|
|
||||||||
Schering-Plough Research Institute, Laboratory for Immunological Research, Dardilly, France
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
(TRIF), and TRIF-related adaptor molecule (TRAM) which activate a cascade of events resulting in transcription factor induction (5). TLR10 remains the only orphan member among the human TLRs. One major hindrance to TLR10 studies is that it lacks a rodent homologue. This has hampered the assignation of a natural or synthetic ligand to TLR10 because the majority of TLR ligands have been defined using mutant or genetically deficient mouse models. As in the case of TLR7 and TLR8, which have a common locus on chromosome X (6), TLR1, TLR6, and TLR10 also share a common locus on chromosome 4p14 and are structurally similar to one another (human genome resources; National Center for Biotechnology Information, ncbi.nlm.nih.gov). The ectodomains of TLR1/2 and TLR2/6 form functional pairs to recognize a variety of microbial residues (7) and it has been speculated that TLR10 could potentially act as a TLR2 coreceptor. Similarly to TLR7 and TLR9, the expression profile of TLR10 has been reported to be restricted to B cells and plasmacytoid dendritic cells (PDCs) (4). In addition, Bourke et al. (8) showed that resting B cells stimulated with anti-µ and anti-CD40 Abs or with Staphylococcus aureus Cowan I bacteria had increased mRNA expression of TLR9 and TLR10. In this study we further characterized the TLR10 expression pattern on immune cells as well as identifying its ability to form homo- or heterodimers with other TLRs. In addition, we have attempted to question the functionality and signaling ability of TLR10 using a constitutively active version of the molecule. Furthermore, we describe the identification of a rat TLR10 sequence. The functional significance of this is unknown, but may open the possibility to study this gene in an immunological model. | Materials and Methods |
|---|
|
|
|---|
HEK293, 293T and T98G cell lines (American Type Culture Collection) were maintained in DMEM supplemented with 10% FBS, 2 mM L-glutamine, 100 U/ml penicillin G, and 100 µg/ml streptomycin (Invitrogen Life Technologies). B cell lines were obtained from American Type Culture Collection and were cultured in RPMI 1640 supplemented with 10% FBS and 0.5% 2-ME (Sigma-Aldrich), except for B lineage acute lymphoblastic leukemia cell lines pre-ALP and Dunatis which were produced and cultured in our laboratory as described previously (9, 10, 11). All cells were cultured at 37°C with 5% CO2.
Cell preparations
Umbilical cord blood samples, peripheral blood samples, and whole tonsils were obtained according to institutional guidelines. PMBCs were purified from human peripheral blood by Ficoll-Hypaque centrifugation. Monocytes were purified from PBMC by centrifugation over a 50% Percoll gradient followed by immunomagnetic depletion of T, B, and NK cells (12). CD34+ hemopoietic cells and monocytes were isolated from umbilical cord; both populations of cells were used to generate dendritic cells (DCs) and activated as previously described (12, 13, 14). Activation of DCs was performed by culturing overirradiated CD40L-expressing L cells in the presence or absence of IL-3 (15). For Western blot analysis, peripheral blood B cells were enriched from whole blood using CD19-coupled magnetic beads (Miltenyi Biotec). PDCs were purified from tonsils as previously described (16) and activated overnight in the presence of IL-3 with or without CD40L-expressing L cells (15).
RT-PCR of human (h) TLR10
Total cellular RNA was isolated using the GdSCN/CsCl gradient procedure (12). Cells were lysed in 4 M guanidine thiocyanate solution and the total RNA was isolated by centrifugation through a 5.7 M CsCl gradient. RNA was treated with DNase I before mRNA purification using the Oligotex-dT kit (Qiagen). Poly(A)+ RNA (2 µg) was used to make first-strand cDNA (Superscript kit; Invitrogen Life Technologies). First-strand cDNAs were prepared after DNase I treatment of 5 µg of total RNA using oligo(dT) primers (Pharmacia) using the Superscript kit. Synthesis of cDNAs was controlled by performing RT-PCR using
-actin primers. RT-PCR was performed using the following primers specific for a 670-bp fragment of the TLR10 cDNA: 5'-GATGGTTGGATGGTCAGATTC (forward primer) and 5'-AAGCCCACATTTACGCCTATC (reverse primer).
Template DNA was added at 1 ng/µl and amplification was performed using the AmpliTaq enzyme and buffer (PerkinElmer), dNTPs at 0.8 mM, and DMSO at a 5% final concentration. Cycle conditions were 94°C for 1 min 60°C for 2 min, and 72°C for 3 min for 35 cycles.
Northern blot analyses
Human adult and fetal commercial tissue blots were used (MTN blots IIV; Clontech Laboratories). Hybridization of Northern blots was performed with the 670-bp DNA fragment generated by RT-PCR labeled with [32P]dCTP (Amersham) using the High Prime kit (Boehringer Mannheim). Hybridization was performed overnight in rapid hybridization buffer at 60°C. High stringency washes were at 0.2x SSC and 0.2% SDS for two times for 30 min. Revelation of bands was performed after 15 days exposition on Biomax MR film (Kodak).
Identification of TLR10 rodent homologues
Potential rodent homologues of TLR10 were identified by the bioinformatics search of the partial rat and mouse genomes using tBLASTn (17). Sequences corresponding to rat and mouse TLR genes that had close homology to human TLR10, including areas specific to TLR10 and not seen in TLR1 or TLR6, were observed. These sequences were completed by amplification from the corresponding genomic DNA, cloning into pCRII-TOPO (Invitrogen Life Technologies), and sequencing using RP and 21 primers. When sequences differed from the public databases, several individual clones were sequenced and the difference was considered a polymorphism if present in at least two separate PCR or in all of the clones from a given reaction. Genomic DNA from two rat strains, Sprague Dawley and Lewis, was used as was DNA from nine unrelated mouse strains. Tissue samples (tail biopsies) of C57/BL/6 and 129sv mice were obtained from Charles River Breeding Laboratories and DNA was extracted using the Qiagen DNeasy genomic DNA extraction kit (Qiagen). Genomic DNA from inbred mouse strains FVB/NJ, NZB, PL/J, NOD/Lt (Mus musculus), wild inbred strains Cast/Ei (Mus musculus castaneus), and SPRET/Ei (Mus spretus) was procured from The Jackson Laboratory. Genomic DNA from Swiss mice was obtained from Promega. Amplification from the 5' end of the mouse TLR10 coding sequence using the primers 5'-GATGTCAACAGAAGCCTGGGC (forward primer) and 5'-GACCATCAGCCAAGTTGTGTTG (reverse primer) gave bands of slightly different sizes from each strain of mouse. PCR amplification was performed for 35 cycles at 92°C for 1 min, 55 or 60°C for 1 min, and 72°C for 2 min. Identical results were achieved at amplification temperatures of 55 and 60°C. Sequences were cloned in pCRII-TOPO (Invitrogen Life Technologies) and sequenced.
Plasmid constructions
Flag-tagged hTLR2, hTLR4, and hemagglutinin (HA)-tagged hTLR3 were kind gifts from Prof. Alberto Mantovani (Universita degli Studi di Milano, Milan, Italy). Other hTLRs and hMD-2 were amplified either from human genomic DNA or cDNA from PBMC, produced as above, and cloned into the pDISPLAY (Invitrogen Life Technologies) eukaryote expression vector which contains the Ig
signal peptide and the NT-HA tag. We made use of a NotI site downstream of the multiple cloning site to eliminate the c-myc epitope and the transmembrane domain. Alternative pDISPLAY vectors which encode c-myc or flag epitopes were produced in our laboratory by substitution of double-stranded oligonucleotides at the HA site of the vector. These were used to produce Flag-TLR10 and c-myc-MD-2. Constitutively active CD4TLR3, 4, and 10 were constructed by fusing cDNA encoding the extracellular domain of murine CD4 to the transmembrane and cytoplasmic domain of human TLR10, TLR4, and TLR3 (18). Mutants were generated in the TIR domain of CD4TLR10 construct using the Gene Editor mutagenesis kit (Promega). Primers used to introduce mutations or deletions are as follows: 5'-CTACTTTGACCATGGCAAAAGC (P674H); 5'-CTTCATTGAGAATCGATATAAGTCC (KS688689NR); AAAAAGCATAGATCTAATGGCCCAAG (Y754stop); and 5'-TGTTAATGTATGAGCTCCCAGAGAAATG (L780stop).
MyD88 and DNMyD88NT Flag (deletion of the death domain) were amplified from human cDNA and cloned into the pCMVNT-Flag vector. NF-
B, ENA-78, and IL-4 luciferase constructs were cloned as previously described (18).
Western blotting and immunoprecipitations of HEK293T cells
HEK293T cells were seeded into six-well plates and the following day 500 ng of the respective construct was transfected using FuGENE (Roche). Twenty-four hours after transfection for CD4TLRs and 48 h for full-length TLRs, cells were lysed in mild lysis buffer (MLB) containing 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% Triton X-100, 1 mM DTT, 0.5 mM PMSF, 1% aprotinin, 20 mM NaF, and 0.3 mM Sodium Orthovanadate.
Western blot analysis of purified B cells from blood, tonsil, and B cell lines
Cells were lysed in radioimmunoprecipitation assay buffer containing 50 mM Tris-HCl (pH 7.5) 150 mM NaCl, 1% Nonidet, 0.5% sodium deoxycholate, and 0.1% SDS. Protease inhibitors aprotinin, leupeptin, and PMSF (Roche) were added. For immunoprecipitations, cells were lysed in MLB and 40 µg of total protein was immunoprecipitated with 1.5 µg of the respective Ab for 2 h or overnight at 4°C in the presence of protein G-Sepharose. Beads were washed four times in MLB and 4x lithium dodecyl sulfate loading buffer was added. In general between 20 and 40 µg of total cellular protein (determined by Bradford assay; Bio-Rad) were used for SDS-NuPAGE and immunoblotting (Invitrogen Life Technologies). After incubation with primary Abs, reactive proteins were detected with peroxidase-conjugated anti-mouse secondary Abs (Jackson ImmunoResearch Laboratories) and ECL (Amersham).
Analysis of glycosylation of transiently transfected TLR10 and MD-2
For N-glycosylation analysis, 48 h after transfection the cells were lysed in 0.1 M phosphate (pH 7), 0.05% (w/v) SDS, 1%
-ME, 1% Igepal, and 50 mM EDTA (Nonidet P-40 buffer) and the lysates were treated with N-glycosidase F at 40 U/ml, O-glycosidase at 40 mU/ml, and O-glycosidase plus neuraminidase at 40 mU/ml for 16 h at 37°C.
Reporter assays
HEK293 cells were transiently transfected using FuGENE (Roche) with 100 ng of reporter construct along with 25 ng of CD4TLR expression vectors and, in certain experiments, in the presence or absence of 50 ng of MyD88DN into 24-well tissue culture plates with cells at 50% confluency. In addition, 1 ng of a construct directing expression of Renilla luciferase (under the control of the constitutively active CMV promoter) was used to normalize the transfection efficiency. Cells were harvested and analyzed for luciferase activity 24 h after transfection.
Luciferase assay
Cells were harvested and analyzed simultaneously for firefly and Renilla luciferase activity (to normalize) using the PerkinElmer Firelite reporter assay reagents.
Abs used
Human TLR10 clone 158C1114 (Imgenex), mCD4 (BD Pharmingen, France), M2 mouse anti-Flag (Sigma-Aldrich), mouse anti-HA (Roche), mouse anti-myc (clone 9E10; Roche), anti-CD3 (UCHT1; BD Pharmingen, France), and anti-CD28 (CLB-CD28/1; Sanquin).
| Results |
|---|
|
|
|---|
Fig. 1A showed that DCs derived from monocytes in the presence of IL-4 and GM-CSF did not express TLR10. CD34+-derived DCs expressed TLR10 during the early stages of differentiation but this disappeared upon culture with CD40L-expressing L cells. Culture of CD34+ progenitor cells in GM-CSF and TNF gives rise to two populations of cells. The CD14+ subset has been described as being similar to dermal DCs or circulating DCs, whereas the CD1a+ subset resemble Langerhans cells in the epidermis (14). Interestingly, TLR10 expression was almost exclusively restricted to the CD1a+ subset. As described by Kadowaki et al. (19), we also confirmed expression of TLR10 on PDCs (Fig. 1A, lower panel). We observed that the expression of TLR10 on PDCs isolated from tonsil remained relatively constant after maturation with IL-3 and CD40L. We were able to detect TLR10 expression in immunological tissue. An mRNA of 4.4 kb was detected by Northern blot analysis (Fig. 1B), uniquely in lymph node and spleen, probably reflecting the high expression in B cells. Using a TLR10 Ab, we detected the presence of a 90- to 100-kDa protein in B cell lines (Fig. 1C). An early pre-B cell line, Reh-6, was negative for TLR10, whereas all of the pre-B, B, and mature B cell lines tested expressed TLR10 protein. The glioma cell line T98G was used as a negative control. In addition, we also detected expression of TLR10 protein on ex vivo B cells purified from PBMCs and tonsil as well as PDCs from tonsil.
|
We created a HA-tagged version of hTLR10; this construct was expressed in HEK293T cells which gave reproducible intracellular expression (data not shown). Western blotting of cell lysates showed a single protein of
91100 kDa, similar in size to endogenous TLR10 (Fig. 2). We treated cell lysates with N-glycosidase A, O-glycosidase, and O-glycosidase plus neuraminidase. MD-2 was used as a positive control since the glycosylation sites of this protein have been previously described (20). As shown in this experiment, MD-2 displayed two glycosylated forms of 20 and 26 kDa, respectively, which could be completely deglycosylated to reveal a single nonglycosylated form of 14 kDa. N-linked glycosylation of MD-2 and TLR4 has been shown to be essential for LPS recognition (21) TLR10 showed N-linked, but not O-linked glycosylation (Fig. 2). Deglycosylated TLR10 shows a size of
80 kDa. Coimmunoprecipitation studies (Fig. 3A) revealed the association of TLR10 with itself as well as TLR2 and TLR1; we were unable however to observe a consistent association with TLR6 in two of the three experiments performed. TLR2 has already been shown to associate with TLR1 or TLR6 via the extracellular domains of these receptors (23, 24, 25, 26). The fact that TLR10 associated with itself revealed a capacity to form homodimers.
|
|
TLR10 activates immune system promoters
To evaluate the basic signaling potential of the TLR10 TIR domain, we generated a constitutively active construct by fusing the mouse CD4 extracellular portion with the TLR10 transmembrane and TIR domain. Previous experiments have shown that CD4TLR10 was able to activate NF-
B, ENA-78, and other gene promoters (18). In this study, we show for the first time that the signaling activity of TLR10 requires the adapter MyD88 (Fig. 4, A and B) but not TIRAP, TRAM, or TRIF (data not shown, using DN versions of TIRAP and TRAM and small-interfering RNA for TRIF). We observed that DNMyD88 entirely blocked the signaling ability of CD4TLR10, partially CD4TLR4, but not CD4TLR3 to induce NF-
B and ENA-78 promoters. Furthermore, coimmunoprecipitation studies were performed to determine whether the TIR domain of TLR10 interacts directly with MyD88. These experiments show that CD4TLR10 interacted with MyD88 and with the control CD4TLR4 (Fig. 4, CE), indicating for the first time MyD88 as the adapter molecule involved in the signalization of TLR10.
|
The TIR domain is essential for signaling and TLR10 also contains the classical regions of particular signaling importance. Most TIR sequences have a conserved proline, which when mutated to histidine renders the protein unable to signal, probably due to an inability to associate with MyD88. Interestingly TLR3, the only TLR which does not associate with MyD88 has alanine at this position. Fig. 5A shows the positions where the mutants were made. Additionally, we noted a conserved potential serine protein kinase C phosphorylation site at position 692 in the TLR10 sequence. This sequence is conserved in all of the TLR TIR domains. The sequence was mutated from KSYK to NRYK to remove the serine residue. We also made truncation mutations to remove parts of the nonconserved carboxy-terminal of the TLR10 TIR domain (Lstop and Ystop). Figure 5B schematically represents where deletions and stop codons were made in the carboxyl-terminal to mutate or shorten the open reading frame of the TLR10. We next examined the CD4TLR10 mutants in their ability to activate the NF-
B, ENA-78, and IL-4 promoters. Transfection of HEK293 cells with CD4TLR10 alone induced all three reporters (Fig. 6, CE). Mutation of the conserved proline decreased luciferase activity of all three promoters. Mutation of the putative phosphorylation site at S692 caused a complete drop in reporter activity for IL-4 and NF-
B. Deletions L and Y in the TIR domain reduced NF-
B activity but a greater decline was observed with EN878 and IL-4 reporters; however, the Y deletion suppressed reporter activity of all promoters. Comparable levels of CD4TLR10 and mutant expression in HEK293T cells was detected by Western blotting using a mouse anti-CD4 Ab (data not shown).
|
|
We determined whether other species had homologues of TLR10. Genomic DNA from humans, mouse, and rat were digested with EcoRI, XbaI, BamHI, and NotI. Using the 670-bp hTLR10 probe, single bands were observed for the human DNA, but not for the other species. Attempts at cross-species PCR using 20-mer oligonucleotides chosen at overlapping sites in the N-terminal coding region of hTLR10 with little homology to TLR1 and TLR6 did not yield any specific amplification (data not shown). We then used bioinformatics analysis to search for sequences with homology to hTLR10 in the genomic databases. Coding sequences similar to the hTLR10 protein were detected in mouse and rat BAC clones. Since the rat genomic clone contained sequences from the 5' and 3' coding sequence, PCR amplification from genomic DNA from the rat allowed us to identify the entire coding exon of this gene. However, for the mouse sequence only partial sequences could be found. Comparison of the human, rat, and mouse amino acid sequences allowed us to conclude that these sequences represent the rodent homologues of TLR10 (Fig. 6A). Interestingly, we detected sequences very similar to TLR1 and TLR6 on the same genomic clones as TLR10, suggesting that in the mouse, rat, and human the TLR1, TLR6, and TLR10 genes are clustered. The human and rat TLR10 proteins each showed a putative signal peptide (Fig. 6B, boxed), a transmembrane region (Fig. 6B, boxed), and a conserved cytosolic TIR domain. Human and rat TLR10 show, respectively, seven and six potential sites for N-glycosylation (circled), of which six are conserved between the two proteins (Fig. 6B). Analysis of the genomic DNA sequences revealed that the mouse TLR10 gene is a nonfunctional gene, with numerous gaps, insertions, and phase changes, and with the TIR domain replaced by a retrovirus-like sequence. Amplification of mouse genomic DNA from nine unrelated mouse strains using PCR primers designed to amplify sequences around the peptide signal (forward primer) and the putative transmembrane domain (reverse primer) gave single bands (data not shown). Sequencing of these bands revealed sequences very similar to that detected on the BAC clone (C57BL/6 strain), with differences in certain repeated regions. Notably the inbred wild strains, CAST/Ei and SPRET/Ei, showed a shorter sequence and contained fewer repeats with respect to the C57BL/6 mice. This suggests that the mouse TLR10 gene has been lost by retroviral insertion and amplification of repeat regions after the separation of the mouse and rat lineages.
| Discussion |
|---|
|
|
|---|
In humans, TLR7, TLR9, and TLR10 expression is limited to granulocytes (in particular eosinophils), germinal center B cells, and PDCs (8, 30, 31). These expression data may indicate a role for TLR10 in terms of biological function in inducing type I IFN from PDCs as in the case of TLR7 and 9 (32) or in the case of B cell activation, inducing proliferation and cytokine secretion as observed for TLR9 in the presence of CpG motifs (8). We have confirmed and extended this expression to DCs generated in vitro resembling Langerhans cells (33). However, in several ex vivo Langerhans cell skin samples, we were unable to detect the expression of TLR10 (data not shown). This may suggest that the expression of TLR10 is directed by conditions similar to those in our in vitro cultures.
Detection of the endogenous TLR10 protein has not been previously reported. We extended the RT-PCR results shown by Bourke et al. (8) by examining TLR10 protein expression. TLR10 was detected in all samples except Reh-6, an early pre-B cell precursor. However, TLR10 mRNA was detected in all cell lines tested, suggesting that mRNA expression starts early in the B cell lineage, but translation of TLR10 is by cells that are committed to B cell differentiation.
We observed for the first time protein complexes with TLR10 as a homodimer and association with TLR1 or TLR 2. In addition, ImageQuant densitometry analysis, using immunoprecipitation controls as standards, reveals that homodimerization of TLR10 has a binding affinity of 100%, whereas for a TLR1/10 heterodimer 87% was observed and for a TLR1/2 complex 80%. Phylogenetic analysis indicates that among all human TLRs, TLR10 is closely related to TLR1 and TLR6. From the sequence homology, the most plausible hypothesis is that a common TLR1/6/10 ancestor duplicated to produce a TLR1/6 precursor and TLR10 (34). Extensive research on TLR2 has shown that the association with TLR1 and TLR6 is necessary for efficient ligand binding and the discrimination of triacyl and diacyl lipopeptides from bacteria (35). Potentially TLR10 may act as a coreceptor to these TLRs and therefore share the same family of ligands. However, the expression pattern of TLR10 in B cells and PDCs (19, 22) is confined to cells that do not appear to express TLR2. It is thus possible that TLR10 does not associate with TLR2 in vivo. Homo- and heterodimer formation by TLRs and associated non-TLR surface Ags increases the potential for ligand recognition and immune system modulation and contributes to the wide range of recognized PAMPs (28). In assessing the nature of the TLR10 agonist, we tested TLR10 in single and cotransfections with TLR1, TLR2, and TLR6 with a luciferase-driven NF-
B minimal promoter to determine whether the TLR10 ligand is related to PAMPs already determined for this family of proteins. However, we were unable to clearly demonstrate that bacterial-derived components activated TLR10 to induce NF-
B. We did not test extensively potential viral ligands in this system. As mentioned previously, TLR10 is clearly expressed on PDCs which produce high levels of type I IFN in response to viral infection and activation of TLR7 and 9 (36); therefore, we cannot exclude that a potential TLR10 ligand could be viral (37). It is noteworthy that PDCs and B cells isolated from tonsils in this study would have been exposed to a reservoir of infection before isolation since human tonsils can, for example, harbor EBV, respiratory syncytial virus (38), HIV (39), and other herpesviruses (40), as well as a range of bacterial pathogens (41). From these reports, we conclude that TLR10 expression in PDCs from tonsils may be enhanced because cells may already be in a state of pathogen activation. It is also probable that TLR10, which also has an extremely restricted expression profile, responds to molecules derived uniquely from very specific pathogens. A recent study that implicated polymorphisms in TLR10 in asthma patients (42) suggests that TLR10 may have a particular role in the lung. Thus, it cannot be excluded that TLR10 may also have a role in the recognition of airborne pathogens, such as bacteria or fungal pathogens, or alternatively airborne allergens.
Although lacking a candidate ligand, we continued to evaluate the signaling potential of TLR10 by using a constitutively active form of the molecule. With the exception of TLR3, all TLRs recruit MyD88, and some TLRs (i.e., TLR4, TLR2) can interact with several adaptors such as TIRAP and TRAM to generate diverse effects on gene transcription (5). We previously described the construction and assessed the activation of certain cytokine promoters by CD4TLR10 (18). In this study, we additionally show that MyD88 is also an adapter molecule involved in TLR10 signalization. Following previous studies on TLR4 (4), we also mutated the proline residue found at position 674 on TLR10. Although the reporter activity induced by TLR10 P674H was decreased compared with that of wild-type CD4TLR10, the activity was not completely abolished. This may imply that other sequences in the TIR domain may also be involved in the signaling of TLR10 and we speculate that either MyD88 may not necessarily bind only at this site or that another TIR adapter can partially substitute for MyD88 in the case of TLR10. Interestingly, the TLR10TIR mutant lacking a conserved potential serine phosphorylation site continued to activate the ENA-78 promoter. The necessity for a serine phosphorylation site in the TIR domain of TLRs has not previously been demonstrated and further work will be required to clarify the function of this site. The TLR10 deletion may suppress the formation of secondary structures specifically formed by TLR10 which can be potentially important for signaling, or may indicate that nonconsensual sequences in the TLR10 TIR activate an important part of the signaling pathway in the case of NF
B and IL-4, but not entirely for ENA-78. This suggests that unknown cytosolic factors and/or transcription factors may depend on the presence of these nonconserved TLR10 sequences.
These data, in addition to the discovery of a rodent homologue, should facilitate the identification of the natural ligand and help to further elucidate the function of TLR10.
| Disclosure |
|---|
|
|
|---|
| Acknowledgments |
|---|
| Footnotes |
|---|
2 C.C. and U.H. contributed equally to this study. ![]()
3 Address correspondence and reprint requests to Elizabeth E. M. Bates, Schering-Plough, Laboratory for Immunological Research, 27 chemin des Peupliers. BP11. 69571 Dardilly, Cedex, France. E-mail address: liz.bates{at}wanadoo.fr ![]()
4 Abbreviations used in this paper: PAMP, pathogen-associated molecule pattern; TIR, Toll IL-1 receptor; TIRAP, TIR domain-containing adaptor protein; TRIF, TIR domain-containing adaptor-inducing IFN-
; TRAM, TRIF-related adaptor molecule; DC, dendritic cell; PDC, plasmacytoid DC; HA, hemagglutinin; h, human. ![]()
Received for publication November 3, 2004. Accepted for publication December 16, 2004.
| References |
|---|
|
|
|---|
B involves the Toll adapters TRAM and TRIF. J. Exp. Med. 198:1043.
. J. Exp. Med. 184:695.
B by lipopolysaccharide. J. Immunol. 167:3354.
1 regulates the expression of the high-affinity receptor for IgE on CD34 stem cell-derived CD1a dendritic cells in vitro. J. Invest. Dermatol. 123:676.[Medline]
This article has been cited by other articles:
![]() |
L. A. J. O'Neill, C. E. Bryant, and S. L. Doyle Therapeutic Targeting of Toll-Like Receptors for Infectious and Inflammatory Diseases and Cancer Pharmacol. Rev., June 1, 2009; 61(2): 177 - 197. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Jendholm, M. Morgelin, M. L. A. Perez Vidakovics, M. Carlsson, H. Leffler, L.-O. Cardell, and K. Riesbeck Superantigen- and TLR-Dependent Activation of Tonsillar B Cells after Receptor-Mediated Endocytosis J. Immunol., April 15, 2009; 182(8): 4713 - 4720. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Parcina, C. Wendt, F. Goetz, R. Zawatzky, U. Zahringer, K. Heeg, and I. Bekeredjian-Ding Staphylococcus aureus-Induced Plasmacytoid Dendritic Cell Activation Is Based on an IgG-Mediated Memory Response J. Immunol., September 15, 2008; 181(6): 3823 - 3833. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wu, H. Wang, W. Xiong, S. Chen, H. Tang, and D. Han Expression Patterns and Functions of Toll-Like Receptors in Mouse Sertoli Cells Endocrinology, September 1, 2008; 149(9): 4402 - 4412. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nyman, P. Stenmark, S. Flodin, I. Johansson, M. Hammarstrom, and P. Nordlund The Crystal Structure of the Human Toll-like Receptor 10 Cytoplasmic Domain Reveals a Putative Signaling Dimer J. Biol. Chem., May 2, 2008; 283(18): 11861 - 11865. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Adam, B. Schmausser, M. Gobeler-Kolve, H. K. Muller-Hermelink, and M. Eck Gastric extranodal marginal zone B-cell lymphomas of MALT type exclusively express toll-like receptor 4 in contrast to other lymphomas infiltrating the stomach Ann. Onc., March 1, 2008; 19(3): 566 - 569. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Zhou and S. Amar Identification of Signaling Pathways in Macrophage Exposed to Porphyromonas gingivalis or to Its Purified Cell Wall Components J. Immunol., December 1, 2007; 179(11): 7777 - 7790. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-C. Chen, E. Giovannucci, P. Kraft, R. Lazarus, and D. J. Hunter Association between Toll-Like Receptor Gene Cluster (TLR6, TLR1, and TLR10) and Prostate Cancer Cancer Epidemiol. Biomarkers Prev., October 1, 2007; 16(10): 1982 - 1989. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-L. Ku, H. von Bernuth, C. Picard, S.-Y. Zhang, H.-H. Chang, K. Yang, M. Chrabieh, A. C. Issekutz, C. K. Cunningham, J. Gallin, et al. Selective predisposition to bacterial infections in IRAK-4 deficient children: IRAK-4 dependent TLRs are otherwise redundant in protective immunity J. Exp. Med., October 1, 2007; 204(10): 2407 - 2422. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Djavani, O. R. Crasta, J. C. Zapata, Z. Fei, O. Folkerts, B. Sobral, M. Swindells, J. Bryant, H. Davis, C. D. Pauza, et al. Early Blood Profiles of Virus Infection in a Monkey Model for Lassa Fever J. Virol., August 1, 2007; 81(15): 7960 - 7973. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Bell, P. A. Svingen, M. K. Rahman, Y. Xiong, and W. A. Faubion Jr. Forkhead Box P3 Regulates TLR10 Expression in Human T Regulatory Cells J. Immunol., August 1, 2007; 179(3): 1893 - 1900. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Into, J.-i. Dohkan, M. Inomata, M. Nakashima, K.-i. Shibata, and K. Matsushita Synthesis and Characterization of a Dipalmitoylated Lipopeptide Derived from Paralogous Lipoproteins of Mycoplasma pneumoniae Infect. Immun., May 1, 2007; 75(5): 2253 - 2259. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Flacher, M. Bouschbacher, E. Verronese, C. Massacrier, V. Sisirak, O. Berthier-Vergnes, B. de Saint-Vis, C. Caux, C. Dezutter-Dambuyant, S. Lebecque, et al. Human Langerhans Cells Express a Specific TLR Profile and Differentially Respond to Viruses and Gram-Positive Bacteria J. Immunol., December 1, 2006; 177(11): 7959 - 7967. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Kornbluth and G. W. Stone Immunostimulatory combinations: designing the next generation of vaccine adjuvants J. Leukoc. Biol., November 1, 2006; 80(5): 1084 - 1102. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Heidemann, W. Domschke, T. Kucharzik, and C. Maaser Intestinal microvascular endothelium and innate immunity in inflammatory bowel disease: a second line of defense? Infect. Immun., October 1, 2006; 74(10): 5425 - 5432. [Full Text] [PDF] |
||||
![]() |
A. E. Medvedev, I. Sabroe, J. D. Hasday, and S. N. Vogel Invited review: Tolerance to microbial TLR ligands: molecular mechanisms and relevance to disease Innate Immunity, June 1, 2006; 12(3): 133 - 150. [Abstract] [PDF] |
||||
![]() |
C.-C. Kuo, W.-T. Lin, C.-M. Liang, and S.-M. Liang Class I and III Phosphatidylinositol 3'-Kinase Play Distinct Roles in TLR Signaling Pathway J. Immunol., May 15, 2006; 176(10): 5943 - 5949. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Buwitt-Beckmann, H. Heine, K.-H. Wiesmuller, G. Jung, R. Brock, S. Akira, and A. J. Ulmer TLR1- and TLR6-independent Recognition of Bacterial Lipopeptides J. Biol. Chem., April 7, 2006; 281(14): 9049 - 9057. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. de Bouteiller, E. Merck, U. A. Hasan, S. Hubac, B. Benguigui, G. Trinchieri, E. E. M. Bates, and C. Caux Recognition of Double-stranded RNA by Human Toll-like Receptor 3 and Downstream Receptor Signaling Requires Multimerization and an Acidic pH J. Biol. Chem., November 18, 2005; 280(46): 38133 - 38145. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |