| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Department of Pathology and Center for Immunology, Washington University School of Medicine,
Howard Hughes Medical Institute, St. Louis, MO 63110; and
Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins Medical Institutions, Baltimore, MD 21231
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
We recently identified a receptor expressed on lymphocytes, B and T lymphocyte attenuator (BTLA) (15), which shared features with these other costimulatory receptors. Similar to CD28, ICOS, CTLA-4, and PD-1, BTLA contains a single Ig domain and is expressed exclusively by lymphoid cells. Similar to PD-1, BTLA contains ITIMs, and like PD-1 and CTLA-4 associates with Src homology domain 2-containing protein tyrosine phosphatase 1 (SHP-1) and SHP-2 (15, 16). BTLA–/– lymphocytes showed increased proliferation (15, 17), and BTLA–/– mice showed enhanced susceptibility rather than resistance to peptide-induced experimental allergic encephalomyelitis (15), suggesting an inhibitory activity. Distinct from CTLA-4 and PD-1, BTLA contains another tyrosine-based motif similar to those interacting with the Grb2 adaptor molecule (18). Finally, we recently showed that the ligand for BTLA is the TNFR family member herpesvirus entry mediator (19).
Independently, Kaye and colleagues (17) recently characterized BTLA expression and analyzed behavior of BTLA–/– T cells, confirming our interpretation of BTLA as an inhibitory receptor. In addition, that study reported BTLA expression on additional lymphoid cells including dendritic cells and macrophages (17) and noted differences in the Ig domain between two mouse strains, BALB/c and C57BL/6. We had also noted polymorphisms in the sequence of BTLA cDNA isolated from murine cell lines derived from distinct backgrounds. Therefore, the purpose of this study was to resolve discrepancies regarding the pattern of BTLA expression by lymphoid subsets, and to characterize the basis of the observed sequence polymorphisms in murine BTLA.
Our approach involved the generation of a panel of mAbs to BTLA capable of distinguishing between allelic variants expressed by different strains. Such reagents provided the means to directly test for potential expression level polymorphisms between alleles of BTLA. In addition, these regents were used to further characterize BTLA expression and regulation in CD4+ T cells during activation and induction of anergy. We find that murine BTLA exhibits both structural and expression polymorphisms between various murine genetic backgrounds, and is selectively induced to high levels on anergic T cells rather than on CD25+ T regulatory cells. These data suggest that BTLA may play a complex regulatory role during the immune response that is distinct from the general inhibitory role mediated by CTLA-4 and PD-1.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
The following Abs used for FACS analysis were from BD Pharmingen: CD4-CyChrome (RM4-5), CD8-FITC (53-6.7), B220-allophycocyanin (RA3-6B2), CD11b-FITC (M1/70), CD11c-FITC (HL3), DX5-FITC, I-Ad-PE (AMS-32.1), I-Ab-PE (AF6-120.1), IgM-PerCP Cy5.5 (R6.60.2), CD21/CD25-FITC (7G6), CD25-allophycocyanin (PC61), CD62 ligand-FITC (MEL-14), Thy1.1-PerCP (OX-7), goat anti-mouse Ig-PE, mouse anti-Armenian/Syrian hamster IgG-PE (mixture), Streptavidin (SA)-PE, SA-CyChrome, and SA-allophycocyanin. KJ1-26 TriColor, hamster IgG-biotin, and murine IgG1-biotin were from Caltag Laboratories. All FACS analysis included an initial incubation with 2.4G2 (anti-CD16/CD32; BD Pharmingen) to block Fc receptor interactions. DO11.10 TCR transgenic mice were as described (20). C3-hemagglutinin (HA)high mice were as described (21). Immunoprecipitation (IP) Western blot analysis was conducted as previously described (16). Conditions used to induce Th1 and Th2 development were as previously described (22).
Sequencing of BTLA and PD-1 Ig domains
Exon 2 of BTLA or PD-1, encompassing the Ig domain, was amplified by PCR from genomic DNA from a panel of mouse strains previously described (23) using Easy-A High Fidelity PCR Cloning Enzyme (Stratagene) and the following intronic primers: BTLA (sense) ATGGTCCTTCTAAGAGTGAAC, (antisense) ATAGATGGTCTGGGGTAGATC and PD-1 (sense) CAGGCTCCTTCCTCACAGC, (antisense) CTAAGAGGTCTCTGGGCAG-3'.
PCR products were cloned into the pGEM-T Easy vector (Promega) and inserts from at least three individual subclones from each strain were sequenced using the T7 universal primer.
Generation of soluble BTLA Ig domain
The Ig domain of C57BL/6 BTLA was PCR amplified from cDNA using the following primers: BTLA (sense) CATGCCATGGAGAAAGCTACTAAGAGGAAT and BTLA (antisense) CGGGATCCTGAAGAGTTTTGAGTCCTTTC-3'. The product was subcloned into the pET28 vector (Novagen) that had been modified to contain a BirA biotinylation sequence (GGGLNDIFEAQKIEWHE) onto the C terminus of the BTLA Ig domain (24). Proteins were expressed as insoluble inclusion bodies in BL21 (DE3) Codon Plus RIL cells (Stratagene) and refolded as described (24).
Production of mAbs to BTLA
Armenian hamsters or BALB/c background BTLA–/– mice were immunized with 100 µg of refolded C57BL/6 BTLA Ig domain protein in CFA, boosted biweekly with 100 µg of protein in IFA, and received a final i.v. boost 3 days before fusion. Splenocytes were fused with the P3X63Ag8 myeloma, and hybridoma supernatants screened for binding to BJAB cells expressing either C57BL/6 or BALB/c BTLA Ig domains as GFP fusion proteins. The BTLA-GFP chimera was prepared by splicing by overlap extension (SOEing). A PCR fragment containing the BTLA cDNA with a 3' tail annealing to the 5' end of GFP was amplified by PCR made using Vent polymerase, the primers J10RV1–BglII (AGCTCTGAAGATCTCTAGGGAGGAAG) and 3' J10+10 (CCTTGCTCACACTTCTCACACAAATGGATGC) with DO11.10 BTLA cDNA as template. A second fragment containing GFP cDNA, without its start codon, with a 5' tail annealing to the 3' end of BTLA was amplified by PCR using Vent polymerase and the primers 5' GFP+10 (TGTGAGAAGTGTGAGCAAGGGCGAGGAGC) and 3' GFP+Sal (ACGCGTCGACTTACTTGTACAGCTCGTCCATG) with the GFP cDNA as template. The chimeric BTLA-GFP fusion cDNA was amplified by PCR from a mixture of these two PCR fragments using the primers J10RV1–BglII and 3' GFP+Sal, digested with BglII and SalI, and cloned into the BglII/SalI sites of IRES-GFP-RV to produce DO11.10-BTLA-GFP-RV. A cytoplasmic deletion was made using site directed mutagenesis (Stratagene) and the primers mj11trunc top (GTTGATATTCCAGTGAGCAAGGGCGAGGAG) and mj11trunc bottom (CTTGCTCACTGGAATATCAACCAGGTTAGTG) to produce DO11.10-BTLA-trunc-GFP-RV. The C56BL/6 version of BTLA trunc-GFP-RV was made by purifying a natural BglII/BamHI fragment from a BTLA cDNA cloned from a mouse spleen cDNA phage library (Stratagene). This fragment was then cloned into the BglII/BamHI digested DO11.10-BTLA trunc-GFP-RV to produce C57BL/6-BTLA trunc-GFP-RV.
Positive hybridomas were expanded and Abs purified using MAPS II-protein A columns. Hamster monoclonal 6A6 is of the IgG isotype, whereas all murine Abs are IgG1
. Unless otherwise stated, all Abs were biotinylated using EZ-Link Sulfo-NHS-LC-biotin (Pierce) and detected with SA-conjugated fluorochromes. This procedure eliminated secondary Ab cross-reactivity with murine cells.
Yeast display mapping
The Ig domain of the C57BL/6 BTLA allele was amplified from cDNA using the primers 5'-GGAATTCCATATGCAGCCAAGTCCTGCCTG-3' and 5'-CATGCTAGCGAGAAAGCTACTAAGAGGAA-3' and subcloned into the NdeI and the NheI sites of the pCT302-AGA2d vector (25) to create an HA-tagged fusion to the Aga2 peptide. QuickChange mutagenesis was used to introduce mutations into this construct using the following primer pairs: C26At, CAGTGCAACTTAATATTACGAGGAATTCCAAACAG; C26Ab, CTCGTAATATTAAGTTGCACTGGACACTCTT; C32At, GCAACTTACTATTAAGAGGAATTCCAAACAGTCTGC; C32Ab, AATTCCTCTTAATAGTAAGTTGCACTGGACA; G48Ct, GAATCCCAAACACTCTGCCAGGACAGGAGAGT; G48Cb, CTGGCAGAGTGTTTGGAATTCCTCGTAATAG; A55Tt, ACAGTCTGCCTGGACAGGAGAGTTATTTAAAATT; A55Tb, TCCTGTCCAGGCAGACTGTTTTGAATTCCT; C79Gt, GAGTTATTTAAAATTGAATGTCCTGTGAAATACTGTGT; C79Gb, AGGACATTCAATTTTAAATAACTCTCCTGTCC; T147Gt, ATGGAACAATCTGGGTACCCCTTGAGGTTAGCC; T147Gb, GGGTACCCAGATTGTTCCATTGTGCTTAC; A163G/T168Gt, TTGAGGTTGGCCCGCAGCTATACACTAG; A163/T168Gb, GCTGCGGGCCAACCTCAAGGGGTACACAGA; A197Gt, TTGGGAAGAAAATCGATCAGTTCCGGTTTTTGTTCT; A197Gb, AACTGATCGATTTTCTTCCCAACTAGTGTA; C320Gt, ATCCATGTGAGAGAAAGGACTCAAAACTCTTCA; and C320Gb, AGTCCTTTCTCTCACATGGATGGTTACTGAATG.
Transformation of EBY100.Aga1 yeast with each construct resulted in surface expression of the BTLA mutant. Expression level was confirmed by anti-HA staining. Yeast cells were stained with anti-BTLA Abs as indicated to determine mutations that abolished Ab recognition.
CD4+ T cell activation and expression analysis
DO11.10 TCR transgenic cells were activated with 0.3 µM OVA peptide (amino acids 323–339) and irradiated (2000 rad) BALB/c splenic APCs as described (20). Th1 conditions consisted of heat-killed Listeria monocytogenes, IL-2 (40 U/ml; Takeda Chemical Industries), and 10 µg/ml anti-IL-4 (11B11). Th2 cells were differentiated in 100 U/ml IL-4, 3 µg/ml anti-IL-12 (TOSH), and IL-2. Cells were restimulated with Ag and APCs on days 7 and 14. Th1/Th2 phenotypes were confirmed at days 7 and 14 by intracellular cytokine staining for IFN-
and IL-4.
Gene microarray
Anergic T cells were isolated by adoptively transferring 2.5 x 106 Thy1.1+ HA-specific T cells to recipient mice (C3-HAhigh) as previously described (21, 26, 27). After 4 days in vivo, animals were sacrificed via CO2 asphyxiation. Spleens were harvested, and subjected to ACK lysis. Adoptively transferred HA-specific T cells were enriched by binding the resulting cells with Abs to CD8a (53-6.7), B220 (RA3-6B2) and Thy1.2 (30-H12), followed by incubation with SA-conjugated magnetic microbeads (Miltenyi Biotec). Unwanted cells were depleted by passage over LS columns (Miltenyi Biotec) according to the manufacturer’s protocol. The remaining cells were stained with an Ab to Thy1.1 (OX-7) and further enriched using fluorescence-based cell sorting on a FACSVantage TurboSort (BD Biosciences). The resulting populations were between 95 and 99% pure. Cells were kept at 4°C throughout the enrichment procedure. In vitro assays confirmed the anergic phenotype of the sorted cells (data not shown). All Abs were purchased from BD Pharmingen. This procedure specifically avoids ligation of the TCR or CD4 during the isolation process. Activated, memory and naive clonal T cells were isolated in an analogous manner, using a specific viral construct (vaccinia-HA) to activate the cells after adoptive transfer to nontransgenic B10.d2 mice. RNA was isolated from each T cell population using the RNAeasy kit according to the manufacturer’s instructions (Qiagen), and cRNA probe was prepared. Fragmented cRNA was hybridized to mouse GeneChips MU174A, MU174B, and MU174C per Affymetrix standard hybridization protocol. Each chip contained 
12,000 different genes (chip A) per expressed sequence tag (EST) with (chips B and C), for a total of 36,000 genes per EST from the three chips. A single gene/EST was represented by a probe set defined by 16–20 perfect match oligonucleotides that span the length of the gene, as well as 16 oligonucleotides with 1 bp mismatch. The intensity of a gene was determined by evaluating the perfect match and mismatch intensities, as described in Affymetrix Microarray Suite, version 5.1 software (Affymetrix). The experiment was replicated once, for a total of two replicate intensities within each condition. To identify probe sets associated with an anergic phenotype, we used the hypothesis-based analysis of microarrays algorithm as previously described (28) with the boolean hypothesis day 4 anergy > naive AND day 4 anergy > day 4 activation.
Assessment of anergy by proliferation
On indicated days following transfer of HA-TCR transgenic T cells, 20 x 106 splenocytes were incubated with increasing doses of HA peptide. Proliferation was assayed after 48 h, with a [3H]thymidine pulse in the final 12 h.
BTLA expression by naive, activated, and anergic CD4+ T cells
HA-TCR transgenic T cells were enriched by depletion of CD8+ and B220+ cells as earlier described. Cells were CFSE-labeled as previously described (29) before adoptive transfer of 2.5 x 106 clonotypic cells via tail vein injection. Cells were stained with anti-Thy1.1 PerCP and the anti-BTLA Ab 6F7-biotin, followed by SA-PE.
Purification and activation of CD4+CD25+ T regulatory cells
Splenocytes and lymph node cells from BALB/c mice were isolated. Following erythrocyte lysis, B220+ cells were depleted by magnetic separation with anti-B220 Microbeads (Miltenyi Biotec). The negative fraction was stained with CD25-PE (BD Pharmingen) and anti-PE Microbeads (Miltenyi Biotec) and magnetically separated into CD25+ and CD25– fractions. Enrichment was assessed by FACS as shown (see Fig. 7D). Contaminating non-CD4+ cells were mainly B220+ or CD8+ cells. To activate T cells, 1 x 106 cells/ml of each fraction were cultured on flat-bottom plates coated with 10 µg/ml 2C11 (anti-CD3; BD Pharmingen) for 48 h. Cells were pulse with 1 µCi/well [3H]thymidine for an additional 12 h.
|
Eight-week-old BTLA+/+ and BTLA–/– littermate mice on the 129SvEv background were immunized i.p. with 50 µg of nitrophenyl (NP)-Ficoll (Biosearch Technologies) in Imject alum (Pierce). Sera were collected on day 14, and the titers of anti-NP were determined by ELISA using NP25-BSA (Biosearch Technologies) for Ab capture and the Southern Biotechnology clonotyping/HRP kit for IgG subclass-specific ELISA (Southern Biotechnology Associates).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
We previously generated BTLA cDNA from several sources, including from the cell line WEHI 231, a commercial murine C57BL/6 splenocyte cDNA library, and 129SvEv mice (15), finding several polymorphisms within the BTLA Ig domain coding sequence. To determine the basis of differences, we sequenced the coding region for the BTLA Ig domain from genomic DNA of several inbred and wild mouse strains (23) (Fig. 1). Among 23 strains, we identified three distinct alleles of BTLA, differing in their predicted amino acid sequence and potential predicted disulphide bonding pattern (Fig. 1A). The allele represented by BALB/c was present in CBA/J, SJL/J, New Zealand White (NZW), BXSB, C3H/J, New Zealand Black (NZB/BinJ), NOD, 129SvEv, and 129Sv/J (Fig. 1B). A second allele, represented by the strains MLR/lpr, AKR, SWR, CALB/RK, and DBA/2J, differed from the BALB/c allele at only one amino acid, containing histidine rather than asparagine at residue 38 of the BTLA protein. These two alleles each have five cysteine residues within the Ig domain, predicting two disulfide bonds and one unpaired cysteine. The third allele, represented by C57BL/6, was also present in B10.PL and several wild-derived inbred strains, and differed from the BALB/c and MLR/lpr alleles at 10 and 11 amino acid residues, respectively (Fig. 1A). Notably, the C57BL/6 allele has a cysteine at amino acid residue 49, making six total cysteine residues with three predicted disulfide bonds in the BTLA Ig domain. As a control, we found no sequence polymorphisms in the PD-1 Ig domain from BALB/c, MLR/lpr, and C57BL/6 (data not shown).
|
To generate anti-BTLA mAbs, we immunized Armenian hamsters and BTLA–/– BALB/c mice with recombinant Ig domain of the C57BL/6 BTLA allele. To allow the identification of Abs that could potentially recognize either the BALB/c or C57BL/6 allele of BTLA, hybridoma supernatants were screened for binding to BJAB cells expressing either the C57BL/6 or BALB/c allele of BTLA as a GFP fusion protein. One hamster anti-BTLA Ab, 6A6, was identified that reacted only with the C57BL/6, but not the BALB/c, allele of BTLA (Fig. 2A). The majority of the murine anti-BTLA mAbs reacted with both the C57BL/6 and BALB/c BTLA alleles, including 6F7, 6G3, 8F4, and 3F9.D12 (Fig. 2B). One murine Ab, 3F9.C6, reacted only with C57BL/6 BTLA, and not with BALB/c BTLA. Another Ab, 6H6, reacted with both alleles, but stained the C57BL/6 allele more highly than the BALB/c allele. For each of these Abs, staining was observed on wild type splenocytes, but not splenocytes of BTLA–/– mice (Fig. 2C, and data not shown), suggesting that these Abs in fact recognize BTLA, and react with native BTLA as well.
|
Notably, although equivalent amounts of each BTLA allele were immunoprecipitated when assessed by immunoblotting for the GFP epitope of the fusion proteins, detection of the Ig domain by IP Western blot analysis was not equally efficient. Following immunoprecipitation, the C57BL/6 BTLA Ig domain was detected much more strongly than the BALB/c allele by 6G3 and 6F7, both pan-specific anti-BTLA Abs, (Fig. 2D, top panel, lanes 1, 2, and 4–6). These results may indicate differential sensitivity between alleles for recognition or detection of the Ig domains, even using pan-specific Abs, which could result from differential sensitivity to denaturation of the antigenic epitope. Whatever the cause, it is necessary to consider this fact when using IP Western blot analysis in comparing BTLA from varying allelic backgrounds. Finally, certain Abs allow coimmunoprecipitation of BTLA-associated proteins. For example, IP Western blot analysis using 6A6 reproduces the known (15) specific and inducible coassociation of SHP-2 with BTLA following pervanadate treatment (Fig. 2E).
Mapping antigenic epitopes recognized by anti-BTLA Abs
To map which of the polymorphic residues differing between BALB/c and C57BL/6 BTLA were involved in strain-specific reactivity of 6A6 and 3F9.C6, we used yeast display technology (30). We first expressed the BTLA Ig domain as an Aga2 fusion protein, and then generated a series of mutant BTLA Ig domains with single amino acid substitutions at the polymorphic residues, replacing BALB/c residues into the C57BL/6 allele one residue at a time (Fig. 3). This series of wild type and mutant BTLA proteins were then analyzed for reactivity with pan-specific anti-BTLA mAbs and two B6-specific Abs, 6A6 and 3F9.C6 (Fig. 3). As a positive control, we confirmed that the pan-specific anti-BTLA mAb 6F7 recognized the wild type C57BL/6 BTLA Ig domain, and also recognized each of the single residue substitutions of BTLA (Fig. 3, left column), as expected for pan-specific reactivity. In contrast, the two C57BL/6-specific Abs recognized some, but not all of BTLA mutants. Specifically, 6A6 showed a very selective loss of reactivity only with the Q27E, C49W, and Q66R substitutions, indicating that these residues are involved in the strain-specific recognition of BTLA. A distinct pattern of reactivity was observed with 3F9.C6, with a selective loss of reactivity with the R107W substitution and reduced reactivity with the Q27E substitution. Also, whereas 6A6 reactivity is sensitive to the C49W substitution, which disrupts one of three predicted disulphide bonds, 3F9.C6 reactivity remains in this substitution. These results indicate that the C57BL/6 specificity of these two Abs derive from interactions with the distinct, but polymorphic, region of the BTLA Ig domain.
|
Distribution and expression of murine BTLA
In our previous studies (15, 16), we were restricted to analyzing BTLA expression either by mRNA expression or by using epitope-tags because we lacked Abs to native BTLA. Conceivably, we failed to detect low but physiologically important levels of BTLA on certain lymphocyte subsets for this reason. Thus, we examined BTLA surface expression on various lymphoid subsets again, using both allele-specific Ab 6A6 and pan-specific Ab 6F7 (Fig. 4).
|
We also examined BTLA expression in splenic B cell populations (Fig. 4B). BTLA expression was detected at the highest levels on follicular B cells (IgMlowCD21/CD35int), and at reduced levels on marginal zone B cells (IgMhighCD21/CD35high) and transitional B cells (IgMlowCD21/CD35low) (Fig. 4B). Notably, because the 6F7 pan-specific Ab was used for analysis, we can also conclude that the levels on each subpopulation of B cells are similar between C57BL/6 and BALB/c mice (Fig. 4B).
We next examined BTLA expression in thymocyte and B cell development (Fig. 5). In thymus, BTLA was expressed at highest levels on mature CD4+ T cells, and at slightly reduced levels on CD8+ T cells (Fig. 5A). BTLA expression on immature CD4–CD8– T cells or CD4+CD8+ double positive T cells was nearly undetectable (Fig. 5A). In bone marrow, BTLA was expressed at the highest levels on B220highIgM+ mature B cells (Fig. 5B), and was detected at relatively low levels on B220low/IgM+ immature B cells. BTLA expression was undetectable on B220+IgM– pro-B cells and pre-B cells. Further, we found no differences between C57BL/6 or BALB/c mice for the levels of BTLA expression on the thymocyte and bone marrow populations.
|
|
Selective induction of BTLA on anergic T cells
Previously, a method of anergy induction for naive CD4+ T cells was developed that involves adoptive transfer of Ag-specific CD4+ T cells into recipients expressing Ag on somatic tissues (21, 26). Specifically, clone 6.5 transgenic T cells, reactive to HA peptide 110–120 presented by I-Ad, become anergic when transferred into recipient mice expressing a membrane bound form of HA targeted for expression on lung and prostate tissue (27). We analyzed BTLA expression following T cell transfer on various days after transfer using Affymetrix gene arrays and FACS (Fig. 7, A and B). We found that BTLA mRNA was highly induced in these anergic CD4+ T cells in this system, compared with CD4+ T cells activated by Ag-expressing vaccinia virus (Fig. 7A). At 2 days after transfer, BTLA expression by T cells undergoing anergy induction was twice the level of naive T cells, and significantly higher than activated T cells. This induction was more evident by day 3 and day 4 following transfer, with BTLA expression 3-fold higher than in naive T cells. By contrast, BTLA levels were substantially reduced in fully activated T cells compared with naive or anergic T cells at these times (Fig. 7A). As a control, myosin VIIa, a constitutive "housekeeping" gene, showed essentially no change in these three conditions over these times. Thus, BTLA mRNA appears to decline more rapidly than BTLA surface protein in activated T cells because activated T cells express peak BTLA surface levels at day 2 (Fig. 6), but show reduced BTLA mRNA (Fig. 7B). These observations are consistent with the reduced BTLA surface expression by day 4 and the essentially undetectable BTLA expression by day 7.
We next measured BTLA expression by FACS under conditions of anergy induction or activation (Fig. 7B). Notably, the highest levels of BTLA surface expression coincided with induction of anergy in vivo. Specifically, 6 days after transfer, anergic T cells expressed 10-fold higher BTLA than naive T cells, and 3-fold higher than in vivo-activated T cells (Fig. 7B). We verified that the CD4+ T cells transferred into HA-expressing recipients did become anergic as defined by lack of proliferation (Fig. 7C), consistent with previous reports (26). For comparison, we also wished to evaluate BTLA expression on conventional naive CD4+ T cells (CD4+CD25–) T cells or T regulatory cells (CD4+CD25+) either as resting cells ex vivo or after in vitro activation with anti-CD3 (Fig. 7D). As expected, BTLA was expressed at low levels on naive T cells, and was induced 10-fold 36 h after anti-CD3 treatment. Freshly isolated T regulatory cells expressed similar levels of BTLA as freshly isolated naive CD4+ T cell, but showed only a slight increase after treatment with anti-CD3 (Fig. 7D). As a control, we confirmed that T regulatory cells, but not naive T cells, expressed PD-1, consistent with previous reports (31). As a further control, we showed that the isolated CD25+ T regulatory cells failed to proliferate in vitro, in contrast to the robust proliferation of freshly isolated naive T cells (Fig. 7E). In summary, BTLA shows a pattern of expression that is somewhat distinct from that of CTLA-4 and PD-1 in terms of its response to anergy induction and expression by T regulatory cells.
Role of BTLA in T cell-independent Ab responses
Our initial analysis of BTLA was motivated by consideration of its role in T cell activation (15). However, the fact that B cells express the highest level of BTLA, and the constitutive nature of this expression, motivated a second examination of its effect on Ab production. In our study, we examined T cell-independent Ab responses using immunization with NP-Ficoll in wild-type mice or BTLA–/– 129SvEv mice, which express the BALB/c allele of BTLA. We immunized cohorts of mice with one injection of NP-Ficoll in alum and measured production of anti-NP Abs of specific isotypes on day 14 (Fig. 8). For the isotypes IgM, IgG1, IgA, we found no specific changes in levels of anti-NP Abs. For IgG2a or IgG2b, we found only slight increases in anti-NP Abs in the BTLA–/– compared with wild-type mice. However, for Abs of the IgG3 isotype, which is primarily associated with T-independent responses, we found an 2-fold increased in anti-NP-specific Abs in BTLA–/– mice compared with wild-type mice. The size of this difference is consistent with the relatively modest increases in B cell and T cell proliferation responses described for BTLA–/– cells previously by both our report (15) and by others (17), and consistent with an inhibitory rather than activating role of BTLA. However, the relatively modest magnitude of this effect could also be an indication that BTLA expression by B cells may serve a purpose other than cell-intrinsic signaling, such as perhaps delivery of a signal toward cells expressing ligands for BTLA.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
In this study, we have reconciled these differences by generating Abs to murine BTLA that either distinguish between allelic variants of BTLA, or recognize BTLA expressed on all laboratory mouse strains. Kaye and colleagues (17) used two Abs, PK3 and PK18, which recognize only the BTLA allele expressed by C57BL/6 strain, but not BALB/c, thus being able to examine BTLA expression on only a subset of mouse strains. With our pan-specific BTLA Abs, we could directly compare BTLA expression on various lymphoid cell types between several strains of mice. Surprisingly, we find polymorphic tissue distribution between C57BL/6 and BALB/c mice in BTLA expression on particular lymphoid cells assayed directly ex vivo. Specifically, using our C57BL/6-specific Ab, 6A6, we confirm that BTLA is expressed on macrophages, NK cells, and dendritic cells, as reported by Kaye and colleagues (17), and on B cells and T cells as we previously described (15). However, using pan-specific mAbs that react with both C57BL/6 and BALB/c BTLA, we can directly demonstrate that the BALB/c allele is expressed by B cells, T cells, and a population of dendritic cells, but not by macrophages or NK cells as assayed directly ex vivo. In contrast in C57BL/6, BTLA is expressed by macrophages or NK cells assayed directly ex vivo.
We previously used cells from the BALB/c background to characterize BTLA tissue distribution because we had included analysis of DO11.10 TCR transgenic T cells in our study, and this line was maintained on the BALB/c background. Further, we did not initially characterize BTLA expression on CD11c+ dendritic cells. Thus, our initial characterization of BTLA expression was accurate for the strain we examined, and the discrepancy between our results (15) and those of Kaye and colleagues (17) may largely be due to an unexpected BTLA expression polymorphism. The basis of this expression polymorphism is not clear, and could be due either to actual differences in genetic regulatory elements directly controlling BTLA, or alternately to differences in the state of physiologic activation operating in vivo in unmanipulated mice. In any case, this difference, and the structural differences in the Ig domain that may impact in vivo activity of BTLA, should be considered in ongoing analysis of the functional role of BTLA in the immune system.
The present study describes interesting features regarding the regulation of BTLA expression. BTLA expression by mature B cells appears constitutive, and is acquired during the later stages of B cell development in the bone marrow. This pattern contrasts with a more complicated expression pattern on T cells. In the thymus, BTLA is undetectable in double negative and double positive thymocytes, and expressed at low levels on mature CD4+ and CD8+ T cells, which are maintained in the periphery. Following Ag-specific activation of CD4+ T cells, BTLA is rapidly induced, with peak surface expression by day 2, quickly diminishing by day 4, and nearly undetectable by day 7. Similarly, secondary reactivation of T cells leads to rapid BTLA induction. However, upon tertiary reactivation, BTLA induction is maintained only in Th1, and not Th2, culture conditions. We have not exhaustively examined subsequent regulation of BTLA induction in vitro, but we have noted long-term Th1 clones to express BTLA.
This study has uncovered an additional and unique aspect of BTLA expression in CD4+ T cells, in that it is most highly expressed following anergy induction. We have studied a system of anergy in which CD4+ T cells encounter Ag expressed by somatic tissues, proceed through an activated effector phase, followed by the development of an anergic phenotype (27). In examining gene expression in this system, we found BTLA to be one of the most highly induced genes selectively expressed in anergic CD4+ T cells. We confirmed this observation using FACS analysis, again finding the highest level of BTLA surface expression on anergic T cells compared with naive or normally activated CD4+ T cells. By contrast, BTLA was not highly expressed on naturally occurring CD25+ T regulatory cells, unlike PD-1 and CTLA-4. Even following TCR activation, the CD4+CD25+ population failed to induce high levels of BTLA. Thus, not only is regulation of BTLA clearly different between T cells and B cells, but its expression within T cells subsets is clearly distinct from that of CTLA-4 and PD-1.
This study also demonstrated a modest enhancement in the BTLA-deficient mouse of T cell-independent IgG3 isotype responses, again suggesting an inhibitory role of BTLA in B cells. We note that the magnitude of this effect is only 2- to 3-fold. Although it is conceivable that such small effects could contribute to fine-tuning of the Ab response, and that this effect is the raison d’etra of BTLA, we would suggest instead that there might be circumstances showing greater differences between wild type and BTLA–/–, such as in models of transplantation and graft-vs-host disease (data not shown). Thus, in pursuing BTLA function in various experimental models, it will be necessary to keep in mind the role that polymorphisms in BTLA structure and expression might play, as well as distinct regulation of BTLA in T cells that may differ between the various strains of mice used in these experimental models.
|
Disclosures |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
|
Acknowledgments |
|---|
|
Footnotes |
|---|
1 This work was supported in part by grants from the National Institutes of Health. K.M.M. is an investigator of the Howard Hughes Medical Institute. 
2 Address correspondence and reprint requests to Dr. Kenneth M. Murphy, Department of Pathology, Washington University School of Medicine, 660 South Euclid Avenue, St. Louis, MO 63110. E-mail address: murphy{at}pathology.wustl.edu
3 Abbreviations used in this paper: PD-1, programmed death-1; SHP, Src homology domain 2-containing protein tyrosine phosphatase; BTLA, B and T lymphocyte attenuator; SA, streptavidin; HA, hemagglutinin; IP, immunoprecipitation; EST, expressed sequence tag; NP, nitrophenyl.
Received for publication September 21, 2004. Accepted for publication December 30, 2004.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionDisclosuresReferences |
|---|
. Immunity 11:423.[Medline]
This article has been cited by other articles:
|
|
 |
|
  Y. Sun, N. K. Brown, M. J. Ruddy, M. L. Miller, Y. Lee, Y. Wang, K. M. Murphy, K. Pfeffer, L. Chen, J. Kaye, et al. B and T Lymphocyte Attenuator Tempers Early Infection Immunity J. Immunol., August 1, 2009; 183(3): 1946 - 1951. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Crawford and E. J. Wherry Editorial: Therapeutic potential of targeting BTLA J. Leukoc. Biol., July 1, 2009; 86(1): 5 - 8. [Full Text] [PDF]
|
|
|
|
|
|
W. Truong, W. W. Hancock, J. C. Plester, S. Merani, D. C. Rayner, G. Thangavelu, K. M. Murphy, C. C. Anderson, and A. M. J. Shapiro BTLA targeting modulates lymphocyte phenotype, function, and numbers and attenuates disease in nonobese diabetic mice J. Leukoc. Biol., July 1, 2009; 86(1): 41 - 51. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Liu, M. Alexiou, N. Martin-Orozco, Y. Chung, R. I. Nurieva, L. Ma, Q. Tian, G. Kollias, S. Lu, D. Graf, et al. Cutting Edge: A Critical Role of B and T Lymphocyte Attenuator in Peripheral T Cell Tolerance Induction J. Immunol., April 15, 2009; 182(8): 4516 - 4520. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. C. Vendel, J. Calemine-Fenaux, A. Izrael-Tomasevic, V. Chauhan, D. Arnott, and D. L. Eaton B and T Lymphocyte Attenuator Regulates B Cell Receptor Signaling by Targeting Syk and BLNK J. Immunol., February 1, 2009; 182(3): 1509 - 1517. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. W. Steinberg, O. Turovskaya, R. B. Shaikh, G. Kim, D. F. McCole, K. Pfeffer, K. M. Murphy, C. F. Ware, and M. Kronenberg A crucial role for HVEM and BTLA in preventing intestinal inflammation J. Exp. Med., June 9, 2008; 205(6): 1463 - 1476. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. A. Nelson, M. D. Fremont, J. R. Sedy, P. S. Norris, C. F. Ware, K. M. Murphy, and D. H. Fremont Structural Determinants of Herpesvirus Entry Mediator Recognition by Murine B and T Lymphocyte Attenuator J. Immunol., January 15, 2008; 180(2): 940 - 947. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. De Trez, K. Schneider, K. Potter, N. Droin, J. Fulton, P. S. Norris, S.-w. Ha, Y.-X. Fu, T. Murphy, K. M. Murphy, et al. The Inhibitory HVEM-BTLA Pathway Counter Regulates Lymphotoxin Receptor Signaling to Achieve Homeostasis of Dendritic Cells J. Immunol., January 1, 2008; 180(1): 238 - 248. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Lepenies, K. Pfeffer, M. A. Hurchla, T. L. Murphy, K. M. Murphy, J. Oetzel, B. Fleischer, and T. Jacobs Ligation of B and T Lymphocyte Attenuator Prevents the Genesis of Experimental Cerebral Malaria J. Immunol., September 15, 2007; 179(6): 4093 - 4100. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Hurchla, J. R. Sedy, and K. M. Murphy Unexpected Role of B and T Lymphocyte Attenuator in Sustaining Cell Survival during Chronic Allostimulation J. Immunol., May 15, 2007; 178(10): 6073 - 6082. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Xu, A. S. Flies, D. B. Flies, G. Zhu, S. Anand, S. J. Flies, H. Xu, R. A. Anders, W. W. Hancock, L. Chen, et al. Selective targeting of the LIGHT-HVEM costimulatory system for the treatment of graft-versus-host disease Blood, May 1, 2007; 109(9): 4097 - 4104. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. C. Beier, T. Kallinich, and E. Hamelmann Master switches of T-cell activation and differentiation Eur. Respir. J., April 1, 2007; 29(4): 804 - 812. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Chemnitz, A. R. Lanfranco, I. Braunstein, and J. L. Riley B and T Lymphocyte Attenuator-Mediated Signal Transduction Provides a Potent Inhibitory Signal to Primary Human CD4 T Cells That Can Be Initiated by Multiple Phosphotyrosine Motifs. J. Immunol., June 1, 2006; 176(11): 6603 - 6614. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Deppong, T. I. Juehne, M. Hurchla, L. D. Friend, D. D. Shah, C. M. Rose, T. L. Bricker, L. P. Shornick, E. C. Crouch, T. L. Murphy, et al. Cutting Edge: B and T Lymphocyte Attenuator and Programmed Death Receptor-1 Inhibitory Receptors Are Required for Termination of Acute Allergic Airway Inflammation J. Immunol., April 1, 2006; 176(7): 3909 - 3913. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. M. Compaan, L. C. Gonzalez, I. Tom, K. M. Loyet, D. Eaton, and S. G. Hymowitz Attenuating Lymphocyte Activity: THE CRYSTAL STRUCTURE OF THE BTLA-HVEM COMPLEX J. Biol. Chem., November 25, 2005; 280(47): 39553 - 39561. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Krieg, P. Han, R. Stone, O. D. Goularte, and J. Kaye Functional Analysis of B and T Lymphocyte Attenuator Engagement on CD4+ and CD8+ T Cells J. Immunol., November 15, 2005; 175(10): 6420 - 6427. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Tao, L. Wang, R. Han, T. Wang, Q. Ye, T. Honjo, T. L. Murphy, K. M. Murphy, and W. W. Hancock Differential Effects of B and T Lymphocyte Attenuator and Programmed Death-1 on Acceptance of Partially versus Fully MHC-Mismatched Cardiac Allografts J. Immunol., November 1, 2005; 175(9): 5774 - 5782. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. H. Watts and J. L. Gommerman The LIGHT and DARC sides of herpesvirus entry mediator PNAS, September 20, 2005; 102(38): 13365 - 13366. [Full Text] [PDF]
|
|
|
|
|
|
T. C. Cheung, I. R. Humphreys, K. G. Potter, P. S. Norris, H. M. Shumway, B. R. Tran, G. Patterson, R. Jean-Jacques, M. Yoon, P. G. Spear, et al. From The Cover: Evolutionarily divergent herpesviruses modulate T cell activation by targeting the herpesvirus entry mediator cosignaling pathway PNAS, September 13, 2005; 102(37): 13218 - 13223. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
