|
|
||||||||
Department of Microbiology and Immunology, Jefferson Medical College and Kimmel Cancer Institute, Thomas Jefferson University, Philadelphia, PA 19107
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
| Materials and Methods |
|---|
|
|
|---|
General chemical supplies were obtained from Sigma-Aldrich. Molecular biology reagents were obtained from New England Biolabs. Isotopes were purchased from ICN Biomedicals and lactacystin was purchased from Boston Biochemicals. Monoclonal anti-nucleoprotein (NP) Abs (clones H16-L10-4R5 and H19-S24-4) were provided by Dr. W. Gerhard (Wistar Institute, Philadelphia, PA), anti-Tac hybridoma (clone 7G7B6) were obtained from American Type Culture Collection; monoclonal anti-hemagglutinin (HA) tag Abs (clone 12CA5) were purchased from Roche Diagnostic Systems. PCR primers were synthesized at the Kimmel Cancer Center Nucleic Acid Facility (Philadelphia, PA).
Cell lines and mice
L-Kd (L929 transfected with H-2Kd) and L-Kb (L929 transfected with H-2Kb) were maintained in DMEM with 5% FBS. Six- to 8-wk-old female inbred BALB/c (H-2d) and C57BL/6 (H-2b) mice were obtained from Taconic Farms or The Jackson Laboratory and maintained in the Thomas Jefferson University Laboratory Animal Facilities (Philadelphia, PA).
Viruses
Generation of the triple tandem HA-tag and addition of OVA257264 epitope with five flanking amino acids on both sides to NP13498-based Ags was done by the two-step PCR using consequent primers: CCTGACTATGCGGGGTCATACCCATACGATGTTCCAGATTACGCTGGATCTCTTGAGCAGCTTGAGAGT and GCGTCGACCACCATGGCTAGCTATCCCTATGACGTACCCGACTATGCAGGCTCGTATCCTTATGACGTGCCTGACTATGCGGGGTCA.
Val280 and Tyr281 substitution with arginines (NP13498/RR) was done by two-step PCR using two mutation primers: 5'- CTGCCTGCCTGTAGAAGAGGGCCCGCCGTA and 3'-TACGGCGGGCCCTCTTCTACAGGCAGGCAG as described earlier (19). NP13498/
was made by creating ClaI site using primer CCATCGATCCTTTCAGACTGCTTCAAAACAGCC allowing substitution of the BstB1/NotI fragment of HA-tagged NP13498 with ClaI/NotI fragment resulting in removal of 144 bp.
HA-tagged Tac Ag appended with OVA257264 epitope with five flanking amino acids on both sides and following the NP147155 epitope with five flanking amino acids on both sides was made by four-step PCR with the following primers (in order of use): 1)GAATCTTTCGAATGGACCAGTAATT2TGAATGATGCAACTTATCAGAGGACAAGAGCTCTTGTTCGCACCGGAATGGATCCCGAGCTCTGTGACGATGAC; 2)GAGCAGCTTGAGAGTATAATCAACTTTGAAAAACTGACTGAATGGACCAGTAATTTGAATGATGC; 3)TATGACGTACCGGACTATGCCGGTAGCTACCCATACGATGTTCCAGATTACGCCGGCTCTCTTGAGCAGCTTGAGAGTATA, and CTGCAGGCTTCGAATACCCGTATGATGTCCCCGACTACGCAGGGTCGTATCCTTATGACGTACCGGACTAT for regular Tac, allowing substitution of a BstB1/PstI fragment, or ACGCGTCGACCACCATGTACCCGTATGATGTCCCCGACTACGCAGGGTCGTATCCTTATGACGTACCGGACTAT for Tac targeted to the cytosol.
Addition of the ubiquitin (Ubi) moiety and changing the N-terminal amino acid to Arg was done using the primer CTAGCTAGCCCTGCCACCTCTCAGTCTTAAGACCAGGTGCAGGG adding Arg to the C terminus of Ubi followed by the NheI site. All HA tags were constructed such that that they contained an NheI site immediately after the ATG initiation codon thus allowing for substitution with Ubi-Arg using SalI/NheI. The genes were cloned into the modified pSC11 plasmid, containing
-glycosidase gene. Sequencing, using
-cyanoethyl phosphoramidities chemistry (Applied Biosystems) and conducted by the Kimmel Cancer Institute Nucleic Acid Facility, confirmed the integrity of each construct. Recombination into vaccinia virus (vac) and titration of vac (in duplicate) was conducted as described (20).
Flow cytometric analysis
L-Kb cells were infected for 1 h at 37°C with vaccinia recombinants at 10 PFU/cell at a concentration of 106 cells/ml in balanced salt solution containing 0.1% BSA. After 1 h, RPMI 1640 plus 10% FBS media was added and the cells were incubated for additional time. Aliquots were removed every hour and stained for Kb/OVA257264 complexes on the surface with 25-D1.16 mAbs specific for Kb/OVA257264 complex (obtained from A. Porgador, University of Ben-Gurion, Beer-Shiva, Israel) and FITC-labeled goat anti-mouse Abs (Vector Laboratories), and then were fixated in 2% solution of paraformaldehyde (Electron Microscopy Sciences) in PBS.
In the experiments with puromycin, 200 µM puromycin was added after 1 h of infection and removed after 20 min of incubation; the cells were then washed twice with RPMI and resuspended in RPMI. The infection then proceeded, and the aliquots were removed and stained as earlier described.
When needed, permeabilization of the cells was performed as previously described (21): the cells were first fixated in 4% solution of formaldehyde in PBS for 10 min, washed three times with PBS, then permeabilized in 2 mg/ml n-octyl-
-D-glucopyranoside (Calbiochem) for 10 min, and washed three times before staining.
CTL assay
Epitope-specific TCD8+ were derived from C57BL/6 or BALB/c mice, respectively, as described elsewhere (22). Briefly, mice were immunized by i.p. injection of 5 x 106 PFU of a vac expressing the isolated OVA257264 epitope in the case of C57BL/6, or a vac expressing the isolated NP147155 epitope in the case of BALB/c mice. After at least 2 wk, spleens from appropriate mice were harvested, and one-third of the cells were infected with A/PR/8/34 influenza virus or WSN/33-Ova influenza virus with OVA257264 epitope incorporated in the virus neuraminidase stalk (constructed by Dr. M. Castrucci and provided by D. Topham, University of Rochester, Rochester, NY) for restimulation. Secondary cultures were incubated at 37°C/6% CO2 for 67 days before harvesting for effector population. CTL assays were performed as previously described (20). L-Kd or L-Kb cells were used as APCs for H-2Kd- or H-2Kb-restricted responses, respectively. APC were infected for 1 h at 37°C with vaccinia recombinants at 10 PFU/cell at a concentration of 107 cells/ml in balanced salt solution containing 0.1% BSA. After 1 h, 2 ml of RPMI 1640 plus 10% FBS were added and the cells were incubated for another 50 min with rotation before 5 µg/ml brefeldin A was added and the cells were rotated another 10 min. When needed, puromycin was added for 20 min following an hour of infection and then the cells were washed three times with PBS. The cells were then pelleted and resuspended with 50 µl/106 cells of RPMI 1640 with 10% FCS containing 50 µCi of Na51CrO4 (ICN) and incubated for 1 h at 37°C. APC were then washed three times with PBS and resuspended in RPMI 1640 plus 10% FBS and combined with CTL populations in round-bottom plates at 104 cells/well. APCs and CTL were coincubated for 4 h at 37°C before 100 µl of supernatants were collected, mixed with the same amount of OptiPhase SuperMix scintillation liquid, and counted in a 1450 Microbeta liquid scintillation and luminescence counter. The data are presented as percentage of specific 51Cr release, defined as 100 x ((experimental cpm spontaneous cpm)/(total cpm spontaneous cpm)).
Metabolic labeling and immunoprecipitation
Metabolic labeling and immunoprecipitation were performed as previously described (20). Gels were dried and exposed to LE Storage Phosphor Screen (Molecular Dynamics), and the luminescence was measured using Typhoon 8600 Variable Mode Imager and analyzed using Image Quant software.
Western blotting
Laemmli SDS-PAGE and transfer to nitrocellulose membrane were performed as previously described (23). The protein bands were visualized by consequent incubating with anti-HA Abs (1 µg/ml) (Roche), HRP conjugated goat anti-mouse Abs dilution 1/10,000 (Vector Laboratories) and LumiGLO Chemiluminescent Substrate System (Kirkegaard & Perry Laboratories) with subsequent autoradiography.
Proteinase K treatment
The cells were metabolically labeled as described elsewhere (20), lysed in the lysis buffer (0.01M Tris-HCl, pH 7.5, 0.14 M NaCl, 0.5% Nonidet P-40), and the constructs were immunoprecipitated with anti-HA Abs immobilized on rProtein A-agarose beads (RepliGen). The gel slurries were washed once with the lysis buffer and three times with PBS. The samples were placed on ice, and 1 µg/ml proteinase K was added to the gel slurries with immobilized Ags. Aliquots were removed at indicated times and 5 mM PMSF was added to stop the reactions. The slurries were washed then once with PBS and boiled 5 min in the Laemmli buffer. Proteolytic fragments were separated by SDS-PAGE in 12% gels and visualized by autoradiography.
| Results |
|---|
|
|
|---|
NP from influenza virus A/PR/8/34 depleted of the twelve N-terminal amino acids that target it to the nucleus (NP13498) was used as a model cytosolic Ag. The loss of amino acids 112 does not impact folding as demonstrated by continued reactivity with a large panel of anti-NP mAbs nor is there an effect upon presentation efficiency (data not shown). The
-chain of human IL-2R (Tac Ag) was used as a model glycoprotein that would be subject to quality control within the ER. Both groups of model Ags were appended with an HA-tag in triplicate which does not disturb folding of the core proteins (data not shown) and allows for the retrieval of Ag independent of its folding state. Each Ag was further engineered to contain the same two epitopes: H-2Kb-restricted OVA257264 and H-2Kd-restricted NP147155 (Fig. 1). These epitopes were chosen because, for all earlier constructs as well as those used here, they demonstrate strikingly different sensitivity to proteasome inhibitors; while OVA257264 presentation is profoundly inhibited by proteasome inhibitors, NP147155 presentation is either unchanged or increased depending upon context (16, 19, 22). The basis for this latter presentation phenotype is the presence of both chymotryptic-like and tryptic-like proteasomal cleavage sites within NP147155 sequence (TYQRTRALV) (19). This suggests the possibility, supported by preliminary data (E. J. Wherry, T. N. Golovina, S. E. Morrison, G. Sinnataumby, M. S. McElhaugh, L. C. Eisenlohr, manuscript in preparation) that nonproteasomal proteases (24, 25, 26) are involved in the generation of NP147155.
|
). The constructs were incorporated into vac, which allow for expression in a wide range of cell lines.
Compared with NP13498, NP13498/RR, and NP13498/
are more rapidly digested by proteinase K, and the digestion products are different for all three (Fig. 2A), indicating altered folding states. This is also apparent when comparing immunoprecipitation of the constructs with the conformation-independent anti-HA mAb vs the conformation-dependent anti-NP mAb H19-S24-4; precipitation of NP13498/RR with H19-S24-4 is clearly impaired compared with NP13498 while NP13498/
does not interact with this Ab at all (Fig. 2A). The protein was also targeted for programmed degradation by replacing the initiating methionine with arginine and preceding the construct with a Ubi moiety that is posttranslationally removed by Ubi C-terminal hydrolase (29). According to the N-end rule (30), an arginine residue at the N terminus constitutes a degron that mediates rapid, Ubi-dependent degradation. As anticipated by published results (11), Ubi-Arg-NP13498 was completely degraded within several min (Fig. 2E, discussed below). This precluded analysis of its folding using proteinase K sensitivity assay. However, immunoprecipation analysis, demonstrating relatively weak interaction with the anti-NP Ab H19-S24-4, indicates that this construct is also misfolded (Fig. 2A).
|
The misfolded NP-based constructs (NP13498/RR and NP13498/
) had only moderately decreased half-lives (1.8 and 2 h, respectively) compared with 2.8 h for NP13498, while the half-life of Ubi-Arg-NP13498 is dramatically lower (10 min) (Fig. 2E, top panel). Indeed, it has been reported that N-end rule substrates can be targeted for degradation even before translation has been completed (34). Among the Tac-based constructs, the half-life of TacGlu was identical to that of wild-type Tac (2.3 h). Despite its unstable folding noted above, this construct passes quality control within the ER and is transported to the cell surface (Fig. 2F). TacR10 has a moderately decreased half-life of 30 min which is sufficient for the proper folding of its extracellular domain (Fig. 2E, bottom panel) but, as anticipated (32), this construct is not transported to the cell surface (Fig. 2F), and is likely targeted to the cytosol for degradation (18, 35, 36, 37, 38). CytoTac was most rapidly degraded, with a half-life of
15 min (Fig. 2E, bottom panel). Thus, among the described model Ags, only the variant with profound misfolding due to relocation within the cell (cytoTac), and those containing degrons (Ubi-Arg-NP13498 and TacR10) were rapidly degraded. The other variants, more representative of the errors that would arise during transcription, splicing, or translation are degraded at a rate not much faster than that of wild-type, a remarkable fact taking into consideration that these changes do significantly impact the protein structure.
