The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ren, F.
Right arrow Articles by Kornfeld, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ren, F.
Right arrow Articles by Kornfeld, H.
The Journal of Immunology, 2005, 174: 2738-2745.
Copyright © 2005 by The American Association of Immunologists

Pro-IL-16 Regulation in Activated Murine CD4+ Lymphocytes1

Fucheng Ren*, Xin Zhan*, Gregory Martens*, Jinhee Lee*, David Center{dagger}, Sue Kim Hanson{dagger} and Hardy Kornfeld2,*

* Division of Pulmonary and Critical Care Medicine, University of Massachusetts Medical School, Worcester, MA 01655; and {dagger} Pulmonary Center, Boston University School of Medicine, Boston, MA 02118


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Prior DNA microarray studies suggested that IL-16 mRNA levels decrease following T cell activation, a property unique among cytokines. We examined pro-IL-16 mRNA and protein expression in resting and anti-CD3 mAb-activated primary murine CD4+ T cells. Consistent with the microarray reports, pro-IL-16 mRNA levels fell within 4 h of activation, and this response is inhibited by cyclosporin A. Total cellular pro-IL-16 protein also fell, reaching a nadir at 48 h. Pro-IL-16 comprises a C-terminal cytokine domain and an N-terminal prodomain that are cleaved by caspase-3. Pro-IL-16 expressed in transfected tumor cells was previously shown to translocate to the nucleus and to promote G0/G1 arrest by stabilizing the cyclin-dependent kinase inhibitor p27Kip1. In the present study, we observed increased S-phase kinase-associated protein 2 mRNA expression in IL-16 null mice, but basal expression and activation-dependent regulation of p27Kip1 were no different from wild-type mice. Stimulation with anti-CD3 mAb induced transiently greater thymidine incorporation in IL-16-deficient CD4+ T cells than wild-type controls, but there was no difference in cell survival or in the CFSE dilution profiles. Analysis of CD4+ T cell proliferation in vivo using BrdU labeling similarly failed to identify a hyperproliferative phenotype in T cells lacking IL-16. These data demonstrate that pro-IL-16 mRNA and protein expression are dynamically regulated during CD4+ T cell activation by a calcineurin-dependent mechanism, and that pro-IL-16 might influence T cell cycle regulation, although not in a dominant manner.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The cytokine IL-16 was originally identified as a chemoattractant activity for CD4+ T cells (1, 2). Subsequent molecular cloning of the human and murine cDNA and genes revealed that the cytokine comprises the C-terminal end of a precursor molecule that is constitutively expressed in a high proportion of human peripheral blood T lymphocytes (3, 4). Caspase-3 was identified as the protease responsible for cleaving pro-IL-16 (5); this is reminiscent of pro-IL-1{beta} and pro-IL-18 cleavage by caspase-1, although these cytokines bear no sequence homology or known functional relationship to IL-16 (6). Several biological activities in addition to chemoattractant activity have been attributed to IL-16, which appears to use CD4 as a receptor on target cells (7).

The IL-16 prodomain is highly conserved across mammalian species and contains several modular functional sequences, including two PDZ domains and a CcN motif consisting of a nuclear localization signal (NLS),3 and substrate sites for casein kinase (CK2) kinase and cdc2 kinase (3, 8). These features suggest the potential for independent intracellular biological activities of the IL-16 prodomain, and this has been borne out by recent studies. Nuclear translocation of the IL-16 prodomain dependent on the NLS has been demonstrated in transfected COS cells (9), and nuclear pro-IL-16 was reported to induce p27Kip1-dependent G0/G1 arrest in transfected Jurkat cells by inhibiting transcription of S-phase kinase-associated protein (Skp2), which is a component of the ubiquitination complex that degrades p27Kip1 (10). These data suggest that pro-IL-16 may be involved in regulating T lymphocyte proliferation, given the abundant evidence that p27Kip1 degradation is required for resting T cells to re-enter the cell cycle upon activation (11, 12, 13).

In two DNA microarray studies reported by other laboratories, IL-16 mRNA levels in human T cells were shown to fall after activation with PMA plus ionomycin, anti-CD3 mAb plus PMA, or anti-CD3 plus anti-CD28 plus PMA (14, 15). A third microarray study using tumor Ag-specific murine T cells also identified IL-16 among genes whose expression is down-modulated following activation (16). These findings, together with the evidence that pro-IL-16 expression stabilizes p27Kip1, led to the proposal that activation-induced down-modulation of pro-IL-16 in T lymphocytes could be a necessary step to allow their subsequent proliferation (10). To address this question, we studied the regulation of IL-16 mRNA and protein in primary murine CD4+ T cells activated by anti-CD3 mAb. Our results confirm the activation-induced reduction of IL-16 mRNA and demonstrate a parallel decrease in intracellular pro-IL-16 protein. However, comparing wild-type and IL-16-deficient T cells, we found no difference in p27Kip1 protein levels under basal or activated conditions and only subtle differences in assays of cell proliferation. We conclude that the absence of basal expression of pro-IL-16 is not sufficient to alter the proliferation of naive murine CD4+ T cells. The dynamic regulation of pro-IL-16 mRNA and protein expression in activated T cells suggest functionally significant roles in this setting that remain to be discovered.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Antibodies

Polyclonal rabbit anti-mouse IL-16 prodomain Ab was generated by immunizing rabbits with a recombinant prodomain protein expressed in Escherichia coli (Strategic Biosolutions). Immune rabbit serum purified by protein A binding was validated by ELISA and Western blot. Unconjugated anti-mouse CD3 and anti-mouse CD28 mAb, as well as anti-human IL-16-PE (14.1), anti-mouse CD71 FITC (C2), anti-mouse CD4 PE (GK1.5), anti-BrdU FITC (3D4), and matching isotype controls were purchased from BD Pharmingen. Anti-{beta}-actin was purchased from Sigma-Aldrich. Rabbit polyclonal anti-p27Kip1 was purchased from Abcam.

Mice

Wild-type BALB/c mice were purchased from Taconic Farms and maintained in the Animal Medicine facility at University of Massachusetts Medical School. The Institutional Animal Care and Use Committee approved all experiments. IL-16-deficient mice were created by targeted mutation of the coding sequences for the mature IL-16 cytokine, leaving the prodomain intact. This was achieved by replacing all of exon VI and portions of exons V and VII with a neomycin resistance gene in reverse orientation. The mutated IL-16 gene fragment was ligated into pKO (Stratagene). After homologous recombination, this vector contained coding sequences for the IL-16 prodomain plus 18 residues of the IL-16 cytokine downstream from the caspase-3 site. The targeting construct was transfected into 129/SvJ embryonic stem cells, and 192 G418-resistant clones were isolated. Southern analysis with 5'-specific and 3'-specific probes and with a neo probe identified 10 candidates, one of which was injected into C57BL/6 embryoblasts that were implanted into pseudopregnant BALB/c females. From these procedures and subsequent breeding, homozygous IL-16–/– mice were produced. Targeted disruption was confirmed by Southern analysis of genomic DNA and Northern analysis (data not shown), as well as by Western blot analysis for IL-16 protein in splenocytes using mAb 14.1 (see Fig. 5A). Although mRNA sequences coding for the prodomain are expressed in these mice, the mutated pro-IL-16 protein appears to be unstable because it was not detectable by Western blot of splenocyte lysates using the polyclonal anti-prodomain Ab (see Fig. 4B). Mice were backcrossed on the BALB/c or the C57BL/6 backgrounds for nine generations. Comparative studies were performed using IL-16+/+ littermate controls.



View larger version (51K):
[in this window]
[in a new window]
 
FIGURE 5. p27Kip1 expression in wild-type and IL-16 null CD4+ T cells. A, p27Kip1 expression was tested by immunoblotting in unstimulated IL-16+/+ (wild-type (WT)) and IL-16–/– (knockout (KO)) CD4+ T cells with an anti-mouse p27Kip1 mAb in lysates prepared from unstimulated cells (0 h), or cells activated with plate-bound anti-CD3 mAb for the indicated times. B, Lysates were prepared from IL-16+/+ (WT) and IL-16–/– (KO) CD4+ T cells that were first activated with plate-bound anti-CD3 mAb for 48 h, then washed and incubated with fresh medium for 24 or 48 h to deplete IL-2. Lysates were analyzed for the presence of p27Kip1 by immunoblotting with monoclonal anti-p27.

 


View larger version (55K):
[in this window]
[in a new window]
 
FIGURE 4. Targeted mutation of IL-16. IL-16 null mice were produced, as described in Materials and Methods. A, IL-16 cytokine expression was tested by immunoblotting with mAb 14.1 using lysates prepared from IL-16+/+ splenocytes (wild-type (WT)), IL-16–/– splenocytes (knockout (KO)), human PBMC (huPBMC), or human rIL-16 cytokine (rIL-16). The location of the pro-IL-16 band is marked by the left arrow, while the location of the rIL-16 band is marked by the right arrow. B, Pro-IL-16 expression in wild-type (WT) and IL-16–/– (KO) spleen and lymph nodes was analyzed by immunoblotting with polyclonal Ab against murine IL-16 prodomain. The level of {beta}-actin in each lysate was also demonstrated by immunoblotting.

 
CD4+ T cell isolation and activation

Pooled splenic and lymph node leukocytes were purified by density gradient centrifugation with Lympholyte-M (Cedarlane Laboratories), followed by positive selection using anti-CD4-conjugated magnetic beads (Dynal Biotech). By flow cytometry, the purified population contained >90% CD4+CD3+ T cells. All cell cultures used RPMI 1640 medium (Invitrogen Life Technologies) supplemented with 10% FCS, 2 mM L-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, and 10 mM 2-ME. For activation, 24-well plates were coated with 2 µg/ml anti-mouse CD3 mAb in HBSS (Invitrogen Life Technologies) at 4°C overnight. Three million CD4+ T cells were added to each well and incubated at 37°C for various times, as indicated in Results.

Immunoblotting

Total cell lysates were prepared from activated CD4+ T cells washed in cold PBS by incubation in radioimmunoprecipitation buffer containing 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40, 0.25% Na-deoxycholate, and 1 mM PMSF on ice for 30 min, followed by centrifugation (14,000 x g, 10 min). Supernatant protein concentration was measured by Bradford assay. Proteins (50 µg per lane) were resolved by 10% SDS-PAGE, and then transferred to polyvinylidene difluoride membranes (Bio-Rad). Blots were blocked for 1 h with 5% nonfat dry milk in PBS, incubated with the primary Ab at room temperature for 2 h, and then washed three times with 0.05% Tween 20 in PBS. Blots were next incubated with HRP-labeled secondary Ab (Pierce) for 1 h at room temperature, and then washed three times with 0.05% Tween 20 in PBS. Immunoreactive bands were detected using SuperSignal West Pico Chemiluminescent Substrate (Pierce).

Real-time PCR analysis of IL-16, Skp2, and p27Kip1 mRNA

Total RNA was extracted from CD4+ T cells using TRIzol (Invitrogen Life Technologies) and treated with DNase I (30 min, 37°C). cDNA was prepared with the SuperScript First-Strand Synthesis System (Invitrogen Life Technologies) using 5 µg of DNaseI-treated RNA and random hexamers. Real-time PCR was conducted using a PTC-200 DNA Engine TM Cycler and CFD-3220 Opticon TM 2 Detector (MJ Research). Each 25 µl reaction contained 25 pM of each forward and reverse primer, 1 µl of cDNA, 0.25 U of Platinum TaqDNA polymerase (Invitrogen Life Technologies), 5 µl of 5x enhancer, 2.5 µl of 10x PCR buffer, 1 µl of 25 mM MgCl2, and 1.25 µl of 1/10,000 dilution SYBR Green (Molecular Probes). Thermal cycling conditions were enzyme activation, 94°C for 15 min; denaturation, 94°C for 15 s; and annealing and extension, 60°C for 1 min. Mouse {beta}-actin primers: forward, CACACCCGCCACCAGTTC; reverse, CTTCTGACCCATTCCCACCA. Mouse pro-IL-16 primers: forward, CAGCCATTCAGCCTACACCA; reverse, CGTCCTCCATCTTGCTTTCC. Mouse p27Kip1 primers: forward, TTGGGTCTCAGGCAAACTCT; reverse, AGCAGGTCGCTTCCTCATC. Mouse Skp2 primers: forward, CAAAGTGTGCCGTTGTCTCT; reverse, GTCAAAGTTCCACCGTTCTC. Each sample was amplified in triplicate, and results for each condition were normalized to {beta}-actin at each time point.

Proliferation assays

For in vitro proliferation, 1 x 105 CD4+ T cells/well were cultured in 96-well round-bottom plates in complete medium alone, or with the addition of anti-CD3 plus anti-CD28 mAb (1 µg/ml each). At indicated intervals, cultures were pulsed with 0.4 µCi/well [3H]thymidine for 18 h, harvested, and counted on a {beta} plate reader. All conditions were performed in quadruplicate. To assess the proliferative response of previously activated cells, CD4+ T cells were first stimulated with anti-CD3 and anti-CD28 for 48 h. Cultures were then washed extensively, and cells were suspended in complete medium supplemented with 50 ng/ml rIL-2 expressed in our laboratory using Pichia pastoris. After 5 days, viable cells were recovered by density gradient centrifugation using Lympholyte-M and replated in equal numbers. Cells were then restimulated with anti-CD3 plus anti-CD28, and [3H]thymidine incorporation was assessed 48 h later. For in vivo proliferation, mice were injected i.p. with 1 mg of BrdU (Sigma-Aldrich) four times over 48 h. Lymph nodes and spleens were harvested 12 h after the last injection.

Flow cytometry

Intracellular staining with PE-conjugated anti-human IL-16 mAb 14.1 was performed using Cytofix/Cytoperm kits (BD Pharmingen), according to the manufacturer’s protocol. Cells were either unstimulated or treated with 2 µg/ml Con A. Staining with mAb 14.1 was negative in IL-16 null mice, confirming the specificity of this mAb for detecting intracellular IL-16 in wild-type mice (data not shown). BrdU intracellular staining was done with a BrdU flow kit (BD Pharmingen), according to the manufacturer’s protocol. Cells were stained with anti-BrdU FITC, mouse anti-CD4 PE, and 7-aminoactinomycin D. All counts were acquired using a BD LSR flow cytometer, and the data were analyzed using FlowJo software (TreeStar).

In other proliferation studies, splenocytes were stained in PBS containing 1 µM CFSE (Molecular Probes) at 37°C for 15 min, and then pelleted and resuspended in complete medium for 30 min. Cells were next washed twice in PBS and then cultured in complete medium in the presence or absence of Con A (2 µg/ml) for 48 or 72 h. Cells were harvested, stained with PerCP-labeled anti-CD4 mAb (BD Biosciences), and analyzed on a FACSCalibur flow cytometer (BD Biosciences). Analyses were performed on 2 x 104 viable cells gated according to their forward/side scatter profile and CD4 expression. Data were analyzed using CellQuest software (BD Biosciences).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
IL-16 mRNA expression in resting and activated lymphocytes

IL-16 mRNA is constitutively expressed in mouse spleen, lymph nodes, and thymus (3). IL-16 mRNA is also constitutively expressed in human spleen, thymus, and PBMC (4). Despite its constitutive expression in a high proportion of naive lymphocytes, data from three independent DNA microarray studies suggest that IL-16 is dynamically regulated at the level of transcription (14, 15, 16). Using stimuli ranging from PMA plus ionophore to specific Ag, all three microarray studies identified IL-16 among genes whose expression was down-modulated after T cell activation. To confirm the microarray data, we measured IL-16 mRNA levels by real-time PCR in primary mouse CD4+ T cells stimulated with plate-bound anti-CD3 mAb. Consistent with the microarray reports, we found that IL-16 mRNA is expressed in naive T cells and the level falls within 4 h of activation, partially recovering by 48 h (Fig. 1A). Relative to {beta}-actin, there was a maximal 5.3-fold reduction in the steady state IL-16 mRNA level 4 h after activation. Two of the previously cited DNA microarray studies also reported that down-modulation of IL-16 mRNA in human T cells activated with PMA plus ionophore or PMA plus anti-CD3 mAb was reversed by cyclosporin A (CsA) (14, 15). To determine whether CsA similarly affects IL-16 expression in primary murine T cells, we treated purified CD4+ T cells with 5 µM CsA before anti-CD3 stimulation. In untreated T cells, we observed the expected activation-induced decline of IL-16 mRNA, whereas in cells pretreated with CsA there was a 2.4-fold increase in IL-16 expression relative to {beta}-actin (Fig. 1B). These data indicate that the down-regulation of IL-16 mRNA expression occurring in activated T cells depends on the function of calcineurin and its downstream target NF-AT. A role for calcium signaling in the activation-dependent down-regulation of IL-16 was further supported by our observation that mRNA levels fall in CD4+ T cells treated with ionomycin alone (Fig. 1C).



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 1. IL-16 mRNA expression in resting and activated CD4+ T cells. A, IL-16 mRNA levels measured by real-time RT-PCR in unstimulated CD4+ T cells and in cells stimulated with plate-bound anti-CD3 mAb for 4, 24, or 48 h. The data are expressed as mean arbitrary units (AU) ± SD, derived by normalizing IL-16 to {beta}-actin amplification at each time point (n = 3). B, IL-16 mRNA expression in CD4+ T cells activated with anti-CD3 mAb after pretreatment with 5 µM CsA for 30 min. C, IL-16 mRNA expression in CD4+ T treated with 2.5 µM ionomycin.

 
IL-16 protein levels in resting and activated lymphocytes

A substantial proportion of circulating human T cells constitutively expresses pro-IL-16 protein. By flow cytometry with intracellular staining, over 70% of unstimulated human peripheral blood CD4+ and CD8+ T cells were found to be IL-16 positive (3). To characterize pro-IL-16 protein expression in primary murine T cells, we prepared lysates of unstimulated and anti-CD3-stimulated murine CD4+ T cells for immunoblot analysis. Blots were probed with a rabbit polyclonal anti-mouse IL-16 prodomain Ab described in Materials and Methods. Consistent with the mRNA data, pro-IL-16 protein was readily detected in unstimulated cells, and the level dropped following activation (Fig. 2A). The pro-IL-16 protein level was moderately reduced by 4 h, reaching a nadir at 48 h after stimulation. Costimulation with anti-CD28 mAb did not amplify the pro-IL-16 response to stimulation using 1 µg/ml anti-CD3, but anti-CD28 did increase the response to suboptimal concentrations of anti-CD3 (data not shown). Also consistent with the mRNA data, we found that CsA pretreatment preserved pro-IL-16 protein in anti-CD3-activated T cells, and pro-IL-16 protein levels declined in cells stimulated with ionomycin alone (Fig. 2B).



View larger version (43K):
[in this window]
[in a new window]
 
FIGURE 2. Pro-IL-16 protein level in activated CD4+ T cells. A, Splenic CD4+ T cells were stimulated with plate-bound anti-CD3 mAb for the indicated times, and then cell lysates were prepared and analyzed for the presence of pro-IL-16 by immunoblotting with polyclonal Ab against mouse IL-16 prodomain. Basal pro-IL-16 expression was measured in lysates of freshly prepared CD4+ T cells cultured in medium alone (0 h). As a loading control, the level of {beta}-actin in each sample was also measured by immunoblotting. B, IL-16 protein expression in CD4+ T cells activated with anti-CD3 mAb after pretreatment with 5 µM CsA for 30 min, and in cells treated with 2.5 µM ionomycin for the indicated times.

 
The IL-16 protein content of resting and activated murine CD4+ T cells was also examined by flow cytometry. The majority of naive CD4+ T cells (74.6%) were IL-16 positive and CD71 negative. After stimulation with Con A, the majority population (78.9%) shifted to become IL-16 negative and CD71 positive (Fig. 3). Although there was variability in the percentage of IL-16-positive CD4+ T cells between experiments, a marked reduction from the basal level of IL-16 content was consistently seen after stimulation. Cells were prepared for intracellular staining using an anti-human IL-16 mAb (14.1) that recognizes an epitope in the C terminus of the pro-IL-16 cytokine domain (17). A single amino acid difference exists between human and murine IL-16 within this epitope, but the mAb is nonetheless capable of binding to murine IL-16 in immunoblots (3). The observed variation in IL-16-positive naive CD4+ T cells may be attributable to borderline sensitivity for murine IL-16 of the anti-human IL-16 mAb used for these experiments. In the immunoblot experiments, there was no significant variability of pro-IL-16 protein content in unstimulated T cells from different donors.



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 3. Activation reduces the proportion of IL-16-positive CD4+ T cells. Unstimulated CD4+ T cells (A) or cells stimulated with 5 µg/ml Con A for 24 h (B) were prepared for intracellular staining with anti-IL-16 mAb 14.1 with surface staining for CD71. The percentage of IL-16-positive cells, set according to isotype-matched controls (data not shown), is indicated in each quadrant.

 
Influence of pro-IL-16 on cell cycle regulation

A major role for p27Kip1 in the regulation of T cell proliferation has been confirmed by several laboratories. Hara et al. (18) reported that the degradation of p27Kip1 following T cell activation is due initially to Skp2-independent ubiquitination, but that Skp2 mediates the persistent reduction of p27Kip1 beyond 24 h. Huleatt et al. (13) found that p27Kip1 levels drop in activated T cells, but are restored when activated cells are deprived of IL-2, coincident with cell cycle arrest. Together with evidence that pro-IL-16 stabilizes p27Kip1 in Jurkat cells, these data suggested that the constitutive expression of pro-IL-16 might serve to block cycling of naive T cells. In this model, the down-regulation of pro-IL-16 that occurs after activation would permit entry of activated T cells into the cell cycle.

We created an IL-16 null mouse that lacks expression of full-length pro-IL-16 protein, as described in Materials and Methods (Fig. 4). Mice deficient in pro-IL-16 have no overt unstressed phenotype; they grow normally to adulthood and they have normal proportions of CD4+ and CD8+ T cells, although the yield of T cells from spleens of mature knockout mice is ~70% of the total for wild-type mice (our unpublished observations). To examine the effects of IL-16 deficiency on p27Kip1 expression, we prepared immunoblots of lysates from naive and anti-CD3-activated wild-type and IL-16 null CD4+ T cells (Fig. 5A). There was no significant difference in the basal level of p27Kip1, nor in its activation-induced down-regulation. Withdrawal of IL-2 was previously reported to be a potent stimulus for the re-expression of p27Kip1 in activated T cells (13). When IL-16 null CD4+ T cells were activated with anti-CD3 and then deprived of IL-2 by replacing the medium, p27Kip1 increased comparably to the response of wild-type cells (Fig. 5B). These results indicate that p27Kip1 is not destabilized by the absence of pro-IL-16 in primary murine CD4+ T cells.

The expression of IL-16, Skp2, and p27Kip1 mRNA in naive and anti-CD3-activated wild-type and pro-IL-16 null CD4+ T cells was measured by real-time RT-PCR (Fig. 6). The primers used to amplify IL-16 are complementary to sequences retained in the mutated IL-16 gene. Normalized to {beta}-actin, the basal expression of muted IL-16 sequence expressed in IL-16 null T cells was 4.2-fold higher compared with wild-type T cells, and dropped 3.8-fold after activation (data not shown). Consistent with the reported repressive effect of pro-IL-16 overexpression on Skp2 transcription in transfected Jurkat cells, the basal level of Skp2 mRNA was 4.3-fold increased in IL-16 null as compared with wild-type T cells (Fig. 6A). Expression of Skp2 increased 9.1-fold after activation in IL-16 null T cells, and increased 5.8-fold in wild-type T cells. Finally, there was no difference in basal p27Kip1 mRNA expression comparing IL-16 null and wild-type T cells. Activation with anti-CD3 resulted in a 9-fold decrease of p27Kip1 mRNA in wild-type T cells, and a 20.5-fold decrease in IL-16 null T cells (Fig. 6B). Together, these data demonstrate that the steady state level and activation-dependent increase in Skp2 mRNA expression are influenced by pro-IL-16, despite the lack of evidence for a dominant downstream effect on p27Kip1 protein levels.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 6. Skp2 and p27Kip1 mRNA expression in IL-16 null and wild-type CD4+ T cells. Total cellular RNA was harvested from unstimulated CD4+ T cells (0 h) and cells stimulated with plate-bound anti-CD3 mAb for 4, 24, or 48 h for real-time RT-PCR measurement of Skp2 (A) and p27Kip1 (B). The data are expressed as mean arbitrary units ± SD (n = 3), by normalization to {beta}-actin at each time point.

 
If pro-IL-16 functions to check the proliferation of naive T cells by a mechanism that lacks any redundant checkpoint controls, then it would be predicted that loss of pro-IL-16 should be sufficient to permit a hyperproliferative phenotype. This was first evaluated by comparing the CFSE dilution profile of IL-16 null and wild-type CD4+ T cells following stimulation with anti-CD3 plus anti-CD28 for 48 or 72 h. Although some individual variation was observed, no consistent differences were seen in the profiles from IL-16 null or wild-type T cells (Fig. 7). Proliferation of IL-16 null and wild-type CD4+ T cells was also assessed by thymidine incorporation over 6 successive days following activation with anti-CD3 plus anti-CD28 mAb. IL-16 null T cells exhibited significantly higher thymidine incorporation than wild type on day 3, and there was a trend for greater incorporation by IL-16 null cells on day 2 that did not reach statistical significance (Fig. 8A). However, there was no difference in thymidine incorporation between wild-type and IL-16 null T cells on days 4, 5, or 6, and no survival difference at any time point (Fig. 8B). The proliferative response of previously activated CD4+ T cells was tested by stimulation for 48 h with anti-CD3 plus anti-CD28, followed by incubation for 5 days in the presence of rIL-2. Viable cells were recovered by density gradient centrifugation and replated in equal numbers for restimulation with anti-CD3 plus anti-CD28. Thymidine incorporation measured at 48 h was significantly lower in IL-16 null CD4+ T cells as compared with wild type (Fig. 8C). The basis for these subtle but reproducible and statistically significant differences in T cell proliferation remains to be determined, but the data do not support the hypothesis that any effect of pro-IL-16 on the cell cycle occurs via a nonredundant pathway.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 7. CFSE dilution profiles of wild-type and IL-16 null CD4+ T cells. A, Splenocytes from wild-type (WT, solid line) and IL-16 knockout (KO, dotted line) were preincubated for 15 min with 1 µM CFSE and then activated with 2 µg/ml Con A. After 48 h, cells were surface stained with anti-CD4 and analyzed by flow cytometry, gating on CD4-positive cells. B, The bar graph plots the mean percentage of CD4-positive cells in each CFSE peak ± SD (n = 4) from splenocytes stimulated with Con A for 72 h.

 


View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 8. Thymidine incorporation and survival of activated wild-type and IL-16 null CD4+ T cells. A, Wild-type (WT) and IL-16 knockout (KO) CD4+ T cells were stimulated with anti-CD3 plus anti-CD28, and proliferation was assessed by [3H]thymidine incorporation every 24 h from day 2 through day 6 after stimulation. Results are presented as mean cpm ± SD for cells from four individual mice plated in replicates of four for each condition. A significant difference (*, p = 0.013) was observed only on day 3. B, Survival of activated CD4+ T cells was assessed by trypan blue dye exclusion every 24 h from day 2 through day 6 after stimulation. There was no difference between wild-type and IL-16 knockout cells at any time point. C, Proliferation after secondary stimulation was assessed by first activating naive CD4+ T cells with anti-CD3 plus anti-CD28 for 48 h, and then resting cells in rIL-2 for 5 days before restimulation with anti-CD3 plus anti-CD28. Proliferation was assessed by [3H]thymidine incorporation 48 h later. *, p = 0.001 (n = 4).

 
To further test the hypothesis that pro-IL-16 expression is necessary to maintain resting T cells in a nonproliferating state, we conducted in vivo cell cycle analysis using BrdU incorporation. Cells from the spleen and lymph nodes were purified and analyzed separately by flow cytometry with intracellular staining for BrdU and surface staining for CD4. Comparing IL-16 null and wild-type cells, there were no statistically significant differences in the percentage of BrdU-positive, G0/G1, G2 + M, or S cells (Table I). A limited comparison of BrdU incorporation of T cells harvested from draining lymph nodes 2 wk after s.c. injection of Mycobacterium bovis bacillus Calmette-Guerin also failed to identify any difference in the response of wild-type or IL-16 null T cells (data not shown).


View this table:
[in this window]
[in a new window]
 
Table I. In vivo CD4+ T cell proliferation

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Pro-IL-16 mRNA and protein are constitutively expressed in a high proportion of T lymphocytes freshly isolated from peripheral blood, spleen, lymph node, and thymus. Several prior DNA microarray studies indicated that IL-16 is among the most strongly down-regulated mRNA species during T cell activation, and the only cytokine gene whose expression is not increased in this setting (14, 16, 19). In the present study, we measured pro-IL-16 mRNA by real-time PCR in primary murine CD4+ T cells before and after stimulation with plate-bound anti-CD3 mAb. Our results confirm the microarray data by demonstrating a >5-fold decline in IL-16 mRNA, and for the first time we show that pro-IL-16 protein levels in murine CD4+ T cells also decrease in an activation-dependent manner. In addition, we confirmed that the down-regulation of pro-IL-16 mRNA is inhibited by CsA, indicating that IL-16 gene expression is modulated by a calcium signal following T cell activation. Additional evidence that calcium signaling plays a role in the activation-dependent regulation of pro-IL-16 was provided by experiments showing that pro-IL-16 mRNA and protein levels fall in response to ionomycin treatment.

Pro-IL-16 is a bifunctional molecule; cleavage by caspase-3 releases the IL-16 cytokine that is exported to the extracellular space by an unknown mechanism to act in trans on IL-16-responsive cells through its interaction with CD4 and possibly other surface receptors (7, 20, 21). The remaining IL-16 prodomain contains PDZ domains and a CcN motif, suggesting functions involving protein-protein interactions and nuclear translocation. Indeed, Bannert et al. (22) identified myosin phosphatase-targeting subunits as PDZ-mediated binding partners of pro-IL-16 by yeast two-hybrid screening. In independent two-hybrid studies, we observed a similar interaction with myosin phosphatase-targeting subunits, and we also identified the adaptor protein Lasp-1 as a pro-IL-16-binding partner (S. Kim, unpublished observations). Lasp-1 is comprised of a LIM domain, a Src homology 3 domain, and an actin binding domain (23). These data suggest an association of pro-IL-16 or its prodomain with molecular complexes involving the cytoskeleton, but to date provide no further insight to its functions.

Building on the observation that expression of the IL-16 prodomain in tumor cell lines triggered growth arrest and apoptosis, Zhang et al. (9) have developed a solid body of evidence supporting a role for IL-16 in cell cycle regulation. In COS cells transfected with full-length pro-IL-16 constructs having N-terminal GFP and C-terminal FLAG fusions, they determined that full-length pro-IL-16 localizes to perinuclear and reticular regions in the cell. COS cells constitutively express activated caspase-3 and spontaneously cleave the transfected pro-IL-16. By confocal microscopy, the cleaved IL-16 prodomain fragment was observed to target the nucleus, and this was abrogated by mutation of the NLS. Expression of the IL-16 prodomain in transfected COS cells was also shown to mediate G0/G1 cell cycle arrest, and this activity was dependent on nuclear translocation. Subsequently, this group determined that nuclear translocation of the IL-16 prodomain is controlled by a phosphorylation-regulated CcN motif, and that mutation of either the CK2 substrate site or the cdc2 kinase impairs the ability of the IL-16 prodomain to induce G0/G1 cell cycle arrest (8). A mechanism for the influence of pro-IL-16 on T cell cycle was reported recently by Center et al. (10). Using Jurkat cells stably transfected with inducible pro-IL-16 expression vectors, it was shown that ectopic expression of pro-IL-16 stabilizes the cyclin-dependent kinase inhibitor p27Kip1 by repressing the transcription of Skp2, a critical component of the SCFSkp2 ubiquitin E3 ligase complex that degrades p27Kip1 and was sufficient to induce cell cycle arrest at G1 in pro-IL-16-negative Jurkat cells. Those studies did not address the question posed in this manuscript as to whether the loss of pro-IL-16 is necessary to permit entry of primary T cells into S phase following TCR activation and whether it is sufficient to permit normal resting T cells to proliferate without a stimulus. A critical role for pro-IL-16 in regulating T cell cycle was also suggested by the intriguing observation that pro-IL-16 is mutated in three additional T cell tumor lines (HUT78, SUP-T1, and H9). HUT78 and SUP-T1 lack nuclear expression of endogenous pro-IL-16 expression due to gene deletion. Pro-IL-16 is expressed in H9 cells, but in these cells NLS is mutated.

Based on the data from pro-IL-16-transfected cells, we anticipated that CD4+ T cells from mice deficient in IL-16 would exhibit a hyperproliferative phenotype. Indeed, basal and stimulated levels of Skp2 mRNA are elevated in IL-16 null CD4+ T cells consistent with the reported repression of Skp2 transcription by pro-IL-16 in transfected human cell lines. Despite the increase in Skp2 mRNA levels in IL-16 null mice, there is no corresponding reduction in p27Kip1 protein and no alternation in the dynamic regulation of p27Kip1 following T cell activation or IL-2 withdrawal. We found little evidence to suggest that T cells lacking pro-IL-16 are hyperproliferative. Following primary stimulation in vitro, IL-16 null T cells demonstrate a transient, but consistent increase in thymidine incorporation at 72 h. However, there is no consistent difference in CFSE dilution profiles, and there appears to be no net increase in proliferating cells or any difference in the survival of activated T cells. To circumvent the artificial conditions of in vitro T cell culture, we also analyzed the proliferation of T cells labeled in vivo with BrdU. These experiments failed to reveal any cell cycle differences in splenic or lymph node CD4+ T cells from wild-type and IL-16 null mice. Although the data do not support a role for pro-IL-16 in holding naive cells in G0, the differences in Skp2 mRNA expression and thymidine incorporation by IL-16 null cells suggest that pro-IL-16 functions in some way to influence T cell cycling following TCR activation. The apparently normal expression of p27Kip1 in IL-16 null T cells might reflect compensatory mechanisms established in development. Alternatively, our data could reflect a regulatory scheme in which the influence of endogenous pro-IL-16 and Skp2 on p27Kip1 is not a dominant factor for primary murine CD4+ T cells under the activation conditions that we studied. In this regard, degradation of p27Kip1 at the G0-G1 transition was reported to be mediated by Skp2-independent ubiquitination pathway (18). Thus, while the ectopic expression of nuclear pro-IL-16 is sufficient to maintain G1 in human T cell tumor lines, its absence is not sufficient to permit primary T cells to continuously cycle once activated.

Aside from the PDZ domains and other functional motifs shared with a wide range of genes, pro-IL-16 is a unique molecule with no apparent family members. The amino acid sequence of IL-16 is highly conserved across mammalian species, and this sequence conservation spans both cytokine domain and the prodomain of pro-IL-16 (3). These features suggest that IL-16 and the prodomain of its precursor protein serve important and potentially nonredundant functions in T cells. In the present study, we found that pro-IL-16 expression is dynamically regulated during CD4+ T activation. Although pro-IL-16 does not appear to check the proliferation of naive T cells, our data suggest a role for pro-IL-16 in T cell activation and cell cycle events that has yet to be identified. Macian et al. (24) reported that NF-AT activation by ionomycin induces a limited set of anergy-associated genes in T cells, and a functional state of TCR unresponsiveness. Based on our finding that ionomycin induces pro-IL-16 mRNA and protein down-regulation, we are currently investigating a possible role for pro-IL-16 in tolerance.


    Disclosures
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Acknowledgments
 
This work is dedicated to the memory of Sue Kim Hanson, Peter Hanson, and Christine Lee Hanson, who died on 09/11/01.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by Grants HL72647 (to H.K.) and AI 50516, AI 35680, and HL32802 (to D.C.) from the National Institutes of Health. Back

2 Address correspondence and reprint requests to Dr. Hardy Kornfeld, Division of Pulmonary and Critical Care Medicine, University of Massachusetts Medical School, LRB-303, 55 Lake Avenue North, Worcester, MA 01655. E-mail address: Hardy.Kornfeld{at}umassmed.edu Back

3 Abbreviations used in this paper: NLS, nuclear localization signal; CsA, cyclosporin A; CK2, casein kinase, Skp, S-phase kinase-associated protein. Back

Received for publication March 16, 2004. Accepted for publication December 15, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. Center, D. M., W. W. Cruikshank. 1982. Modulation of lymphocyte migration by human lymphokines. I. Identification of characterization of chemoattractant activity for lymphocytes from mitogen-stimulated mononuclear cells. J. Immunol. 128:2563.[Medline]
  2. Berman, J. S., W. W. Cruikshank, D. M. Center, A. C. Theodore, D. J. Beer. 1985. Chemoattractant lymphokines specific for the helper/inducer T-lymphocyte subset. Cell. Immunol. 95:105.[Medline]
  3. Keane, J., J. Nicoll, S. Kim, D. M. Wu, W. W. Cruikshank, W. Brazer, B. Natke, Y. Zhang, D. M. Center, H. Kornfeld. 1998. Conservation of structure and function between human and murine IL-16. J. Immunol. 160:5945.[Abstract/Free Full Text]
  4. Chupp, G. L., E. A. Wright, D. Wu, M. Vallen-Mashikian, W. W. Cruikshank, D. M. Center, H. Kornfeld, J. S. Berman. 1998. Tissue and T cell distribution of precursor and mature IL-16. J. Immunol. 161:3114.[Abstract/Free Full Text]
  5. Zhang, Y., D. M. Center, D. M. Wu, W. W. Cruikshank, J. Yuan, D. W. Andrews, H. Kornfeld. 1998. Processing and activation of pro-interleukin-16 by caspase-3. J. Biol. Chem. 273:1144.[Abstract/Free Full Text]
  6. Dinarello, C. A.. 1998. Interleukin-1{beta}, interleukin-18, and the interleukin-1{beta} converting enzyme. Ann. NY Acad. Sci. 856:1.[Medline]
  7. Center, D. M., H. Kornfeld, W. W. Cruikshank. 1996. Interleukin 16 and its function as a CD4 ligand. Immunol. Today 17:476.[Medline]
  8. Wilson, K. C., W. W. Cruikshank, D. M. Center, Y. Zhang. 2002. Prointerleukin-16 contains a functional CcN motif that regulates nuclear localization. Biochemistry 41:14306.[Medline]
  9. Zhang, Y., H. Kornfeld, W. W. Cruikshank, S. Kim, C. Campbell Reardon, D. M. Center. 2001. Nuclear translocation of the N-terminal pro-domain of interleukin-16. J. Biol. Chem. 276:1299.[Abstract/Free Full Text]
  10. Center, D. M., W. W. Cruikshank, Y. Zhang. 2004. Nuclear pro-IL-16 regulation of T cell proliferation: p27Kip1-dependent G0/G1 arrest mediated by inhibition of Skp2 transcription. J. Immunol. 172:1654.[Abstract/Free Full Text]
  11. Mohapatra, S., D. Agrawal, W. J. Pledger. 2001. p27Kip1 regulates T cell proliferation. J. Biol. Chem. 276:21976.[Abstract/Free Full Text]
  12. Appleman, L. J., A. A. van Puijenbroek, K. M. Shu, L. M. Nadler, V. A. Boussiotis. 2002. CD28 costimulation mediates down-regulation of p27kip1 and cell cycle progression by activation of the PI3K/PKB signaling pathway in primary human T cells. J. Immunol. 168:2729.[Abstract/Free Full Text]
  13. Huleatt, J. W., J. Cresswell, K. Bottomly, I. N. Crispe. 2003. p27kip1 regulates the cell cycle arrest and survival of activated T lymphocytes in response to interleukin-2 withdrawal. Immunology 108:493.[Medline]
  14. Feske, S., J. Giltnane, R. Dolmetsch, L. M. Staudt, A. Rao. 2001. Gene regulation mediated by calcium signals in T lymphocytes. Nat. Immunol. 2:316.[Medline]
  15. Cristillo, A. D., B. E. Bierer. 2002. Identification of novel targets of immunosuppressive agents by cDNA-based microarray analysis. J. Biol. Chem. 277:4465.[Abstract/Free Full Text]
  16. Zhang, X., Z. Chen, H. Huang, J. R. Gordon, J. Xiang. 2002. DNA microarray analysis of the gene expression profiles of naive versus activated tumor-specific T cells. Life Sci. 71:3005.[Medline]
  17. Nicoll, J., W. W. Cruikshank, W. Brazer, Y. Liu, D. M. Center, H. Kornfeld. 1999. Identification of domains in IL-16 critical for biological activity. J. Immunol. 163:1827.[Abstract/Free Full Text]
  18. Hara, T., T. Kamura, K. Nakayama, K. Oshikawa, S. Hatakeyama, K. Nakayama. 2001. Degradation of p27Kip1 at the G0-G1 transition mediated by a Skp2-independent ubiquitination pathway. J. Biol. Chem. 276:48937.[Abstract/Free Full Text]
  19. Lin, Z., G. C. Fillmore, T. H. Um, K. S. Elenitoba-Johnson, M. S. Lim. 2003. Comparative microarray analysis of gene expression during activation of human peripheral blood T cells and leukemic Jurkat T cells. Lab. Invest. 83:765.[Medline]
  20. Staudinger, R., S. K. Phogat, X. Xiao, X. Wang, D. S. Dimitrov, S. Zolla-Pazner. 2003. Evidence for CD4-enchanced signaling through the chemokine receptor CCR5. J. Biol. Chem. 278:10389.[Abstract/Free Full Text]
  21. Lynch, E. A., C. A. Heijens, N. F. Horst, D. M. Center, W. W. Cruikshank. 2003. Cutting edge: IL-16/CD4 preferentially induces Th1 cell migration: requirement of CCR5. J. Immunol. 171:4965.[Abstract/Free Full Text]
  22. Bannert, N., K. Vollhardt, B. Asomuddinov, M. Haag, H. Konig, S. Norley, R. Kurth. 2003. PDZ domain-mediated interaction of interleukin-16 precursor proteins with myosin phosphatase targeting subunits. J. Biol. Chem. 278:42190.[Abstract/Free Full Text]
  23. Schreiber, V., C. Moog-Lutz, C. H. Regnier, M. P. Chenard, H. Boeuf, J. L. Vonesch, C. Tomasetto, M. C. Rio. 1998. Lasp-1, a novel type of actin-binding protein accumulating in cell membrane extensions. Mol. Med. 4:675.[Medline]
  24. Macian, F., F. Garcia-Cozar, S. H. Im, H. F. Horton, M. C. Byrne, A. Rao. 2002. Transcriptional mechanisms underlying lymphocyte tolerance. Cell 109:719.[Medline]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
T. Alvaro, M. Lejeune, J. F. Garcia, Ma. T. Salvado, C. Lopez, R. Bosch, J. Jaen, P. Escriva, and L. E. Pons
Tumor-Infiltrated Immune Response Correlates with Alterations in the Apoptotic and Cell Cycle Pathways in Hodgkin and Reed-Sternberg Cells
Clin. Cancer Res., February 1, 2008; 14(3): 685 - 691.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Zhang, M. Tuzova, Z.-X. J. Xiao, W. W. Cruikshank, and D. M. Center
Pro-IL-16 Recruits Histone Deacetylase 3 to the Skp2 Core Promoter through Interaction with Transcription Factor GABP
J. Immunol., January 1, 2008; 180(1): 402 - 408.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Nakae, H. Suto, G. J. Berry, and S. J. Galli
Mast cell-derived TNF can promote Th17 cell-dependent neutrophil recruitment in ovalbumin-challenged OTII mice
Blood, May 1, 2007; 109(9): 3640 - 3648.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
E. Stabile, T. Kinnaird, A. la Sala, S. K. Hanson, C. Watkins, U. Campia, M. Shou, S. Zbinden, S. Fuchs, H. Kornfeld, et al.
CD8+ T Lymphocytes Regulate the Arteriogenic Response to Ischemia by Infiltrating the Site of Collateral Vessel Development and Recruiting CD4+ Mononuclear Cells Through the Expression of Interleukin-16
Circulation, January 3, 2006; 113(1): 118 - 124.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ren, F.
Right arrow Articles by Kornfeld, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ren, F.
Right arrow Articles by Kornfeld, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS