functionally rearranged TCR chains becomes possible and their frequency will depend on the rearrangement rates at different J regions. Obviously, the chances that a progenitor cell will produce two functional chains decrease as the rates of rearrangement of the different TCR chains diminish but with a concomitant decrease in the fraction of progenitor cells that will succeed in producing a functional TCR chain. Interestingly, increasing the rate of recombination of one isotype relative to the other will have as a consequence a relatively high rate of success keeping the probability of producing isotypically included cells at 1% (36). However, in these conditions, the majority of the rescued cells will express the most abundantly rearranged isotype (V4 in adult mouse thymocyte). An elevated production of V1 cells can be obtained by reducing the probability of obtaining functional V4 chains without altering the rate of rearrangement of the V4 gene segment. This is precisely the consequence of the presence of an in-frame stop codon at the end of the V4 gene, which decreases by about 2-fold the chance that a V4-J1 rearrangement will result in a functional V4 chain (4, 47). Thus, the 11-fold difference in the rates at which V1 and V4 rearrange (13), together with the presence of a stop codon at the end of the V4 gene segment are sufficient to ensure the development of relatively high numbers of V4⁺ and V1⁺ thymocytes from a common precursor, keeping the probability that a cell may contain two functionally rearranged isotypes below 1% (36). The selective advantage for the coexistence of both cell populations may relate to their different functions, as has been suggested in several infectious models (reviewed in Ref. 48).

Although assembly of V genes displays properties of allelic exclusion, it is expected that a small fraction of cells will contain two functionally rearranged alleles. This is predicted by stochastic models of TCR gene rearrangement and our data indicates that cells containing two functional V1 or V4 chains are in the order of 1%. More importantly, the models also predict a very small fraction of isotypically included cells, which is in apparent contradiction with the experimental data. Thus, 12% of the V1⁺ thymocytes also contain a functional V4 chain (Fig. 2) and about half of the thymocytes contain a functional V2 chain in addition to the V chain that is expressed at their cell surface (13). These cells are isotypically included at the genetic level but excluded at the level of TCR expression at the cell surface as demonstrated by their staining with V-specific Abs (Fig. 1 and Ref. 13). At least part of this phenotypic exclusion is due to the restriction in V chain pairing displayed by V2 and possibly V4 chains (13), reminiscent of the allelically included B cells that were shown to be allelically excluded at the level of pre-BCR surface expression (49). Altogether, these and previous data analyzing the extent of TCR rearrangements in a smaller number of thymocytes (13), are consistent with the hypothesis that cessation of rearrangements at the TCR locus (and possibly at the TCR and TCR loci) and final development along the T cell pathway are mediated by signals trough a TCR that can be expressed at the cell surface.

Previous analysis of human T cell clones with V-specific Abs showed that a significant fraction of cells (1–7%) contained two functional TCR chains, suggesting that assembly of human V genes is not regulated in the context of allelic exclusion (26). This is in contrast with our data showing that the vast majority of mouse thymocytes express a unique TCR chain at the cell surface. However, as also shown here, up to 3% of the mouse thymocytes express two different TCR chains at the cell surface. If signals to terminate rearrangements at the TCR (and possibly TCR) loci are mediated by a selectable TCR and not by a surrogate receptor, only the chain that rearranges later can be allelically excluded efficiently. Furthermore, a certain degree of isotypic exclusion of TCR chains in the mouse is due to their restricted pairing with TCR chains. Thus, differences in the time at which TCR and TCR rearrangements take place in human progenitors and/or a less evident restriction for TCR chains displayed by human TCR chains could explain, at least in part, the different phenotype observed in mouse and human T cells with regard to allelic exclusion of TCR chains.

Because assembly of TCR chains does not exhibit properties of allelic exclusion it is expected that 20% of the T cells containing complete V(D)J rearrangements at both alleles will contain two functional TCR chains (22). The actual number of T cells bearing two functional TCR chains is higher than that (28% in the combined data from Ref. 22 and 13). This is also a possible consequence of the restricted pairing of TCR and TCR chains and of the fact that T cell progenitors do not attempt all possible rearrangements at the TCR locus. In these circumstances, progenitor cells containing two functional TCR chains have a greater chance to be rescued by a TCR chain to enter the T cell pool than progenitor cells containing a single functional TCR chain. Because37% of the T cells contain only one complete TCR rearrangement (13, 22) it is expected that 18% (0.28 x 0.63 x 100) of the T cells contain two functional TCR chains. Of those, a relatively large fraction will harbor a TCR chain unable to pair with the TCR chain and, therefore, will be allelically excluded at the cell surface. Consistent with this interpretation is the fact that, of 11 V4⁺ clones containing two functional TCR chains, 7 (63%) contained a V6 chain (L. Boucontet and P. Pereira, unpublished observations), which is known to be rarely expressed with V4 (25). Thus, in the absence of any other constraint it can be estimated that 6% of the thymocytes may express two different TCR chains at the cell surface. This value is somewhat higher than the maximum of 3% found by staining with V-specific mAbs (Fig. 1) suggesting that additional mechanisms exist to further restrict the expression of two functional TCR chains.

Finally, our results suggest a mechanism to explain, at least in part, how the absence of a functional pre-TCR results in an increased number of thymocytes (7, 50). Thus, signals through the pre-TCR may inhibit TCR rearrangements in cells that, otherwise, could still become T cells. However, this mechanism appears to operate in a small number of progenitors, likely because V to DJ rearrangements mostly take place after the majority of TCR and TCR rearrangements have been completed (3, 4).

	Disclosures

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 
The authors have no financial conflict of interest.

	Acknowledgments

 
We thank Paulo Vieira and Ana Cumano for critical reading of the manuscript and Pierre Ferrier for the kind gift of TCR^–/– mice.

	Footnotes

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ This work was supported by institutional grants, grants from the "Association pour la Recherche sur le Cancer" (to P.P.) and Fundaçao para a Ciência e Tecnologia (to J.C.). N.S. received a fellowship from the Gulbenkian Institute for Science.

² Address correspondence and reprint requests to Dr. Pablo Pereira, Unité du Développement des Lymphocytes, Institut Pasteur, 25 Rue du Dr. Roux, 75724 Paris Cedex 15, France. E-mail address: ppereira{at}pasteur.fr

³ Abbreviation used in this paper: Tg, transgenic.

Received for publication August 19, 2004. Accepted for publication January 20, 2005.

	References

Top Abstract Introduction Materials and Methods Results Discussion Disclosures References

 

1. Tonegawa, S.. 1983. Somatic generation of antibody diversity. Nature 302:575.[Medline]
2. Godfrey, D. I., A. Zlotnik. 1993. Control points in early T cell development. Immunol. Today 14:547.[Medline]
3. Livak, F., M. Tourigny, D. G. Schatz, H. T. Petrie. 1999. Characterization of TCR gene rearrangements during adult murine T cell development. J. Immunol. 162:2575.[Abstract/Free Full Text]
4. Capone, M., R. D. Hockett, Jr, A. Zlotnik. 1998. Kinetics of T cell receptor , , and rearrangements during adult thymic development: T cell receptor rearrangements are present in CD44⁺CD25⁺ pro-T thymocytes. Proc. Natl. Acad. Sci. USA 95:12522.[Abstract/Free Full Text]
5. Petrie, H. T., F. Livak, D. Burtrum, S. Mazel. 1995. T cell receptor gene recombination patterns and mechanisms: cell death, rescue, and T cell production. J. Exp. Med. 182:121.[Abstract/Free Full Text]
6. Wilson, A., J.-P. de Villartay, H. R. MacDonald. 1996. T cell receptor gene rearrangement and T early a (TEA) expression in immature lineage thymocytes: implications for / lineage commitment. Immunity 4:37.[Medline]
7. Fehling, H. J., A. Krotkova, C. Saint-Ruf, H. von Boehmer. 1995. Crucial role of the pre-T cell receptor a gene in the development of but not T cells. Nature 375:795.[Medline]
8. Dudley, E. C., H. T. Petrie, L. M. Shah, M. J. Owen, A. C. Hayday. 1994. T cell receptor chain gene rearrangement and selection during thymocyte development in adult mice. Immunity 1:83.[Medline]
9. von Boehmer, H., I. Aifantis, J. Feinberg, O. Lechner, C. Saint-Ruf, U. Walter, J. Buer, O. Azogui. 1999. Pleiotropic changes controlled by the pre-T-cell receptor. Curr. Opin. Immunol. 11:135.[Medline]
10. Wilson, A., W. Held, H. R. MacDonald. 1994. Two waves of recombinase gene expression in developing thymocytes. J. Exp. Med. 179:1355.[Abstract/Free Full Text]
11. Passoni, L., E. S. Hoffman, S. Kim, T. Crompton, W. Pao, M.-Q. Dong, M. J. Owen, A. C. Hayday. 1997. Intrathymic selection events in cell development. Immunity 7:83.[Medline]
12. Kang, J., M. Coles, D. Cado, D. H. Raulet. 1998. The developmental fate of T cells is critically influenced by TCR expression. Immunity 8:427.[Medline]
13. Pereira, P., L. Boucontet. 2004. Rates of recombination and chain pair biases greatly influence the primary TCR repertoire in the thymus of adult mice. J. Immunol. 173:3261.[Abstract/Free Full Text]
14. Seboun, E., N. Joshi, S. L. Hauser. 1992. Haplotypic origin of -chain genes expressed by human T-cell clones. Immunogenetics 36:363.[Medline]
15. Malissen, M., J. Trucy, E. Jouvin-Marche, P.-A. Cazenave, R. Scollay, B. Malissen. 1992. Regulation of TCR a and gene allelic exclusion during T-cell development. Immunol. Today 13:315.[Medline]
16. Aifantis, I., J. Buer, H. von Boehmer, O. Azugui. 1997. Essential role of the pre-T cell receptor in allelic exclusion of the T cell receptor locus. Immunity 7:601.[Medline]
17. Gascoigne, N. R. J., S. M. Alam. 1999. Allelic exclusion of the T cell receptor -chain: developmental regulation of a post-translational event. Sem. Immunol. 11:337.[Medline]
18. Alt, F. W., N. Rosenberg, S. Lewis, E. Thomas, D. Baltimore. 1981. Organization and reorganization of immunoglobulin genes in A-MuLV-transformed cells: Rearrangement of heavy but not light chain genes. Cell 27:381.[Medline]
19. Coleclough, C.. 1983. Chance, necessity and antibody gene dynamics. Nature 303:23.[Medline]
20. Uematsu, Y., S. Ryser, Z. Dembic, P. Borgulya, P. Krimpenfort, A. Berns, H. von Boehmer, M. Steinmetz. 1988. In transgenic mice the introduced functional T cell receptor gene prevents expression of endogenous b genes. Cell 52:831.[Medline]
21. Aifantis, I., V. I. Pivniouk, F. Gartner, J. Freinberg, W. Swat, F. W. Alt, H. von Boehmer, R. S. Geha. 1999. Allelic exclusion of the T cell receptor locus requires the SH2 domain-containing leucocyte protein (SLP)-76 adaptor protein. J. Exp. Med. 190:1093.[Abstract/Free Full Text]
22. Sleckman, B. P., B. Khor, R. Monroe, F. W. Alt. 1998. Assembly of productive T cell receptor variable region genes exhibits allelic inclusion. J. Exp. Med. 188:1465.[Abstract/Free Full Text]
23. Ferrero, I., A. Wilson, F. Beermann, W. Held, H. R. MacDonald. 2001. T cell receptor specificity is critical for the development of epidermal T cells. J. Exp. Med. 194:1473.[Abstract/Free Full Text]
24. Bluestone, J. A., R. Q. Cron, T. A. Barrett, B. Houlden, A. I. Sperling, A. Dent, S. Hedrick, B. Rellahan, L. A. Matis. 1991. Repertoire development and ligand specificity of murine TCR cells. Immunol. Rev. 120:5.[Medline]
25. Pereira, P., V. Hermitte, M.-P. Lembezat, L. Boucontet, V. Azuara, K. Grigoriadou. 2000. Developmentally regulated and lineage-specific rearrangement of T cell receptor V/ gene segments. Eur. J. Immunol. 30:1988.[Medline]
26. Davodeau, F., M.-A. Peyrat, I. Houde, M.-M. Hallet, G. De Libero, H. Vié, M. Bonneville. 1993. Surface expression of two distinct functional antigen receptors on human T cells. Science 260:1800.[Abstract/Free Full Text]
27. Pereira, P., D. Gerber, A. Regnault, S. Y. Huang, V. Hermitte, A. Coutinho, S. Tonegawa. 1996. Rearrangement and expression of V1, V2 and V3 TCR genes in C57BL/6 mice. Int. Immunol. 8:83.[Abstract/Free Full Text]
28. Heilig, J. S., S. Tonegawa. 1986. Diversity of murine genes and expression in fetal and adult T lymphocytes. Nature 322:836.[Medline]
29. Gerber, D. J., V. Azuara, J.-P. Levraud, S. Y. Huang, M.-P. Lembezat, P. Pereira. 1999. IL-4-producing T cells that express a very restricted TCR repertoire are preferentially localized in liver and spleen. J. Immunol. 163:3076.[Abstract/Free Full Text]
30. Malissen, M., P. Pereira, D. J. Gerber, B. Malissen, J. P. DiSanto. 1997. The common cytokine receptor chain controls survival of / T cells. J. Exp. Med. 186:1277.[Abstract/Free Full Text]
31. Itohara, S., P. Mombaerts, J. Lafaille, J. Lacomini, A. Nelson, A. R. Clarke, M. L. Hooper, A. Farr, S. Tonegawa. 1993. T cell receptor gene mutant mice: independent generation of T cells and programmed rearrangements of TCR genes. Cell 72:337.[Medline]
32. Leduc, I., W. M. Hempel, N. Mathieu, C. Verthuy, G. Bouvier, F. Watrin, P. Ferrier. 2000. T cell development in TCR enhancer-deleted mice: implications for T cell lineage commitment and differentiation. J. Immunol. 165:1364.[Abstract/Free Full Text]
33. Grigoriadou, K., L. Boucontet, P. Pereira. 2003. Most IL-4-producing thymocytes of adult mice originate from fetal precursors. J. Immunol. 171:2413.[Abstract/Free Full Text]
34. Ardouin, L., J. Ismalli, B. Malissen, M. Malissen. 1998. The CD3- and CD3-/ç modules are each essential for allelic exclusion at the T cell receptor b locus but are both dispensable for the initiation of V to (D)J recombination at the T cell receptor-, - and - loci. J. Exp. Med. 187:105.[Abstract/Free Full Text]
35. Coleclough, C., R. P. Perry, K. Karjalainen, M. Weigert. 1981. Aberrant rearrangements contribute significantly to the allelic exclusion of immunoglobulin gene expression. Nature 290:372.[Medline]
36. Sepulveda, N., L. Boucontet, P. Pereira, and J. Carneiro.