Finally, it was important to determine the degree to which defective products are made during the expression of the wild-type proteins. If rapidly degraded, the products of such errors might be undetectable by the analyses shown thus far. Most importantly, if such products are abundant, then the imposed changes might affect a relatively minor increase in the total amount of defective proteins available for class I processing. To this end, we used an approach similar to that taken by others (3). Cells were infected with the various recombinant viruses in the presence or absence of the proteasome inhibitor lactacystin. Following lysis, relative steady state levels were determined by PAGE followed by Western blotting and staining with anti-HA Abs (Fig. 3). Addition of lactacystin revealed that some truncated polypeptides were produced during biosynthesis of the wild-type NP13498 but not a wild-type Tac. These truncated products would appear to have little significance in terms of epitope production as addition of a degradation signal to NP13498 does not result in production of more truncated products, yet, as shown below, this modification greatly enhances epitope supply. The same is true for the Tac Ags; with the difference that in contrast to the stable Tac, destabilized Tac derivatives showed a ladder pattern consistent with multiubiquitylation (Fig. 3).
|
OVA257264 epitope presentation was assessed in two ways: surface staining with Abs specific for OVA257264/H-2Kb complexes (clone 25-D1.16) and 51Cr release cytotoxic assay in which surface complexes were limited through the use of brefeldin A treatment (39, 40). Staining with OVA257264/Kb-specific Abs revealed that the first OVA257264/H2-Kb complexes from either NP13498, NP13498/RR, or NP13498/
were detectable after 3 h of infection while the OVA257264/H2-Kb complexes from Ubi-Arg-NP13498 are readily apparent within the first 2 h of infection (Fig. 4A). 51Cr release assay results closely correlated with the Ab staining results (Fig. 4B).
|
Impact on epitope presentationthe exocytic Tac-based constructs
Within the Tac group of model Ags, the trend was similar in that only those versions that are profoundly unstable due to circumstances beyond simple misfolding allow for greater epitope production. However, after this first level of assessment, results were less straightforward. Elimination of N-linked glycosylation had no impact on presentation of either epitope (Fig. 4, D and F), in line with the lack of effect upon degradation rate. The appearance of OVA257264/H2-Kb complexes from cytoTac and TacR10 was more rapid compared with the wild-type Tac construct, although after 4 h of infection the number of surface complexes was appreciably lower in the case of cytoTac compared with TacR10 (Fig. 4D). Given the extreme misfolded state of cytoTac, one explanation for its lower contribution of epitope could be that it is subject to degradation by other cellular proteases that might diminish the amount of substrate for "productive" proteasomal degradation. However, addition of various individual protease inhibitors of different specificities or protease inhibitor mixtures does not enhance OVA257264 presentation from cytoTac at later time points (data not shown). Therefore, we considered the possibility that the cellular machinery associated with degron-mediated destruction produces epitope more efficiently than the machinery associated with the destruction of misfolded proteins, however profound the degree of misfolding. If true, then addition of a degron to cytoTac should enhance epitope production. To test this, we converted cytoTac to an N-end rule substrate by substituting its N-terminal Met with Arg. Ubi-Arg-cytoTac became the most unstable construct of all those tested (data not shown), but the modification increased OVA257264 production only slightly (Fig. 4D). Thus, the efficient generation of epitope from TacR10 cannot be explained by degradation rate or qualitative aspects of degron-mediated destruction.
For OVA257264 presentation, results were similar in 51Cr-release assay although the differences were not so prominent (Fig. 4E). Interestingly, the pattern of presentation for the NP147155 epitope was distinct, with appreciably more efficient generation of the epitope from all three modified Tac variants (Fig. 4F) despite considerable differences in degradation rates.
Impact of premature translation termination on epitope production
It has been shown by others that brief termination of protein synthesis with puromycin increases the presentation of influenza matrix 5866 epitope in low molecular protein-deficient cells, suggested by the authors to be due to an increase in the amount of defective products available for processing (9). Following very similar experimental conditions, we investigated the impact of puromycin on presentation of our epitopes from various constructs. Consistent with results shown above, though puromycin pretreatment induced a number of shorter products (Fig. 5A), it did not increase the level of OVA257264 or NP147155 presentation in either context (Figs. 5, B and C); rather, it slightly decreased the level of presentation from the more rapidly degraded constructs. Under similar experimental conditions Gileadi et al. did observe an increase in the presentation of epitope 5866 from influenza virus Matrix protein (9), but it was in a different system, namely, in low molecular protein-deficient cells, and matrix 5866 epitope was not presented in these cells if expressed in the contest of wild-type matrix protein.
|
| Discussion |
|---|
|
|
|---|
Assuming, for the sake of this discussion, that the types of processing substrates represented by cytoTac are relatively rare, how can our findings be reconciled with the observation that nascent proteins are the major source of class I-restricted peptide (3)? It has been demonstrated that both the degradation and folding machineries of the cell can access nascent polypeptides before termination of translation (34, 42). Thus there is a competition for any nascent prefolded protein between the folding and degradation machineries of the cell. We propose that epitopes are derived from the cases, likely rare, where the degradation machinery prevails. The ultimate success of a protein in terms of folding would have no bearing on this competition, explaining why most of our point mutations and deletions have no impact on epitope supply. In contrast, the degron-containing polypeptides are almost uniformly targeted for destruction either during or after translation independent of folding state.
Based upon much of the work reported here, appending a degron to an Ag may seem a reasonable strategy for enhancing TCD8+ activation, but the task is clearly more complex. The most rapidly degraded protein (Ubi-CytoTac) of the group we tested does not produce the highest level of epitope, indicating qualitative aspects of Ag processing that remain poorly understood. In addition, as has been shown recently, (10, 43), the relative epitope production from two versions of an Ag does not predict the relative level of T cell response, due to nebulous in vivo phenomena such as cross-presentation. Indeed, preliminary in vivo experiments with the constructs described here indicate that efficiency of epitope production is not predictive of immunogenicity (T. N. Golovina, unpublished observations). This contrasts with earlier studies where we modulated expression levels of a single model Ag, and under such circumstances epitope production is essentially predictive of the magnitude of the TCD8+ response (44). The collective data indicate that protein context is an important determinant of both epitope production and immunogenicity, and that these two properties are differentially impacted. A deeper understanding of this disconnect should contribute significantly to the rational engineering of Ags to optimize TCD8+ responses.
| Disclosures |
|---|
|
|
|---|
| Acknowledgments |
|---|
| Footnotes |
|---|
1 This work was supported by grants to L.C.E. from the National Institutes of Health (AI39501) and the Leukemia and Lymphoma Society (1121-00). T.G. was supported by National Institutes of Health Training Grant 5-T32-CA09683. ![]()
2 Address correspondence and reprint requests to Dr. Laurence C. Eisenlohr, Thomas Jefferson University, Bleumle Life Sciences Building, Room 706, 233 South 10th Street, Philadelphia, PA 19107. E-mail address: L_Eisenlohr{at}mail.jci.tju.edu ![]()
3 Abbreviations used in this paper: ER, endoplasmic reticulum; NP, nucleoprotein; HA, hemagglutinin; Ubi, ubiquitin; vac, vaccinia virus. ![]()
Received for publication October 15, 2004. Accepted for publication December 20, 2004.
| References |
|---|
|
|
|---|
-NH-ubiquitin)protein endoproteases in cells. J. Biol. Chem. 264:10637.Related articles in The JI:
This article has been cited by other articles:
![]() |
M. Ostankovitch, M. Altrich-VanLith, V. Robila, and V. H. Engelhard N-Glycosylation Enhances Presentation of a MHC Class I-Restricted Epitope from Tyrosinase J. Immunol., April 15, 2009; 182(8): 4830 - 4835. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Snook, B. J. Stafford, P. Li, G. Tan, L. Huang, R. Birbe, S. Schulz, M. J. Schnell, M. Thakur, J. L. Rothstein, et al. Guanylyl Cyclase C-Induced Immunotherapeutic Responses Opposing Tumor Metastases Without Autoimmunity J Natl Cancer Inst, July 2, 2008; 100(13): 950 - 961. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Goldwich, S. S. C. Hahn, S. Schreiber, S. Meier, E. Kampgen, R. Wagner, M. B. Lutz, and U. Schubert Targeting HIV-1 Gag into the Defective Ribosomal Product Pathway Enhances MHC Class I Antigen Presentation and CD8+ T Cell Activation J. Immunol., January 1, 2008; 180(1): 372 - 382. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Caron, R. Charbonneau, G. Huppe, S. Brochu, and C. Perreault The structure and location of SIMP/STT3B account for its prominent imprint on the MHC I immunopeptidome Int. Immunol., December 1, 2005; 17(12): 1583 - 1596. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |