The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tumang, J. R.
Right arrow Articles by Rothstein, T. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tumang, J. R.
Right arrow Articles by Rothstein, T. L.
The Journal of Immunology, 2005, 174: 3173-3177.
Copyright © 2005 by The American Association of Immunologists

CUTTING EDGE

Cutting Edge: Spontaneously Ig-Secreting B-1 Cells Violate the Accepted Paradigm for Expression of Differentiation-Associated Transcription Factors1

Joseph R. Tumang2,*, Rubén Francés2,*, Seung Geun Yeo3,* and Thomas L. Rothstein4,*,{dagger},{ddagger}

Departments of * Medicine and {dagger} Microbiology, Boston University School of Medicine, and {ddagger} Immunobiology Unit, Evans Memorial Department of Clinical Research, Boston University Medical Center, Boston, MA 02118


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
B-1 cells spontaneously secrete natural Ig that acts as a primary line of defense against infection. A major shortfall in our understanding of this key process centers on the molecular mechanisms regulating natural Ab secretion by B-1 cells. Herein, we demonstrate that secreting B-1 cells use some aspects of the recently recognized plasmacytic differentiation program but deviate from it in important ways. Specifically, we show that key repressors of the plasmacytic program, B cell leukemia/lymphoma-6 and paired box gene 5, are reduced in spontaneously secreting B-1 B cells, as in stimulated differentiated B-2 cells. Surprisingly, we find that key promoters of the plasmacytic program, B lymphocyte inducer of maturation program 1 and X-box binding protein 1, are not up-regulated in secreting B-1 cells, in contrast to secreting B-2 cells. These data demonstrate that B-1 cells operate under a differentiation program that is unique and differs from the paradigm associated with Ig-secreting B-2 cells.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results and Discussion
 Disclosures
 References
 
B-1 cells spontaneously secrete natural Ig, which plays a critical role in host immune defense. Natural Ig contains specificities for pathogens and pathogen-associated epitopes (1, 2, 3, 4); these specificities have been shown to be protective in vivo (4, 5, 6, 7). Although the importance of these crucial effector molecules is well understood, the mechanisms regulating natural Ab production are not. One accepted paradigm for Ig secretion derived from studies of LPS-stimulated B-2 cell plasma cell differentiation focuses on a central cascade controlled by four transcription factors, B cell leukemia/lymphoma-6 (BCL-6),5 B lymphocyte inducer of maturation program 1 (BLIMP-1), paired box gene 5 (PAX-5), and X-box binding protein 1 (XBP-1) (reviewed in Refs. 8, 9). According to this model, BCL-6 and PAX-5a repress, and BLIMP-1 and XBP-1 stimulate, genes associated with differentiation to Ig secretion. These transcription factors are thought to act in cascade fashion, such that naive, nonsecreting B-2 cells express elevated BCL-6 that represses BLIMP-1 and elevated PAX-5 that represses XBP-1, whereas coincident with plasmacytic differentiation the level of BCL-6 falls, releasing repression of BLIMP-1 which rises, thereby suppressing PAX-5a, which in turn releases XBP-1 which also rises. Thus, the current paradigm holds that differentiated Ig-secreting B cells express low levels of BCL-6 and PAX-5a, but high levels of BLIMP-1 and XBP-1.

BLIMP-1 in particular is currently cast as the master regulator of plasmacytic differentiation on the basis of several key observations. Normal plasma cells express BLIMP-1 (10), and ectopic expression of BLIMP-1 induces plasma cell differentiation (11). Conversely, BLIMP-1-deficient mice are deficient in serum Ig and B cells from these mice fail to mature to plasma cells and to up-regulate the plasma cell associated genes CD138 (syndecan-1) and J-chain (12). Final commitment to the plasma cell differentiation pathway appears to be reinforced through BLIMP-1 back-repression of BCL-6 (13).

The studies described herein were designed to bridge the gap between the physiology of natural Ig secretion and the known molecular mechanisms governing plasmacytic differentiation.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results and Discussion
 Disclosures
 References
 
Animals

Male BALB/cByJ mice at 8–14 wk of age were obtained from The Jackson Laboratory. Mice were cared for and handled in accordance with National Institutes of Health and institutional guidelines.

B cell purification and culture

Sorted B cell populations were obtained on the basis of CD5 and B220 staining as previously described (14), and reanalyzed for purity by immunofluorescent staining with Abs directed against Mac-1, CD43, and CD23. Peritoneal B-1a cells and splenic B-2 cells were found to be ≥96% pure (B220+/CD43+/CD23–/Mac-1+ or B220+/CD43–/CD23+/Mac-1–, respectively). FACS-sorted B cells were cultured in RPMI 1640 medium as previously described (14). Where indicated, cells were cultured in the presence of 25 µg/ml LPS.

