|
|
||||||||
B Activation




* Laboratory of Immunology, First Medical Clinic, and
Department of Immunology, University of Mainz, Mainz, Germany;
Gastroenterology Division, Brigham and Womens Hospital, Harvard Medical School, Boston, MA 02115; and
Department of Pathology and Anatomy, Eastern Virginia Medical School, Norfolk, VA 23507
| Abstract |
|---|
|
|
|---|
B and Ets binding sites at 90 and 73 bp upstream of the transcriptional start site, respectively. Furthermore, we observed that NF-
B p50/p65 and PU.1 were sufficient to transactivate the EBI3 promoter in EBI3-deficient 293 cells. Finally, induced EBI3 gene expression in DCs was reduced or abrogated in TLR-2/TLR4, TLR9, and MyD88 knockout mice, whereas both basal and inducible EBI3 mRNA levels in DCs were strongly suppressed in NF-
B p50-deficient mice. In summary, these data suggest that EBI3 expression in DCs is transcriptionally regulated by TLR signaling via MyD88 and NF-
B. Thus, EBI3 gene transcription in DCs is induced rapidly by TLR signaling during innate immune responses preceding cytokine driven Th cell development. | Introduction |
|---|
|
|
|---|
Recently, IL-27 has been identified as a new bioactive member of the IL-12 cytokine family (7, 8). The IL-27 heterodimer consists of an IL-12 p40-related polypeptide, denoted EBV-induced gene 3 (EBI3) (9, 10), and a novel p28 subunit with some similarities to IL-12 p35. IL-27 induces the proliferation of naive CD4+ T cells and production of the Th1 cytokine IFN-
(7). However, in contrast to IL-23, IL-27 seems to have no major effect on memory T cells. Recent studies of IL-27 signaling (8, 11, 12) have shown that it activates STAT transcription factors (STAT-1, STAT-3, STAT-4, and STAT-5) and the Th1-specific transcription factor T-bet (13, 14). In contrast, IL-27 suppressed the expression of the Th2-specific transcription factor GATA-3 by down-regulating STAT-6 expression (8, 11, 12). IL-27 binds to a receptor complex composed of gp130 and the orphan receptor WSX-1/TCCR, a homologue of the IL-12R
2-chain, which is expressed abundantly in naive T cells and NK cells (15).
Interestingly, there is evidence that IL-12-related cytokines not only induce T cell responses, but also actively control sustained Th1 and Th2 cell responses. In fact, data from two recent reports strongly indicate that signaling via the IL-27R WSX-1 is required to control T cell hyper-reactivity after infections. Hence, WSX-1-deficient mice infected with Trypanosoma cruzi or Toxoplasma gondii showed increased organ injury and mortality due to excessive production of proinflammatory cytokines (16, 17, 18). Furthermore, it has been reported that IL-27/WSX-1 signaling can play an important role in limiting innate and adaptive components of Th2 responses (19). Finally, mice deficient for the EBI3 subunit of IL-27 showed surprisingly attenuated Th2 responses in vitro and in vivo associated with reduced invariant NK T cell numbers, suggesting that EBI3 controls NK and Th2 T cell activity (20). It has been speculated that these apparently IL-27-independent effects of EBI3 could be mediated by EBI3 homodimers or EBI3/IL-12p35 heterodimers, although no biological effects of free EBI3 or EBI3/p35 have been reported to date (9, 20, 21). Because the expression of EBI3 has been reported in cells lacking the p28 subunit of IL-27, it is possible that some of the biological functions of EBI3 may be mediated by a heterodimer consisting of EBI3 and a currently unknown binding partner.
Whereas the regulation of IL-12 p40/p35 production has been intensely studied (22, 23, 24, 25), the transcriptional regulation of IL-27 expression is largely unclear. In the present study we have found that the EBI3 subunit of IL-27 is produced by DCs upon TLR stimulation via activation of the transcription factors NF-
B and PU.1 that transactivate the EBI3 gene promoter. Furthermore, studies using DCs from NF-
B p50-, MyD88-, and TLR-deficient mice showed that EBI3 expression in primary DCs is controlled via TLR signaling and NF-
B activation. Thus, EBI gene transcription is activated in primary DCs early during innate immune responses by interactions between microorganisms and specific pattern recognition receptors leading to TLR-dependent signaling events.
| Materials and Methods |
|---|
|
|
|---|
C57BL/6 mice were obtained from Charles River. EBI3/ mice were previously described (20). NF-
B p50/ mice were obtained from The Jackson Laboratory (26). MyD88/ (27), TLR4-deficient, and TLR2- plus TLR4-deficient mice were described previously (28). TLR9/ mice (29) were provided by H. Wagner (Technische Universitaet, Munich, Germany). All animals were bred and maintained in the specific pathogen-free animal facility of University of Mainz.
Cell lines and isolation of DC
Raw264.7, Bewo, Jurkat, DLD-1, NIH-3T3, COS-7, 293, and Raji cells were obtained from American Type Culture Collection. Cells were grown in RPMI 1640 supplemented with 10% FCS, 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin.
Mouse bone marrow-derived DCs (BMDC) were generated according to Lutz et al. (30). Bone marrow cells were isolated from femurs of 6- to 10-wk-old mice and cultured in serum free X-Vivo-15 medium (Cambrex) supplemented with 10 ng/ml murine GM-CSF (PeproTech). Splenic DC were isolated using collagenase digestion as previously described (31). In some experiments on CD8
+ (lymphoid) and CD8
(myeloid) DC subfractions, C57BL/6 mice were inoculated s.c. in the neck area with a total of 1 x 106 live Flt3 ligand- or GM-CSF-secreting B16-F10 melanoma cells. CD11c/CD8 double-positive cells were isolated from the spleen using a CD8+ DC isolation kit, whereas for isolation of myeloid DCs, the CD11c cell isolation kit was used (both obtained from Miltenyi Biotec). Plasmacytoid DC were isolated from mouse spleens with anti-mouse plasmacytoid DC Ag-1 microbeads (Miltenyi Biotec). Human monocyte-derived DCs were generated from buffy coats as described previously (32). For differentiation into mature DC, cells were additionally stimulated on day 7 with 10 ng/ml IL-1
, 10 ng/ml TNF-
, and 1000 U/ml IL-6.
Reagents and Abs
LPS (Escherichia coli serotype 055:B5), lipoteichoic acid (LTA), and poly(I:C) were obtained from Sigma-Aldrich; CpG ODN1668 was synthesized by MWG Biotech with a phosphorothioate backbone. Sac, Bay 11-7082, and curcumin were purchased from Calbiochem. Abs used in EMSA (anti-p50, anti-p65, anti-relB, anti-c-Rel, and anti-PU.1) were obtained from Santa Cruz Biotechnology. IL-1, IL-12, and TNF-
were obtained from PeproTech.
Total RNA isolation and RT-PCR
Total RNA was isolated using the Trifast reagent (Peqlab), followed by additional purification with the RNeasy MinElute Cleanup Kit (Qiagen) including DNase I digestion. One to 5 µg of RNA was used for cDNA synthesis with Superscript II (Invitrogen Life Technologies). Specific mRNA detection was performed by PCR analysis with the primers described in Table I. The thermal cycle profile was as follows: 30 s at 95°C, 45 s at 57°C, and 75 s at 72°C for 2532 cycles.
|
After DNase I digestion, total RNA (4001000 ng) was used as a template for first-strand cDNA synthesis using Superscript II. PCR was performed on the iQ iCycler (Bio-Rad) using specific cDNA primers and fluorescent-labeled probes. To obtain absolute quantification of gene expression, standard curves for every assay were generated using defined concentrations of EBI3 or
-actin amplicons. Standard curves were generated from six different concentrations of standards, each run in duplicate. For detection of EBI3 mRNA a Quantitect assay (Qiagen) with the following primer set was used, 5'-ggctgagcgaatcatcaa-3' (spanning the boundary between exons 3 and 4) and 5'-gagagagaagatgtccgggaa-3', with a FAM-labeled Quantiprobe (5'-atccccctgcttcctg-3'). PCR was performed with the QRT-PCR Mix from Abgene as follows: 15 min at 95°C, followed by 4045 cycles of denaturation at 95°C for 20 s, annealing at 56°C for 30 s, and extension at 76°C for 30 s. Fluorescence was detected during the annealing step. For amplification of
-actin, TaqMan probes (5'-FAM CACTGCCGCATCCTCTTCCTCCC TAMRA-3') with 5'-AGAGGGAAATCGTGCGTGAC-3' and 5'-CAATAGTGATGACCTGGCCGT-3' primers were used.
Identification of the transcription start site (TSS)
The TSS of the murine EBI3 gene was obtained by 5'RACE-PCR amplification of cDNA sequences generated from LPS (1 µg/ml)-stimulated Raw264.7 cells or BMDC with the GeneRacer Kit (Invitrogen Life Technologies) according to the manufacturers instructions. The first gene-specific primer (5'-GCCACGGGATACCGAGAAGCAT-3') was used for the initial PCR, whereas the second nested PCR was performed with a second gene-specific primer (5'-GATCCGAGTAGTGACCCATCAGA-3'). PCR products were subcloned, and multiple clones were sequenced.
Plasmids
A 1071-bp PCR product corresponding to the region from nt 891 to +180 relative to the major cap site was amplified using the forward primer 5'-CTGTTCCTTGGATCCGAGTT-3' and the reverse primer 5'-GGGCTGGAATGGTGTATTTG-3' with TurboPfu polymerase (Stratagene) and was cloned into pCRblunt (Invitrogen Life Technologies). Subsequently, a 1.1-kb KpnI/XhoI fragment was ligated into the promoterless luciferase reporter gene vector pGL3basic (Promega), yielding the 891 to +180 luciferase construct. Progressive deletion mutants were generated by restriction digestion or PCR amplification using primers with internal KpnI or XhoI restriction sites. Mutations in potential transcription factor binding sites were introduced using the QuikChange XL2 site-directed mutagenesis kit (Stratagene). The p50, p65, and PU.1 expression plasmids were gifts from S. Pettersson (Karolinska Institutet, Stockholm, Sweden). Plasmid DNA for transient transfections was prepared using Endofree Plasmid Maxi Kits (Qiagen).
Transfection and luciferase assays
Raw264.7 cells were transiently transfected by a DEAE-dextran-based method. Cells (1 x 107) were transfected with 10 µg of EBI3 promoter vectors along with 1 µg of a
-galactosidase (
-gal) expression vector (Invitrogen Life Technologies). Sixteen hours after transfection, cells were stimulated as specified in Results. BMDC, mature/immature monocyte-derived DC, and Jurkat T cells were transfected using Nucleofector technology according to the recommendations of the manufacturer (Amaxa). 293 and COS-7 cells were transfected with the Polyfect reagent according to the manufacturers instructions (Qiagen).
Luciferase activities in cell lysates were measured as light emission over a period of 10 s after addition of luciferase assay buffer (Promega) with a Sirius II luminometer (Berthold). Luciferase activity was normalized to
-gal expression levels in the lysate or where applicable to the protein content of the solution. The background obtained from mock-transfected cells was subtracted from each experimental value.
EMSA
Probes for EMSA (Table I) were labeled with [
-32P]ATP with T4 polynucleotide kinase (NEB) and separated from unincorporated nucleotides by mini QuickSpin columns (Roche). For supershift assays, 2 µg of specific Abs were used, and preincubation with nuclear proteins was performed for 30 min on ice. EMSA was conducted as previously described (33). For competition analysis, the indicated excess of unlabeled oligonucleotides containing consensus sites for transcription factors was added to the binding reaction. Complex formation was allowed to proceed for 30 min at room temperature.
In vivo genomic footprinting analysis
In vivo footprinting on primary DC or cell lines was conducted as previously described (23). For dimethylsulfate (DMS) treatment of Raw264.7 cells or BMDC, DMS (0.1%; Sigma-Aldrich) was added directly to the culture medium and incubated for 2 min. Cells were washed with PBS, and DNA extraction was performed by overnight incubation in cell lysis buffer (1 mM Tris-HCl (pH 7.5), 400 mM NaCl, 2 mM EDTA, 0.2% SDS, and 0.2 mg/ml proteinase K) at 37°C. The strand scission reaction was performed by resuspending the DNA in 1 M piperidine with subsequent incubation for 30 min at 90°C. The DNA was finally resuspended in water and diluted at a concentration of 1 µg/µl. For control reactions, naked genomic DNA was treated with DMS in vitro. Therefore, the DNA was incubated for 30 s with 0.1% DMS at room temperature. In vitro methylated control DNA was subsequently treated with piperidine as described above.
The ligation-mediated PCR (LM-PCR) procedure was conducted essentially as previously described by Mueller and Wold (34). In brief, primer annealing was performed with 0.5 pmol of primer 1 for 1 µg of genomic DMS-treated and piperidine-cleaved DNA. For primer extension, Vent polymerase (NEB) was used. Linker ligation was performed overnight at 15°C. Exponential PCR amplification was performed with primer 2 and the linker primer for 1522 cycles (94°C for 1 min, 1°C for 2 min, and 76°C for 3 min). Finally, the 32P-labeled third primer (106 cpm) was added together with 2 U of Taq DNA polymerase and 2 µl of dNTPs (5 mM each), and a final PCR cycle was performed. The primer sequences for LM-PCR on the EBI3 gene promoter are described in Table I.
| Results |
|---|
|
|
|---|
EBI3 plays an important role during early phases of innate and T cell-mediated immune responses (7, 20). However, the molecular pathways leading to EBI3 production in cells of the immune system are largely unknown. To address this question, we analyzed in an initial series of studies EBI3 levels in various cell lines and primary cells. Whereas EBI3 mRNA was undetectable in fibroblasts and T lymphocytes, EBI3 was expressed in primary murine DC, macrophages, and B lymphocytes (Fig. 1A). Interestingly, myeloid CD8
, lymphoid CD8
+, and plasmacytoid DC subsets produced comparable constitutive levels of EBI3 mRNA.
|
, a proinflammatory cytokine using similar signal transduction mechanisms as TLR agonists, also induced EBI3 expression in BMDC (Fig. 1E). To assess whether TLR stimulation augments EBI3 mRNA levels in vivo, C57BL/6 mice were challenged i.p. with LPS, followed by analysis of EBI3 expression by RT-PCR analysis. As shown in Fig. 1F, EBI3 mRNA expression was strongly induced in spleen and, to a lesser extent, in colon and liver after LPS administration, suggesting that TLR signaling drives EBI3 expression both in vitro and in vivo. To determine the functional relevance of the above signaling pathways for regulation of EBI3 gene expression in vivo, we next analyzed EBI3 levels in animals with deficient TLRs or TLR-dependent signaling events. Because MyD88 plays a key role in signal transduction by TLRs and IL-1 family members, we first determined EBI3 levels in primary DC from MyD88/ mice. As shown in Fig. 2D, although basal EBI3 mRNA levels were similar between MyD88/ mice and wild-type controls, TLR-4- and TLR-9-dependent EBI3 expression was abrogated in primary DCs from MyD88/ mice. Furthermore, LPS-dependent induction of EBI3 levels in primary DCs was suppressed in mice with deficient TLR-4 and TLR-2 plus TLR-4 signaling, whereas CpG-inducible EBI3 expression was abrogated in TLR-9/ mice (Fig. 2, AC). Taken together, these data suggested that TLR signaling is essential for inducible EBI3 expression in primary DCs in vivo.
|
To understand TLR-regulated expression of EBI3 in APCs, we analyzed the transcriptional regulation of the murine EBI3 gene. In these studies we aimed at identifying the TSS of the EBI3 gene using oligo-capping-based and RNA ligase-mediated 5'RACE techniques with total RNA derived from either BMDC or Raw264.7 macrophages. Sequencing analysis of the RACE-PCR clones identified a major TSS (nt 2044645 of GenBank locus NT_039656) 189 bp upstream of the translational start codon. Interestingly, this predominant initiation sequence did not resemble an initiator (inr) element, and no upstream TATA box was found.
We then cloned and sequenced the 5'-flanking region (GenBank accession no. AY505142), which contains numerous potential cis-regulatory elements, but lacks various typical promoter elements (TATA, inr, and CAAT boxes; Fig. 3A). To determine whether the 5'-flanking region could confer cell type-specific activity in reporter assays, we next cloned a 891 to +180 bp DNA fragment including the TSS into a firefly luciferase reporter plasmid. Transient transfection analysis was performed in various cell lines and primary mouse and human DCs. As shown in Fig. 3B, constitutive reporter gene activity was detectable in Raw264.7 macrophages and primary DCs, whereas no reporter gene activity was present in 293 or COS-7 cells. In contrast, a plasmid containing the 891 to +180 bp DNA fragment cloned in the opposite orientation upstream of the reporter gene produced only background levels of luciferase enzyme activity in Raw264.7 cells comparable to transfection of an empty vector, suggesting that the EBI3 promoter functions in an orientation-specific manner (data not shown). Consistent with endogenous EBI3 mRNA expression, stimulation of transfected Raw264.7 cells via TLR-2, TLR-4, and TLR-9 pathways significantly increased luciferase activity (Fig. 3C). These results clearly demonstrate that the genomic DNA immediately upstream of the EBI3 gene contains the functional promoter region that confers TLR-dependent and cell type-specific transcription of the EBI3 gene.
|
To further delineate cis-acting DNA elements that might be important in transcriptional regulation of the mouse EBI3 gene, we created constructs containing progressive 5' deletion mutants of the EBI3 promoter and transiently transfected them into primary BMDC. As shown in Fig. 4, plasmids containing various 5' deletions from 2829 to 205 bp did not significantly decrease luciferase activity compared with the 891 to +180 bp promoter construct. However, a significant decrease in luciferase activity was observed when a construct with a deletion from 891 to 106 bp was analyzed. In addition, subsequent deletions to 76 bp further reduced luciferase activity, indicating the presence of key positive cis-acting regulatory elements residing in the sequence region between 76 and 106 bp. Finally, deletion of the sequence elements from 891 to 35 bp reduced luciferase activity to background levels of the empty pGL3basic vector. Similar results were obtained by transient transfection assays of these deletion constructs into Raw264.7 cells (data not shown). Thus, the results of the deletion analysis of the promoter indicated that the sequence from 205 to +180 bp is sufficient to confer tissue-specific transcriptional activity of the EBI3 promoter.
|
The promoter deletion studies clearly demonstrated the importance of the proximal EBI3 promoter region in DCs and macrophages. However, because the reporter gene vector remains episomal, transient transfections do not necessarily reflect the complex biochemical processes involved in endogenous EBI3 gene regulation in the nucleus. Therefore, we analyzed in situ binding of transacting factors to this area by in vivo genomic footprinting. In these studies, Raw264.7 cells or BMDC were stimulated with medium, LPS/Sac, or LPS/IFN-
for 7 h and were treated with the DNA-methylating substance DMS. In vivo DMS-methylated DNA was then isolated and subjected to an LM-PCR procedure specific for the proximal EBI3 promoter (see Materials and Methods). A comparison between in vitro and in vivo methylated DNA showed altered DMS reactivities in LPS- plus Sac-stimulated and LPS- plus IFN-
-stimulated Raw264.7 cells and in LPS-stimulated and LPS- plus IFN-
-stimulated BMDCs characterized by hyper-reactive A and G as well as protected G residues (Fig. 5A). These footprints corresponded to putative consensus binding sites for NF-
B, ETS, AP-1, and IFN response factor (IRF) transcription factors and suggested the potential presence of specific DNA/protein interactions regulating EBI3 promoter activity in vivo.
|
B binding sites with altered DMS reactivity in vivo were highly conserved between rodent and human sequences.
NF-
B p50 and p65 are required for transactivation of the EBI3 gene promoter
We next analyzed the functional role of the protected regions identified by in vivo genomic footprinting. Accordingly, we performed transient transfection assays using constructs containing critical mutations in the putative AP-1, IRF, and NF-
B binding sites. However, mutations in the AP-1 and IRF sites did not result in reduced reporter gene activity in LPS-stimulated Raw264.7 cells (Fig. 6A). In additional studies, we then tested the effects of either a critical 2-bp mutation in the putative NF-
B binding motif or a 108 to 78 bp deletion that completely removes the NF-
B site, but still contains the potential Ets binding site. In LPS-stimulated Raw264.7 cells transfected with both mutated constructs, reporter gene activities were significantly reduced compared with the wild-type 891 to +180 bp construct, suggesting that the NF-
B binding motif is essential to achieve transactivation of the EBI3 promoter (Fig. 6B). To confirm the involvement of the NF-
B pathway, we transiently transfected Raw264.7 cells with the 891 to +180 EBI3 promoter reporter construct and pretreated the cells with an inhibitor of I
B phosphorylation, Bay 11-7082, before LPS stimulation. Pretreatment of cells with Bay 11-7082 resulted in a dose-dependent decrease in EBI3 promoter activity (Fig. 6C), indicating the importance of NF-
B signal transduction for EBI3 promoter activation.
|
B site in EBI3-producing cells. In EMSA studies, we found a retarded complex with nuclear proteins from both LPS-stimulated Raw264.7 cells and BMDC and an end-labeled oligonucleotide encompassing the putative NF-
B binding site (Fig. 6D). This retarded complex could be specifically competed with a 100-fold molar excess of unlabeled oligonucleotide, but not with mutant oligonucleotides lacking the NF-
B consensus sequence. To identify the nuclear factors that interact with this site in the mouse EBI3 promoter, we next performed supershift experiments. Using BMDC extracts, it was found that Abs specific for the p50 and p65 subunits of NF-
B supershifted the complex and reduced complex intensity. In contrast, Abs to RelB and c-Rel had no effect on complex formation. These observations indicate that the retarded band contains p50 homodimers and p50/p65 heterodimers in primary DCs. These findings were supported by the observation that BMDC nuclear extracts from NF-
B p50 knockout mice failed to result in retarded bands using the radiolabeled NF-
B binding site in the EBI3 gene promoter, as determined by EMSA analysis (Fig. 6E).
Because the above data suggested the importance of NF-
B p50 for EBI3 gene transcription, we determined in a final series of studies the functional relevance of NF-
B p50 for EBI3 expression by analyzing EBI3 levels in p50-deficient mice. As shown in Fig. 7A, both basal and TLR-inducible EBI3 levels were strongly suppressed in primary BMDCs from p50/ mice compared with wild-type controls, indicating that NF-
B p50 is essential for both basal and inducible EBI3 gene expression in primary DCs in vivo. In contrast, EBI3 expression levels were not altered in splenic B lymphocytes from NF-
B p50-deficient mice, suggesting that EBI3 levels in primary DCs, rather than B lymphocytes, are selectively dependent on NF-
B p50 (Fig. 7A). We therefore analyzed whether NF-
B is dispensable for EBI3 expression in murine B cells. However, pretreatment of LPS-stimulated splenic B cells with the NF-
B inhibitors Bay 11-7082 or curcumin led to a strongly decreased EBI3 mRNA expression, indicating that NF-
B family members other than p50 control EBI3 expression in B cells (Fig. 7B).
|
To identify nuclear protein complexes binding to the Ets element in the proximal EBI3 promoter region, EMSAs were performed with a probe spanning positions 77 to 55 bp and nuclear extracts from BMDC or NIH-3T3 fibroblasts. Auto- and cross-competition assays demonstrated four specific protein/DNA complexes using BMDC extracts (Fig. 8A). Interestingly, complex formation was completely abolished by competition with an Ets consensus sequence, suggesting that Ets-like proteins bind to this site. Addition of competitor sequences with mutations in the two Ets boxes (5'-GGAA-3') of the Ets element in the EBI3 promoter showed that the distal Ets box contributes to the formation of complexes 14 (Fig. 8, A and B). Complex 3 was present using nuclear extracts from EBI3-producing BMDC and Raw264.7 cells, but was not seen when extracts from NIH-3T3 cells were used. To analyze the possibility that the Ets protein PU.1 binds to the Ets boxes of the EBI3 promoter, we used a biotin-labeled 77 to 55 bp fragment to isolate nuclear proteins binding this sequence with streptavidin-tagged magnetic particles. The eluted samples were fractionated by SDS-PAGE and probed using a specific Ab against PU.1. As shown in Fig. 8C, the PU.1 Ab identified a single protein with the expected molecular size of 40 kDa in BMDC and macrophages, whereas PU.1 was not present in nuclear extracts of 293 cells. Consistently, supershift assays demonstrated binding of PU.1 protein to the labeled ewt (77/55) probe (not shown). Together, these data demonstrate that PU.1 binds to the Ets element of the EBI3 promoter in BMDC and macrophages.
|
PU.1 and NF-
B are sufficient to transactivate the EBI3 promoter in 293 cells
The above data are consistent with a model in which PU.1 and NF-
B synergistically transactivate the EBI3 promoter in APCs. To determine whether these transcription factors are sufficient to induce EBI3 promoter activity in non-APC, in a final series of studies we cotransfected the EBI3 promoter together with expression plasmids for NF-
B p50/p65 and PU.1 in 293 cells that do not express EBI3 (Fig. 9). Although mock-transfected 293 cells showed no EBI3 promoter activity, high luciferase expression was observed in 293 cells cotransfected with both NF-
B p50/p65 and PU.1 expression plasmids. These data suggested that PU.1 and NF-
B are both necessary and sufficient to transactivate the EBI3 gene promoter in non-APCs.
|
| Discussion |
|---|
|
|
|---|
B and PU.1 binding sites in the EBI3 promoter. The functional relevance of these findings was supported by studies in knockout mice showing that EBI3 expression in primary DCs is critically dependent on TLR signaling via MyD88 and NF-
B activation. Thus, EBI3 gene transcription in DCs is induced rapidly by TLR signaling during innate immune responses preceding cytokine-driven Th cell polarization.
TLRs represent the major cell surface initiators of inflammatory responses to pathogens and bind to a wide variety of pathogenic substances through their ectodomains (35). TLRs play a key regulatory role in host defense and inflammatory diseases. Furthermore, TLR signaling in specific DC subsets can enhance their ability to activate Ag-specific T cells (36). Interestingly, EBI3 expression was found to be strongly inducible by TLR signaling in primary DCs and macrophages, thereby providing an important link between TLR signaling and EBI3 gene expression in these cells. Subsequent cloning and functional analysis of the EBI3 promoter showed that NF-
B and Ets/PU.1 sites are critical for TLR-dependent activity of the TATA-less EBI3 promoter. Several lines of evidence suggested an important functional role for PU.1 and NF-
B in driving EBI3 promoter activity in DCs. Specifically, NF-
B and PU.1 binding sites showed altered DMS reactivity in vivo, suggesting binding of these transcription factors to the EBI3 promoter in primary DCs in the nucleosomal context. This observation is consistent with previous studies suggesting activation of NF-
B and PU.1 upon TLR signaling in APCs (37, 38). Furthermore, mutation of either of these sites led to a marked suppression of EBI3 promoter activity. Finally, subsequent functional studies showed that PU.1 and NF-
B are both necessary and sufficient for promoter transactivation in the EBI3-lacking 293 cell line. Interestingly, binding sites for PU.1 and NF-
B have also been demonstrated in the promoter of the EBI3-related IL-12 p40 cytokine gene (22, 23, 24), suggesting the potential existence of evolutionary conserved pathways to activate IL-12 family members in DCs. Taken together, these data suggest that TLR signaling activates NF-
B and PU.1 transcription factors in primary DCs, which, in turn, transactivate the EBI3 promoter. The functional relevance of this concept is strongly supported by the observation that LPS- and CpG-inducible EBI3 levels in primary DCs were markedly suppressed in MyD88-, TLR-4-, NF-
B p50-, and TLR-9-deficient mice.
Studies using an inhibitor of I
B phosphorylation suggested the functional importance of NF-
B activation for EBI3 gene expression, whereas blockade of p38 MAPK, ERK, and JNK kinases had little effects (S. Wirtz, unpublished observations). The functional importance of these data was highlighted by studies in NF-
B p50 knockout mice. In primary DCs both basal and inducible EBI3 levels were strongly reduced in NF-
B p50-deficient mice compared with wild-type mice. In contrast, EBI3 levels were virtually unaffected in B cells from NF-
B p50 knockout mice, suggesting the existence of p50-independent pathways for the regulation of EBI3 expression in B lymphocytes. Thus, primary DCs rather than B lymphocytes are critically dependent on NF-
B p50 for EBI3 expression under unstimulated or stimulated conditions, suggesting the existence of lineage-specific regulation of EBI3 gene expression.
EBI3 is expressed much more widely than IL-27, including contexts in which the Th1-associated cytokine tone is diminished, such as in pregnancy or ulcerative colitis (39, 40, 41), raising the possibility that EBI3 has functions other than promoting Th1 cytokine production via IL-27. Consistent with this concept, EBI3 expression can be identified in cell types in which either IL-12 p35 or p28 is not present (9). Furthermore, studies in EBI3-deficient mice showed that inactivation of EBI3 results in diminished Th2 cytokine production as well as reduced susceptibility to Th2-mediated, but not Th1-mediated, immunopathology, as defined in experimental colitis (20). Similarly, previous studies suggested a critical role for NF-
B p50 in Th2 T cell development. In fact, NF-
B p50-deficient CD4+ T cells failed to up-regulate the master transcription factor of Th2 cells, GATA-3, and exhibited significant defects in secretion of IL-4 and IL-13 after in vitro stimulation (42, 43). Such p50 knockout mice were also protected from allergic airway inflammation as well as helminth infection models due to reduced Th2 responses in vivo (44, 45). Because our data demonstrate marked suppression of EBI3 expression in p50 knockout mice, it is possible that these similarities in the phenotypes of EBI3- and p50-deficient mice are at least partially based on the lack of EBI3-derived cytokines in DCs that modulate T cell cytokine production.
Finally, EBI3-deficient mice (S. Zahn, unpublished observations) as well as IL-27R-deficient WSX-1 mice (46) are highly susceptible to infections with intracellular parasites such as Leishmania major due to decreased Ag-specific Th1 cytokine responses and IFN-
production. Thus, although EBI3-deficient mice show a marked defect in Th2 cytokine production under unstimulated conditions, a less severe Th1-mediated pathology may produce such mice in vivo after Leishmania infections. Similarly, an increased susceptibility to L. major infections associated with decreased Th1 cytokine responses and IFN-
production has recently also been observed in NF-
B p50 knockout mice (47).
In summary, these data suggest that EBI3 expression in DCs is controlled by TLR signaling at the transcriptional level via the transcription factors PU.1 and NF-
B. EBI3 expression in DCs is transcriptionally regulated by TLR signaling via MyD88 and NF-
B p50/p65. In particular, NF-
B p50 is essential for EBI3 expression in primary DCs. Transcriptional regulation of EBI3 transcription in DCs thus emerges as a potential link between innate TLR-dependent immunity and adaptive immunity driven by DC-instructed T lymphocytes.
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 Address correspondence and reprint requests to Dr. Markus F. Neurath, Laboratory of Immunology, First Medical Clinic, University of Mainz, Langenbeckstrasse 1, 55101 Mainz, Germany. E-mail address: neurath{at}1-med.klinik.uni-mainz.de ![]()
2 Abbreviations used in this paper: DC, dendritic cell; BMDC, bone marrow-derived DC; DMS, dimethylsulfate; EBI3, EBV-induced gene 3;
-gal,
-galactosidase; inr, initiator; IRF, IFN response factor; LM-PCR, ligation-mediated PCR; LTA, lipoteichoic acid; TSS, transcription start site. ![]()
Received for publication July 12, 2004. Accepted for publication December 7, 2004.
| References |
|---|
|
|
|---|
signal via Stat1 and Stat3 and induce T-Bet and IL-12R
2 in naive T cells. J. Interferon Cytokine Res. 23:513.[Medline]
B, CCAAT/enhancer-binding protein
, and PU.1 and identification of a novel repressor element (GA-12) that responds to IL-4 and prostaglandin E2. J. Immunol. 167:2608.
-primed IL-12 production by IFN regulatory factor 1. J. Exp. Med. 198:1265.
B leads to multifocal defects in immune responses. Cell 80:321.[Medline]
+ and CD8
subclasses of dendritic cells direct the development of distinct T helper cells in vivo. J. Exp. Med. 189:587.
B in GATA3 expression and TH2 differentiation in allergic airway inflammation. Nat. Immunol. 2:45.[Medline]
B family members in control of helminth infection and intestinal inflammation. J. Immunol. 169:4481.
B in the induction of eosinophilia in allergic airway inflammation. J. Exp. Med. 188:1739.
B1 is required for optimal CD4+ Th1 cell development and resistance to Leishmania major. J. Immunol. 170:1995.This article has been cited by other articles:
![]() |
M. El-behi, B. Ciric, S. Yu, G.-X. Zhang, D. C. Fitzgerald, and A. Rostami Differential Effect of IL-27 on Developing versus Committed Th17 Cells J. Immunol., October 15, 2009; 183(8): 4957 - 4967. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kempe, P. Heinz, E. Kokai, O. Devergne, N. Marx, and T. Wirth Epstein-Barr Virus-Induced Gene-3 Is Expressed in Human Atheroma Plaques Am. J. Pathol., July 1, 2009; 175(1): 440 - 447. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Huber, V. Steinwald, A. Guralnik, A. Brustle, P. Kleemann, C. Rosenplanter, T. Decker, and M. Lohoff IL-27 inhibits the development of regulatory T cells via STAT3 Int. Immunol., February 1, 2008; 20(2): 223 - 234. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Heidemann, C. Ruther, M. Kebschull, W. Domschke, M. Bruwer, S. Koch, T. Kucharzik, and C. Maaser Expression of IL-12-related molecules in human intestinal microvascular endothelial cells is regulated by TLR3 Am J Physiol Gastrointest Liver Physiol, December 1, 2007; 293(6): G1315 - G1324. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pirhonen, J. Siren, I. Julkunen, and S. Matikainen IFN-{alpha} regulates Toll-like receptor-mediated IL-27 gene expression in human macrophages J. Leukoc. Biol., November 1, 2007; 82(5): 1185 - 1192. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F Neurath New therapies for sepsis: focus on the interleukin (IL)12 family member IL27 Ann Rheum Dis, November 1, 2007; 66(suppl_3): iii29 - iii31. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Molle, M. Nguyen, V. Flamand, J. Renneson, F. Trottein, D. De Wit, F. Willems, M. Goldman, and S. Goriely IL-27 Synthesis Induced by TLR Ligation Critically Depends on IFN Regulatory Factor 3 J. Immunol., June 15, 2007; 178(12): 7607 - 7615. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Becker, H. Dornhoff, C. Neufert, M. C. Fantini, S. Wirtz, S. Huebner, A. Nikolaev, H.-A. Lehr, A. J. Murphy, D. M. Valenzuela, et al. Cutting Edge: IL-23 Cross-Regulates IL-12 Production in T Cell-Dependent Experimental Colitis. J. Immunol., September 1, 2006; 177(5): 2760 - 2764. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wirtz, I. Tubbe, P. R. Galle, H. J. Schild, M. Birkenbach, R. S. Blumberg, and M. F. Neurath Protection from lethal septic peritonitis by neutralizing the biological function of interleukin 27 J. Exp. Med., August 7, 2006; 203(8): 1875 - 1881. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |