Correction
for Sakurai et al., J Immunol 173 (9) 5801-5809.
The Journal of Immunology, 2005, 174: 3818.
Copyright © 2005 by The American Association of Immunologists
Crucial Role of Inhibitor of DNA Binding/Differentiation in the Vascular Endothelial Growth Factor-Induced Activation and Angiogenic Processes of Human Endothelial Cells.
Daisuke Sakurai,
Naoyuki Tsuchiya,
Akihiro Yamaguchi,
Yurai Okaji,
Nelson H. Tsuno,
Tetsuji Kobata,
Koki Takahashi and
Katsushi Tokunaga
Daisuke Sakurai, Naoyuki Tsuchiya, Akihiro Yamaguchi, Yurai Okaji, Nelson H. Tsuno, Tetsuji Kobata, Koki Takahashi, and Katsushi Tokunaga. Crucial Role of Inhibitor of DNA Binding/Differentiation in the Vascular Endothelial Growth Factor-Induced Activation and Angiogenic Processes of Human Endothelial Cells. The Journal of Immunology, 2004, 173: 58015809
.
In Materials and Methods, in the second sentence of the third paragraph under the heading Endothelial cell culture and transient transfection, the nucleotide sequence of ID3 shRNA is incorrect. The correct sequence is shown below.
TCGGATCCAACCACTGCTACTCCCGCCTGTTCAAGAGACAGGCGGGAGTAGCAGTGGTTTTTTGGAAAAGCTTGG.