ELISPOT assay

FACS-sorted, naive B cells, or B cells cultured for 48 h, were distributed at various dilutions onto MultiScreen*-IP Plates (Millipore) precoated with goat anti-mouse Ig (H+L) and then incubated for 3 h at 37°C and 5% CO2. Plates were treated with alkaline phosphatase-conjugated goat anti-mouse IgM (Southern Biotechnology Associates) and developed with 5-bromo-4-chloro-3-indolyl phosphate/p-NBT chloride substrate (KPL). Ig-secreting cells were enumerated using Phoretix Expression software (NonLinear Dynamics).

Gene expression

RNA was prepared from B cells using Ultraspec reagent (BiotecX) and was DNase treated. cDNA was prepared using avian myeloblastis virus reverse transcriptase (Roche Applied Sciences), and normalized by PCR for {beta}2-microglobulin expression. Gene expression was then assessed by real-time PCR (Stratagene) using the following primers (forward/reverse): {beta}2-microglobulin (CCCGCCTCACATTGAAATCC/GCGTATGTATCAGTCTCAGTGG); BCL-6 (GCAACATCTACTCGCCCAAG/CTTCTTCTTTGCTGGCTTTGT); BLIMP-1 (AAGAGGTTATTGGCGTGGTAAG/ACTTCCTGTTGGCATTCTTGG); PAX-5a (GCTACTCTGCACCGACGCTG/GGGCTGCAGGGCTGTAATAGT); spliced XBP-1 (XBP-1s) (TAGAAAATCAGCTTTTACGGGAGAAA/GGGCCTGCACCTGCTGCGGACTCAG); CD80 (GGGTGCTCTCAGAACCAAGCC/TCTCGTGGTGAGCCCGATC); CD138 (CCCCTCCTTTGACTTCTGCCT/GCAGTCGGGTCCCCTTTCT); cyclin D2 (TGGGCTTCAGCAGGATGATG/ACGGAACTGCTGCAGGCTGT); and J-chain (GCACAGGGGGCAGAAGAT/CGTTGAATGATGGAGGAT).

Protein expression

B cells were extracted and immunoblotted as previously described (15). Membranes were developed using the ECL Western Blotting Analysis System from Amersham Biosciences. As a protein loading control, blots were stripped and reprobed with anti-{beta}-actin Ab (Sigma-Aldrich). A polyclonal anti-BCL-6 Ab (catalog no. 4242) was obtained from Cell Signaling Technology. Monoclonal anti-PAX-5 (sc-13146) and anti-XBP-1 (sc-8015) Abs were obtained from Santa Cruz Biotechnology. mAb specific for BLIMP-1 was kindly provided by Dr. K. Calame (Department of Microbiology, Columbia University, New York, NY). Additional polyclonal Abs to BCL-6 (sc-858) and BLIMP-1 (sc-13206) used to further validate the results were obtained from Santa Cruz Biotechnology.

Reagents

Fluorescent-labeled anti-B220, anti-CD5, and anti-CD8 Abs for FACS staining were obtained from BD Pharmingen. LPS was obtained from Sigma-Aldrich.


   Results and Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
Disclosures
 References
 
B-1 cells spontaneously secrete Ig

We demonstrated spontaneous Ig secretion by highly purified B-1 cells in vitro, through ELISPOT assay using an abbreviated incubation period of just 3 h. We compared naive B-1 and B-2 cells sort-purified at 4°C as described in Materials and Methods with sort-purified B-2 cells stimulated by LPS for 2 days. Results from five independent experiments are shown in Fig. 1. Naive B-2 cells contained only a low background level of Ig-secreting cells (mean ± SEM = 3.1% ± 0.7), whereas LPS stimulation markedly up-regulated the number of Ig-secreting cells detected by ELISPOT, to 25.2% ± 4.7. We found that a substantial proportion of naive B-1 cells, amounting to 20.7% ± 4.0 of the total, secreted IgM within 3 h of purification, approximately the same proportion of Ig-secreting cells found among B-2 cells that had been stimulated with LPS for 2 days. The proportion of Ig-secreting, sort-purified B-1 cells noted in this study is very similar to the proportion previously reported for B-1 cells purified by a lengthier, multistep process (16). As depicted in Fig. 1, spontaneously secreting peritoneal B-1 cells secreted a little less IgM per cell than LPS-stimulated B-2 cells; computer-assisted peak height analysis of scanned ELISPOTs showed that unstimulated B-1 cells secreted ~54.9% ± 6.2 the amount of IgM secreted by LPS-stimulated B-2 cells. Most importantly, these results demonstrate that peritoneal B-1 cells differ markedly from splenic B-2 cells, in that spontaneous IgM secretion is a unique property of the former and not the latter.



View larger version (34K):
[in this window]
[in a new window]
  		FIGURE 1. Naive B-1 cells spontaneously secrete Ig. Left panel, top, Naive or 2 day LPS-stimulated B-2 or naive B-1 cells (2.5 x 103) were seeded for 3 h, after which IgM secretion was assessed by ELISPOT assay. Left panel, bottom, Three-dimensional representation of top panels as generated by Phoretix Expression Software. Right panel, Enumeration of ELISPOT results from five independent experiments, with SEM indicated.

 
B-1 cells express a unique profile of differentiation-associated transcription factors

To determine whether spontaneously secreting peritoneal B-1 cells exhibit a transcriptional profile analogous to that seen in secreting B-2 cells, we analyzed BCL-6, BLIMP-1, PAX-5a, and XBP-1s levels by Western blotting. As in all of these experiments, we directly sorted peritoneal B-1 and splenic B-2 cells at 4°C, after which lysates were immediately prepared, so as to avoid any room temperature or 37°C manipulations during which protein expression might change. Cell extracts were also isolated from sort-purified B-2 cells after 2 days of LPS stimulation. Naive splenic B-2 cells contained substantial levels of immunoreactive BCL-6 and PAX-5a protein which declined following LPS stimulation and the onset of Ig secretion; conversely, naive B-2 cells failed to express detectable levels of BLIMP-1 and XBP-1 protein whereas levels of these transcription factors rose dramatically coincident with LPS stimulation/Ig secretion (Fig. 2A). This pattern of differentiation-associated changes in transcription factor expression—diminished BCL-6, enhanced BLIMP-1, diminished PAX-5a, enhanced XBP-1—reflects the prevailing paradigm for regulation of B cell differentiation to Ig secretion. The profile for B-1 cells, however, differed markedly from that of B-2 cells. Although unstimulated, spontaneously Ig-secreting B-1 cells exhibited reduced levels of BCL-6 and PAX-5a, as might be expected, surprisingly, B-1 cells did not express increased levels of BLIMP-1 and XBP-1. Rather, B-1 cells failed to express BLIMP-1 and XBP-1, much like naive nonsecreting B-2 cells. Moreover, the very low levels of BCL-6, BLIMP-1, PAX-5a, and XBP-1 observed in sorted B-1 cells did not change during the incubation period of 3 h required for ELISPOT assay of Ig secretion (Fig. 2A). Thus, although B-1 cells secrete Ig, they lack the elevated expression of BLIMP-1 and XBP-1 that typifies Ig secretion by B-2 cells.



View larger version (53K):
[in this window]
[in a new window]
  		FIGURE 2. Naive B-1 cells express low protein levels of BCL-6, BLIMP-1, PAX-5a, and XBP-1. A, Whole cell extracts from naive or 2-day LPS-stimulated B-2 cells, naive B-1 cells, and naive B-1 and B-2 cells cultured in medium for 3 h, were immunoblotted for the expression of the transcription factors indicated. B, Lysates from naive or LPS-stimulated B-2 cells mixed at ratios of 100:0, 85:15, 70:30, 40:60, and 0:100, as well as from naive B-1 cells, were immunoblotted and relative protein expression levels determined. C, Naive B-2 and B-1 cells were blotted for the expression of PAX-5 isoforms. All experimental blots were stripped and reprobed for {beta}-actin to ensure equal loading. The ~30 kDa isoforms of immunoreactive Pax-5d and Pax-5e could not be resolved under the conditions used. D, Extracts as in A, above, were obtained from naive, 1-day, and 2-day LPS-stimulated B-2 cells and naive B-1 cells and were immunoblotted for the expression of the transcription factors indicated.

 
To determine the limits of detection for the various transcription factors in our Western blot assays, whole cell lysates from either 2-day LPS-stimulated or naive B-2 cells were pooled together at various ratios according to total protein concentration, and then Western blotted for BCL-6, BLIMP-1, PAX-5, or XBP-1 (Fig. 2B). Lysates from naive B-1 cells were examined at the same time. We found that BLIMP-1 and XBP-1 were both detected in samples containing as little as 15% LPS-stimulated B-2 cell extract. This rules out the remote possibility that LPS stimulation up-regulated BLIMP-1 and XBP-1 expression in 100% of B-2 cells (despite the fact that only 25% are secreting Ig at 2 days), but BLIMP-1 and XBP-1 were up-regulated only in the fraction of B-1 cells actively secreting by ELISPOT assay, because even in this situation B-1 cell BLIMP-1 and XBP-1 would have been detected, which was not the case. We further detected BCL-6 and PAX-5a in pools containing only 40% and 70% naive B-2 cell extract, respectively. This rules out the remote possibility that B-1 cells not secreting by ELISPOT assay (~80% of the total) express levels of BCL-6 and PAX-5a comparable to those of nonsecreting naive B-2 cells, because even in this situation B-1 cell BCL-6 and PAX-5a would have been detected, which was not the case.

The absence of key transcription factors in B-1 cells as detected by Western blotting raised the theoretical possibility that B-1 cell nuclei are more resistant to detergent extraction than B-2 cell nuclei. To rule out the possibility of differential extraction, we examined B-1 and B-2 cell extracts for expression of a faster migrating isoform of PAX-5 not known to be involved in Ig secretion. We found equivalent levels of the ~30 kDa form of immunoreactive PAX-5 (17, 18) in extracts obtained from sort-purified naive B-1 cells, that lack PAX-5a, as from sort-purified naive B-2 cells that express PAX-5a (Fig. 2C). Further, the findings above (Fig. 2A) regarding low level expression of differentiation-asssociated transcription factors by B-1 cells were reproduced when cell pellets were directly dissolved in SDS loading buffer before Western blotting (data not shown).

Although the poor B-1 cell expression of BCL-6, BLIMP-1, PAX-5a, and XBP-1 matches neither naive nor LPS/2-day B-2 cell levels of these transcription factors, the theoretical possibility that B-1 cells correspond to a transitional stage of differentiating B-2 cells was not ruled out by this data. To address this possibility, B-2 cells were evaluated after 0, 24, and 48 h of LPS stimulation (Fig. 2D). We found that at 24 h, in comparison to naive B cells, BCL-6 had declined, BLIMP-1 had risen, PAX-5a had declined, and XBP-1 had risen, but most importantly, all were detected. Thus, there is no stage of LPS-stimulated B-2 cell differentiation that matches the transcription factor characteristics found in unstimulated, but IgM-secreting, B-1 cells. Prior to, and in comparison with, 24 h, BCL-6 and PAX-5a would be even higher even if BLIMP-1 and XBP-1 had not started to rise; conversely, after 24 h, BLIMP-1 and XBP-1 would be even higher even if BCL-6 and PAX-5a had declined to undetectable levels.

B-1 cells express a unique profile of differentiation-associated transcription factor genes

To verify the unique B-1 cell transcription factor profile outline above, we analyzed BCL-6, BLIMP-1, PAX-5a, and XBP-1s transcript levels by real-time quantitative PCR (qPCR). As described above, we directly sorted peritoneal B-1 and splenic B-2 cells at 4°C, after which RNA was immediately prepared, so as to avoid any room temperature or 37°C manipulations during which gene expression might change. RNA was also isolated from sort-purified B-2 cells after 2 days of LPS stimulation. Three independently isolated sets of RNA were examined using specific primers after normalization for {beta}2-microglobulin, which was used as a normalization control in view of our earlier work (14) identifying this as the most stable housekeeping gene across these B cell subsets. Similar results were obtained using {beta}-actin (data not shown). All primer sets were intron-spanning and the absence of amplicons corresponding to genomic sequence provided evidence for the lack of genomic DNA contamination in the analyzed cDNA samples (data not shown). Naive B-2 cells expressed substantial levels of BCL-6 and PAX-5a mRNA which declined following LPS stimulation and the onset of Ig secretion; conversely, naive B-2 cells expressed low levels of BLIMP-1 and XBP-1 mRNA which rose coincident with LPS stimulation/Ig secretion (Fig. 3), as expected from the prevailing paradigm for regulation of B cell differentiation and the results above. The pattern for B-1 cells, however, differed markedly from that of Ig-secreting B-2 cells and in so doing fully matched the Western blot data (Fig. 2). Although unstimulated B-1 cells expressed low levels of BCL-6 and PAX-5a, like LPS-stimulated B-2 cells, this was not accompanied by up-regulated BLIMP-1 and XBP-1. Instead, unstimulated Ig-secreting B-1 cells expressed low levels of BLIMP-1 and XBP-1, much like naive nonsecreting B-2 cells. Thus, although B-1 cells spontaneously secrete Ig, B-1 cells lack the elevated levels of BLIMP-1 and XBP-1 gene expression that typifies Ig secretion by B-2 cells. These results provide strong support for the uniquely low levels of differentiation associated transcription factor in Ig-secreting B-1 cells described above.



View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 3. Naive B-1 cells express low transcript levels of BCL-6, BLIMP-1, PAX-5a, and XBP-1s. Fold expression of the various transcripts relative to naive B-2 cells was determined by qPCR. Results from three independent experiments are shown, along with SEM.

 
Target gene expression in B-1 cells accurately reflects the levels of BCL-6 and BLIMP-1

To further verify the low level of BCL-6, and the unexpectedly low level of BLIMP-1, in Ig-secreting B-1 cells, we evaluated expression of BCL-6 and BLIMP-1 target genes. In particular, we examined CD80 and cyclin D2, genes that are suppressed by BCL-6 (19, 20), and CD138 and J-chain, genes that are elevated upon BLIMP-1 expression (13). Results from three independent experiments are shown in Fig. 4, in which relative values normalized to {beta}2-microglobulin are displayed. Naive B-2 cells that contain substantial amounts of BCL-6 expressed little CD80 and little cyclin D2, suggesting that these genes were suppressed by BCL-6 as expected; conversely, LPS-stimulated B-2 cells, that contain undetectable amounts of BCL-6, expressed levels of CD80 and cyclin D2 that were markedly elevated in comparison to naive B-2 cells, consistent with alleviation of BCL-6 suppression. We found that naive B-1 cells expressed substantial levels of CD80 and cyclin D2, approximating the levels present in LPS-stimulated B-2 cells (Fig. 4), indicating that the low levels of BCL-6 identified in naive B-1 cells (Figs. 2 and 3) fail to suppress BCL-6 target genes. Thus, B-1 cells, like LPS-stimulated B-2 cells, do not experience BCL-6-mediated transcriptional repression in keeping with the low levels of BCL-6 identified in these populations. LPS-stimulated B-2 cells that contain substantial amounts of BLIMP-1 expressed substantial amounts of CD138 and J-chain, suggesting that these genes were induced by BLIMP-1 expression as expected; conversely, naive B-2 cells, that contain undetectable amounts of BLIMP-1, expressed levels of CD138 and J-chain that are markedly reduced in comparison to LPS-stimulated B-2 cells, consistent with the absence of BLIMP-1-mediated induction. We found that naive B-1 cells expressed low levels of CD138 and J-chain, approximating the levels present in naive B-2 cells (Fig. 4), indicating that the low levels of BLIMP-1 identified in naive B-1 cells (Figs. 2 and 3) fail to trigger up-regulation of BLIMP-1 target genes. Parenthetically, although these experiments were intended only to evaluate direct transcriptional activation of specific targets, it should be noted that J-chain is not required for, nor does it regulate the rate of, IgM secretion (21, 22). Thus, naive B-1 cells, like naive B-2 cells, do not experience BLIMP-1-mediated transcriptional induction in keeping with the low levels of BLIMP-1 identified in these populations. The results described above are consistent with previous work showing high CD80 and low CD138 surface expression on peritoneal B-1 cells (14, 23). Further, other BCL-6-repressed (STAT-1, CD44) and BLIMP-1-repressed (ID-3, Spi-B) genes (13, 24) reflect the functional deficiency of BCL-6 and BLIMP-1 in B-1 cells and support the results described above. The normalized (to {beta}2-microglobulin) fold difference in expression between naive B-1 cells (low BCL-6) and naive B-2 cells (high BCL-6) was 1.8 ± 0.042 for STAT-1 and 4.0 ± 0.56 for CD44 (mean ± SEM, n = 3); the normalized fold difference in expression between naive B-1 cells (low BLIMP-1) and LPS-stimulated B-2 cells (high BLIMP-1) was 4.4 ± 0.73 for ID-3 and 5.7 ± 1.8 for Spi-B (mean ± SEM, n = 3). Note that naive B-1 cells have been reported to express elevated levels of CD44 protein (25). Thus, for naive B-1 cells, the absence of BCL-6 and BLIMP-1 transcriptional regulators is reflected in the absence of BCL-6 and BLIMP-1 function.



View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 4. BCL-6 target genes are not repressed and BLIMP-1 target genes are not induced in naive B-1 cells. Fold expression levels of CD80, Cyclin D2, CD138, and J-chain in the various B cell populations relative to naive B-2 cells were determined by qPCR. Target gene expression in LPS-stimulated B-2 cells was determined at day 2 except for J-chain expression, which was assessed at day 3. Results from three independent experiments are shown, along with SEM.

 
The initial down-regulation of the key transcriptional repressor, BCL-6, may be a direct consequence of BCR-engagement that has been reported to occur chronically in B-1 cells (26). BCR ligation has been shown to diminish BCL-6 transcript levels in primary B cells (27), and to induce MAPK-dependent phosphorylation and ubiquitin-mediated degradation of existing BCL-6 protein in B cell lines (28). However, subsequent events in the transcription factor cascade that regulates B cell differentiation and Ig secretion differ from the accepted paradigm. In particular, BLIMP-1 is considered a master regulator of B cell differentiation and Ig secretion, yet is expressed in B-1 cells at a level far below that of Ig-secreting B-2 cells. It is unclear why B-1 cell BLIMP-1 levels are not increased in the absence of BCL-6 suppression, and, moreover, why PAX-5a levels are low in the absence of BLIMP-1 suppression (29), and why XBP-1 levels are not increased in the absence of PAX-5a suppression.

The low baseline level of serum IgM in BLIMP-1-deficient mice (12) suggests either that BLIMP-1 is required for natural Ig secretion by B-1 cells, or that BLIMP-1 is required for B-1 cell development. The former explanation would seem to be at odds with the current results, although it is important to note the possibility of developmental effects on B-1 cell Ig secretion (30), and the possibility that only a low threshold level of BLIMP-1 may be required to push B-1 cells toward Ig secretion. The low level of expression of BLIMP-1-responsive genes argues against the threshold concept, but does not rule it out as individual genes may be differentially responsive to low BLIMP-1 levels. A linear relationship is ruled out, however, inasmuch as B-1 cells secrete 55% as much IgM as LPS-stimulated B-2 cells on a per cell basis, but express <5% the amount of BLIMP-1 protein (data not shown; cf Fig. 2). It is clear, then, that B-1 cells spontaneously secrete Ig without experiencing the kind of BLIMP-1 expression that is considered characteristic of, and required for, activation of Ig secretion on the part of B-2 cells. This may, in fact, sidestep the terminal differentiation of B cells associated with elevated BLIMP-1 and thereby allow B-1 cells to manifest another key characteristic, that of self-renewal (31).

On the whole, our results suggest the need to re-evaluate the prevailing paradigm for transcriptional control of B cell differentiation as it might apply to the unique B-1 cell population, and to elucidate the mechanism responsible for spontaneous Ig secretion by this unusual B cell subset.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Acknowledgments
 
We thank Dr. K. Calame and D. Savitsky for generously providing anti-BLIMP-1 Ab.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by Public Health Service Grants AI29690 and AI60896 awarded by the National Institutes of Health. Back

2 J.R.T. and R.F. contributed equally to this work. Back

3 Current address: Department of Otolaryngology, College of Medicine, Kyung Hee University #1 Hoegi-dong, Dongdaemun-gu, Seoul 130-702, Korea. Back

4 Address correspondence and reprint requests to Dr. Thomas L. Rothstein, Immunobiology Unit, Evans Biomedical Research Center, Room 437, Boston Medical Center, 650 Albany Street, Boston, MA 02118. E-mail address: tr{at}bumc.bu.edu Back

5 Abbreviations used in this paper: BCL-6, B cell leukemia/lymphoma-6; qPCR, quantitative-PCR; BLIMP-1, B lymphocyte inducer of maturation program 1; PAX-5, paired box gene 5; XBP-1, X-box binding protein 1; XBP-1s, spliced XBP-1. Back

Received for publication November 15, 2004. Accepted for publication January 21, 2005.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 

  1. Masmoudi, H., T. Mota-Santos, F. Huetz, A. Coutinho, P. A. Cazenave. 1990. All T15 Id-positive antibodies (but not the majority of VHT15+ antibodies) are produced by peritoneal CD5+ B lymphocytes. Int. Immunol. 2:515.[Abstract/Free Full Text]
  2. Hayakawa, K., R. R. Hardy, M. Honda, L. A. Herzenberg, A. D. Steinberg. 1984. Ly-1 B cells: functionally distinct lymphocytes that secrete IgM autoantibodies. Proc. Natl. Acad. Sci. USA 81:2494.[Abstract/Free Full Text]
  3. Hardy, R. R., C. E. Carmack, S. A. Shinton, R. J. Riblet, K. Hayakawa. 1989. A single VH gene is utilized predominantly in anti-BrMRBC hybridomas derived from purified Ly-1 B cells: definition of the VH11 family. J. Immunol. 142:3643.[Abstract]
  4. Baumgarth, N., O. C. Herman, G. C. Jager, L. E. Brown, L. A. Herzenberg, J. Chen. 2000. B-1 and B-2 cell-derived immunoglobulin M antibodies are nonredundant components of the protective response to influenza virus infection. J. Exp. Med. 192:271.[Abstract/Free Full Text]
  5. Yother, J., C. Forman, B. M. Gray, D. E. Briles. 1982. Protection of mice from infection with Streptococcus pneumoniae by anti-phosphocholine antibody. Infect. Immun. 36:184.[Abstract/Free Full Text]
  6. Briles, D. E., M. Nahm, K. Schroer, J. Davie, P. Baker, J. Kearney, R. Barletta. 1981. Antiphosphocholine antibodies found in normal mouse serum are protective against intravenous infection with type 3 Streptococcus pneumoniae. J. Exp. Med. 153:694.[Abstract/Free Full Text]
  7. Boes, M., A. P. Prodeus, T. Schmidt, M. C. Carroll, J. Chen. 1998. A critical role of natural immunoglobulin M in immediate defense against systemic bacterial infection. J. Exp. Med. 188:2381.[Abstract/Free Full Text]
  8. Lin, K. I., C. Tunyaplin, K. Calame. 2003. Transcriptional regulatory cascades controlling plasma cell differentiation. Immunol. Rev. 194:19.[Medline]
  9. Calame, K. L., K. I. Lin, C. Tunyaplin. 2003. Regulatory mechanisms that determine the development and function of plasma cells. Annu. Rev. Immunol. 21:205.[Medline]
  10. Angelin-Duclos, C., G. Cattoretti, K. I. Lin, K. Calame. 2000. Commitment of B lymphocytes to a plasma cell fate is associated with Blimp-1 expression in vivo. J. Immunol. 165:5462.[Abstract/Free Full Text]
  11. Turner, C. A., Jr, D. H. Mack, M. M. Davis. 1994. Blimp-1, a novel zinc finger-containing protein that can drive the maturation of B lymphocytes into immunoglobulin-secreting cells. Cell 77:297.[Medline]
  12. Shapiro-Shelef, M., K. I. Lin, L. J. McHeyzer-Williams, J. Liao, M. G. McHeyzer-Williams, K. Calame. 2003. Blimp-1 is required for the formation of immunoglobulin secreting plasma cells and pre-plasma memory B cells. Immunity 19:607.[Medline]
  13. Shaffer, A. L., K. I. Lin, T. C. Kuo, X. Yu, E. M. Hurt, A. Rosenwald, J. M. Giltnane, L. Yang, H. Zhao, K. Calame, L. M. Staudt. 2002. Blimp-1 orchestrates plasma cell differentiation by extinguishing the mature B cell gene expression program. Immunity 17:51.[Medline]
  14. Tumang, J. R., W. D. Hastings, C. Bai, T. L. Rothstein. 2004. Peritoneal and splenic B-1 cells are separable by phenotypic, functional, and transcriptomic characteristics. Eur. J. Immunol. 34:2158.[Medline]
  15. Schneider, T. J., D. Grillot, L. C. Foote, G. E. Nunez, T. L. Rothstein. 1997. Bcl-x protects primary B cells against Fas-mediated apoptosis. J. Immunol. 159:4834.[Abstract]
  16. Klinman, D. M., K. L. Holmes. 1990. Differences in the repertoire expressed by peritoneal and splenic Ly-1 (CD5)+ B cells. J. Immunol. 144:4520.[Abstract]
  17. Zwollo, P., H. Arrieta, K. Ede, K. Molinder, S. Desiderio, R. Pollock. 1997. The Pax-5 gene is alternatively spliced during B-cell development. J. Biol. Chem. 272:10160.[Abstract/Free Full Text]
  18. Lowen, M., G. Scott, P. Zwollo. 2001. Functional analyses of two alternative isoforms of the transcription factor Pax-5. J. Biol. Chem. 276:42565.[Abstract/Free Full Text]
  19. Niu, H., G. Cattoretti, R. Dalla-Favera. 2003. BCL6 controls the expression of the B7-1/CD80 costimulatory receptor in germinal center B cells. J. Exp. Med. 198:211.[Abstract/Free Full Text]
  20. Kusam, S., F. H. Vasanwala, A. L. Dent. 2004. Transcriptional repressor BCL-6 immortalizes germinal center-like B cells in the absence of p53 function. Oncogene 23:839.[Medline]
  21. Randall, T. D., J. W. Brewer, R. B. Corley. 1992. Direct evidence that J chain regulates the polymeric structure of IgM in antibody-secreting B cells. J. Biol. Chem. 267:18002.[Abstract/Free Full Text]
  22. Randall, T. D., R. M. Parkhouse, R. B. Corley. 1992. J chain synthesis and secretion of hexameric IgM is differentially regulated by lipopolysaccharide and interleukin 5. Proc. Natl. Acad. Sci. USA 89:962.[Abstract/Free Full Text]
  23. Chumley, M. J., J. M. Dal Porto, J. C. Cambier. 2002. The unique antigen receptor signaling phenotype of B-1 cells is influenced by locale but induced by antigen. J. Immunol. 169:1735.[Abstract/Free Full Text]
  24. Shaffer, A. L., X. Yu, Y. He, J. Boldrick, E. P. Chan, L. M. Staudt. 2000. BCL-6 represses genes that function in lymphocyte differentiation, inflammation, and cell cycle control. Immunity 13:199.[Medline]
  25. Murphy, T. P., D. L. Kolber, T. L. Rothstein. 1990. Elevated expression of Pgp-1 (Ly-24) by murine peritoneal B lymphocytes. Eur. J. Immunol. 20:1137.[Medline]
  26. Wong, S. C., W. K. Chew, J. E. Tan, A. J. Melendez, F. Francis, K. P. Lam. 2002. Peritoneal CD5+ B-1 cells have signaling properties similar to tolerant B cells. J. Biol. Chem. 277:30707.[Abstract/Free Full Text]
  27. Allman, D., A. Jain, A. Dent, R. R. Maile, T. Selvaggi, M. R. Kehry, L. M. Staudt. 1996. BCL-6 expression during B-cell activation. Blood 87:5257.[Abstract/Free Full Text]
  28. Niu, H., B. H. Ye, R. Dalla-Favera. 1998. Antigen receptor signaling induces MAP kinase-mediated phosphorylation and degradation of the BCL-6 transcription factor. Genes Dev. 12:1953.[Abstract/Free Full Text]
  29. Lin, K. I., C. Angelin-Duclos, T. C. Kuo, K. Calame. 2002. Blimp-1-dependent repression of Pax-5 is required for differentiation of B cells to immunoglobulin M-secreting plasma cells. Mol. Cell. Biol. 22:4771.[Abstract/Free Full Text]
  30. Ishida, H., R. Hastings, J. Kearney, M. Howard. 1992. Continuous anti-interleukin 10 antibody administration depletes mice of Ly-1 B cells but not conventional B cells. J. Exp. Med. 175:1213.[Abstract/Free Full Text]
  31. Lalor, P. A., A. M. Stall, S. Adams, L. A. Herzenberg. 1989. Permanent alteration of the murine Ly-1 B repertoire due to selective depletion of Ly-1 B cells in neonatal animals. Eur. J. Immunol. 19:501.[Medline]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
L. Genestier, M. Taillardet, P. Mondiere, H. Gheit, C. Bella, and T. Defrance
TLR Agonists Selectively Promote Terminal Plasma Cell Differentiation of B Cell Subsets Specialized in Thymus-Independent Responses
J. Immunol., June 15, 2007; 178(12): 7779 - 7786.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
K. A. Fairfax, L. M. Corcoran, C. Pridans, N. D. Huntington, A. Kallies, S. L. Nutt, and D. M. Tarlinton
Different Kinetics of Blimp-1 Induction in B Cell Subsets Revealed by Reporter Gene
J. Immunol., April 1, 2007; 178(7): 4104 - 4111.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
R. Frances, J. R. Tumang, and T. L. Rothstein
Extreme skewing of annexin II and S100A6 expression identified by proteomic analysis of peritoneal B-1 cells
Int. Immunol., January 1, 2007; 19(1): 59 - 65.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
G. Cattoretti, R. Shaknovich, P. M. Smith, H.-M. Jack, V. V. Murty, and B. Alobeid
Stages of Germinal Center Transit Are Defined by B Cell Transcription Factor Coexpression and Relative Abundance
J. Immunol., November 15, 2006; 177(10): 6930 - 6939.
[Abstract] [Full Text] [PDF]

Home page
 J. Exp. Med.Home page
D. Savitsky and K. Calame
B-1 B lymphocytes require Blimp-1 for immunoglobulin secretion
J. Exp. Med., October 2, 2006; 203(10): 2305 - 2314.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. M. Mataraza, J. R. Tumang, M. R. Gumina, S. M. Gurdak, T. L. Rothstein, and T. C. Chiles
Disruption of Cyclin D3 Blocks Proliferation of Normal B-1a Cells, but Loss of Cyclin D3 Is Compensated by Cyclin D2 in Cyclin D3-Deficient Mice
J. Immunol., July 15, 2006; 177(2): 787 - 795.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tumang, J. R.
Right arrow Articles by Rothstein, T. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tumang, J. R.
Right arrow Articles by Rothstein, T. L.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS