|
|
||||||||


* Division of Pulmonary and Critical Care Medicine, University of Massachusetts Medical School, Worcester, MA 01655; and
Pulmonary Center, Boston University School of Medicine, Boston, MA 02118
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
and pro-IL-18 cleavage by caspase-1, although these cytokines bear no sequence homology or known functional relationship to IL-16 (6). Several biological activities in addition to chemoattractant activity have been attributed to IL-16, which appears to use CD4 as a receptor on target cells (7). The IL-16 prodomain is highly conserved across mammalian species and contains several modular functional sequences, including two PDZ domains and a CcN motif consisting of a nuclear localization signal (NLS),3 and substrate sites for casein kinase (CK2) kinase and cdc2 kinase (3, 8). These features suggest the potential for independent intracellular biological activities of the IL-16 prodomain, and this has been borne out by recent studies. Nuclear translocation of the IL-16 prodomain dependent on the NLS has been demonstrated in transfected COS cells (9), and nuclear pro-IL-16 was reported to induce p27Kip1-dependent G0/G1 arrest in transfected Jurkat cells by inhibiting transcription of S-phase kinase-associated protein (Skp2), which is a component of the ubiquitination complex that degrades p27Kip1 (10). These data suggest that pro-IL-16 may be involved in regulating T lymphocyte proliferation, given the abundant evidence that p27Kip1 degradation is required for resting T cells to re-enter the cell cycle upon activation (11, 12, 13).
In two DNA microarray studies reported by other laboratories, IL-16 mRNA levels in human T cells were shown to fall after activation with PMA plus ionomycin, anti-CD3 mAb plus PMA, or anti-CD3 plus anti-CD28 plus PMA (14, 15). A third microarray study using tumor Ag-specific murine T cells also identified IL-16 among genes whose expression is down-modulated following activation (16). These findings, together with the evidence that pro-IL-16 expression stabilizes p27Kip1, led to the proposal that activation-induced down-modulation of pro-IL-16 in T lymphocytes could be a necessary step to allow their subsequent proliferation (10). To address this question, we studied the regulation of IL-16 mRNA and protein in primary murine CD4+ T cells activated by anti-CD3 mAb. Our results confirm the activation-induced reduction of IL-16 mRNA and demonstrate a parallel decrease in intracellular pro-IL-16 protein. However, comparing wild-type and IL-16-deficient T cells, we found no difference in p27Kip1 protein levels under basal or activated conditions and only subtle differences in assays of cell proliferation. We conclude that the absence of basal expression of pro-IL-16 is not sufficient to alter the proliferation of naive murine CD4+ T cells. The dynamic regulation of pro-IL-16 mRNA and protein expression in activated T cells suggest functionally significant roles in this setting that remain to be discovered.
| Materials and Methods |
|---|
|
|
|---|
Polyclonal rabbit anti-mouse IL-16 prodomain Ab was generated by immunizing rabbits with a recombinant prodomain protein expressed in Escherichia coli (Strategic Biosolutions). Immune rabbit serum purified by protein A binding was validated by ELISA and Western blot. Unconjugated anti-mouse CD3 and anti-mouse CD28 mAb, as well as anti-human IL-16-PE (14.1), anti-mouse CD71 FITC (C2), anti-mouse CD4 PE (GK1.5), anti-BrdU FITC (3D4), and matching isotype controls were purchased from BD Pharmingen. Anti-
-actin was purchased from Sigma-Aldrich. Rabbit polyclonal anti-p27Kip1 was purchased from Abcam.
Mice
Wild-type BALB/c mice were purchased from Taconic Farms and maintained in the Animal Medicine facility at University of Massachusetts Medical School. The Institutional Animal Care and Use Committee approved all experiments. IL-16-deficient mice were created by targeted mutation of the coding sequences for the mature IL-16 cytokine, leaving the prodomain intact. This was achieved by replacing all of exon VI and portions of exons V and VII with a neomycin resistance gene in reverse orientation. The mutated IL-16 gene fragment was ligated into pKO (Stratagene). After homologous recombination, this vector contained coding sequences for the IL-16 prodomain plus 18 residues of the IL-16 cytokine downstream from the caspase-3 site. The targeting construct was transfected into 129/SvJ embryonic stem cells, and 192 G418-resistant clones were isolated. Southern analysis with 5'-specific and 3'-specific probes and with a neo probe identified 10 candidates, one of which was injected into C57BL/6 embryoblasts that were implanted into pseudopregnant BALB/c females. From these procedures and subsequent breeding, homozygous IL-16/ mice were produced. Targeted disruption was confirmed by Southern analysis of genomic DNA and Northern analysis (data not shown), as well as by Western blot analysis for IL-16 protein in splenocytes using mAb 14.1 (see Fig. 5A). Although mRNA sequences coding for the prodomain are expressed in these mice, the mutated pro-IL-16 protein appears to be unstable because it was not detectable by Western blot of splenocyte lysates using the polyclonal anti-prodomain Ab (see Fig. 4B). Mice were backcrossed on the BALB/c or the C57BL/6 backgrounds for nine generations. Comparative studies were performed using IL-16+/+ littermate controls.
|
|
Pooled splenic and lymph node leukocytes were purified by density gradient centrifugation with Lympholyte-M (Cedarlane Laboratories), followed by positive selection using anti-CD4-conjugated magnetic beads (Dynal Biotech). By flow cytometry, the purified population contained >90% CD4+CD3+ T cells. All cell cultures used RPMI 1640 medium (Invitrogen Life Technologies) supplemented with 10% FCS, 2 mM L-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, and 10 mM 2-ME. For activation, 24-well plates were coated with 2 µg/ml anti-mouse CD3 mAb in HBSS (Invitrogen Life Technologies) at 4°C overnight. Three million CD4+ T cells were added to each well and incubated at 37°C for various times, as indicated in Results.
Immunoblotting
Total cell lysates were prepared from activated CD4+ T cells washed in cold PBS by incubation in radioimmunoprecipitation buffer containing 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40, 0.25% Na-deoxycholate, and 1 mM PMSF on ice for 30 min, followed by centrifugation (14,000 x g, 10 min). Supernatant protein concentration was measured by Bradford assay. Proteins (50 µg per lane) were resolved by 10% SDS-PAGE, and then transferred to polyvinylidene difluoride membranes (Bio-Rad). Blots were blocked for 1 h with 5% nonfat dry milk in PBS, incubated with the primary Ab at room temperature for 2 h, and then washed three times with 0.05% Tween 20 in PBS. Blots were next incubated with HRP-labeled secondary Ab (Pierce) for 1 h at room temperature, and then washed three times with 0.05% Tween 20 in PBS. Immunoreactive bands were detected using SuperSignal West Pico Chemiluminescent Substrate (Pierce).
Real-time PCR analysis of IL-16, Skp2, and p27Kip1 mRNA
Total RNA was extracted from CD4+ T cells using TRIzol (Invitrogen Life Technologies) and treated with DNase I (30 min, 37°C). cDNA was prepared with the SuperScript First-Strand Synthesis System (Invitrogen Life Technologies) using 5 µg of DNaseI-treated RNA and random hexamers. Real-time PCR was conducted using a PTC-200 DNA Engine TM Cycler and CFD-3220 Opticon TM 2 Detector (MJ Research). Each 25 µl reaction contained 25 pM of each forward and reverse primer, 1 µl of cDNA, 0.25 U of Platinum TaqDNA polymerase (Invitrogen Life Technologies), 5 µl of 5x enhancer, 2.5 µl of 10x PCR buffer, 1 µl of 25 mM MgCl2, and 1.25 µl of 1/10,000 dilution SYBR Green (Molecular Probes). Thermal cycling conditions were enzyme activation, 94°C for 15 min; denaturation, 94°C for 15 s; and annealing and extension, 60°C for 1 min. Mouse
-actin primers: forward, CACACCCGCCACCAGTTC; reverse, CTTCTGACCCATTCCCACCA. Mouse pro-IL-16 primers: forward, CAGCCATTCAGCCTACACCA; reverse, CGTCCTCCATCTTGCTTTCC. Mouse p27Kip1 primers: forward, TTGGGTCTCAGGCAAACTCT; reverse, AGCAGGTCGCTTCCTCATC. Mouse Skp2 primers: forward, CAAAGTGTGCCGTTGTCTCT; reverse, GTCAAAGTTCCACCGTTCTC. Each sample was amplified in triplicate, and results for each condition were normalized to
-actin at each time point.
Proliferation assays
For in vitro proliferation, 1 x 105 CD4+ T cells/well were cultured in 96-well round-bottom plates in complete medium alone, or with the addition of anti-CD3 plus anti-CD28 mAb (1 µg/ml each). At indicated intervals, cultures were pulsed with 0.4 µCi/well [3H]thymidine for 18 h, harvested, and counted on a
plate reader. All conditions were performed in quadruplicate. To assess the proliferative response of previously activated cells, CD4+ T cells were first stimulated with anti-CD3 and anti-CD28 for 48 h. Cultures were then washed extensively, and cells were suspended in complete medium supplemented with 50 ng/ml rIL-2 expressed in our laboratory using Pichia pastoris. After 5 days, viable cells were recovered by density gradient centrifugation using Lympholyte-M and replated in equal numbers. Cells were then restimulated with anti-CD3 plus anti-CD28, and [3H]thymidine incorporation was assessed 48 h later. For in vivo proliferation, mice were injected i.p. with 1 mg of BrdU (Sigma-Aldrich) four times over 48 h. Lymph nodes and spleens were harvested 12 h after the last injection.
Flow cytometry
Intracellular staining with PE-conjugated anti-human IL-16 mAb 14.1 was performed using Cytofix/Cytoperm kits (BD Pharmingen), according to the manufacturers protocol. Cells were either unstimulated or treated with 2 µg/ml Con A. Staining with mAb 14.1 was negative in IL-16 null mice, confirming the specificity of this mAb for detecting intracellular IL-16 in wild-type mice (data not shown). BrdU intracellular staining was done with a BrdU flow kit (BD Pharmingen), according to the manufacturers protocol. Cells were stained with anti-BrdU FITC, mouse anti-CD4 PE, and 7-aminoactinomycin D. All counts were acquired using a BD LSR flow cytometer, and the data were analyzed using FlowJo software (TreeStar).
In other proliferation studies, splenocytes were stained in PBS containing 1 µM CFSE (Molecular Probes) at 37°C for 15 min, and then pelleted and resuspended in complete medium for 30 min. Cells were next washed twice in PBS and then cultured in complete medium in the presence or absence of Con A (2 µg/ml) for 48 or 72 h. Cells were harvested, stained with PerCP-labeled anti-CD4 mAb (BD Biosciences), and analyzed on a FACSCalibur flow cytometer (BD Biosciences). Analyses were performed on 2 x 104 viable cells gated according to their forward/side scatter profile and CD4 expression. Data were analyzed using CellQuest software (BD Biosciences).
| Results |
|---|
|
|
|---|
IL-16 mRNA is constitutively expressed in mouse spleen, lymph nodes, and thymus (3). IL-16 mRNA is also constitutively expressed in human spleen, thymus, and PBMC (4). Despite its constitutive expression in a high proportion of naive lymphocytes, data from three independent DNA microarray studies suggest that IL-16 is dynamically regulated at the level of transcription (14, 15, 16). Using stimuli ranging from PMA plus ionophore to specific Ag, all three microarray studies identified IL-16 among genes whose expression was down-modulated after T cell activation. To confirm the microarray data, we measured IL-16 mRNA levels by real-time PCR in primary mouse CD4+ T cells stimulated with plate-bound anti-CD3 mAb. Consistent with the microarray reports, we found that IL-16 mRNA is expressed in naive T cells and the level falls within 4 h of activation, partially recovering by 48 h (Fig. 1A). Relative to
-actin, there was a maximal 5.3-fold reduction in the steady state IL-16 mRNA level 4 h after activation. Two of the previously cited DNA microarray studies also reported that down-modulation of IL-16 mRNA in human T cells activated with PMA plus ionophore or PMA plus anti-CD3 mAb was reversed by cyclosporin A (CsA) (14, 15). To determine whether CsA similarly affects IL-16 expression in primary murine T cells, we treated purified CD4+ T cells with 5 µM CsA before anti-CD3 stimulation. In untreated T cells, we observed the expected activation-induced decline of IL-16 mRNA, whereas in cells pretreated with CsA there was a 2.4-fold increase in IL-16 expression relative to
-actin (Fig. 1B). These data indicate that the down-regulation of IL-16 mRNA expression occurring in activated T cells depends on the function of calcineurin and its downstream target NF-AT. A role for calcium signaling in the activation-dependent down-regulation of IL-16 was further supported by our observation that mRNA levels fall in CD4+ T cells treated with ionomycin alone (Fig. 1C).
|
A substantial proportion of circulating human T cells constitutively expresses pro-IL-16 protein. By flow cytometry with intracellular staining, over 70% of unstimulated human peripheral blood CD4+ and CD8+ T cells were found to be IL-16 positive (3). To characterize pro-IL-16 protein expression in primary murine T cells, we prepared lysates of unstimulated and anti-CD3-stimulated murine CD4+ T cells for immunoblot analysis. Blots were probed with a rabbit polyclonal anti-mouse IL-16 prodomain Ab described in Materials and Methods. Consistent with the mRNA data, pro-IL-16 protein was readily detected in unstimulated cells, and the level dropped following activation (Fig. 2A). The pro-IL-16 protein level was moderately reduced by 4 h, reaching a nadir at 48 h after stimulation. Costimulation with anti-CD28 mAb did not amplify the pro-IL-16 response to stimulation using 1 µg/ml anti-CD3, but anti-CD28 did increase the response to suboptimal concentrations of anti-CD3 (data not shown). Also consistent with the mRNA data, we found that CsA pretreatment preserved pro-IL-16 protein in anti-CD3-activated T cells, and pro-IL-16 protein levels declined in cells stimulated with ionomycin alone (Fig. 2B).
|
|
A major role for p27Kip1 in the regulation of T cell proliferation has been confirmed by several laboratories. Hara et al. (18) reported that the degradation of p27Kip1 following T cell activation is due initially to Skp2-independent ubiquitination, but that Skp2 mediates the persistent reduction of p27Kip1 beyond 24 h. Huleatt et al. (13) found that p27Kip1 levels drop in activated T cells, but are restored when activated cells are deprived of IL-2, coincident with cell cycle arrest. Together with evidence that pro-IL-16 stabilizes p27Kip1 in Jurkat cells, these data suggested that the constitutive expression of pro-IL-16 might serve to block cycling of naive T cells. In this model, the down-regulation of pro-IL-16 that occurs after activation would permit entry of activated T cells into the cell cycle.
We created an IL-16 null mouse that lacks expression of full-length pro-IL-16 protein, as described in Materials and Methods (Fig. 4). Mice deficient in pro-IL-16 have no overt unstressed phenotype; they grow normally to adulthood and they have normal proportions of CD4+ and CD8+ T cells, although the yield of T cells from spleens of mature knockout mice is
70% of the total for wild-type mice (our unpublished observations). To examine the effects of IL-16 deficiency on p27Kip1 expression, we prepared immunoblots of lysates from naive and anti-CD3-activated wild-type and IL-16 null CD4+ T cells (Fig. 5A). There was no significant difference in the basal level of p27Kip1, nor in its activation-induced down-regulation. Withdrawal of IL-2 was previously reported to be a potent stimulus for the re-expression of p27Kip1 in activated T cells (13). When IL-16 null CD4+ T cells were activated with anti-CD3 and then deprived of IL-2 by replacing the medium, p27Kip1 increased comparably to the response of wild-type cells (Fig. 5B). These results indicate that p27Kip1 is not destabilized by the absence of pro-IL-16 in primary murine CD4+ T cells.
The expression of IL-16, Skp2, and p27Kip1 mRNA in naive and anti-CD3-activated wild-type and pro-IL-16 null CD4+ T cells was measured by real-time RT-PCR (Fig. 6). The primers used to amplify IL-16 are complementary to sequences retained in the mutated IL-16 gene. Normalized to
-actin, the basal expression of muted IL-16 sequence expressed in IL-16 null T cells was 4.2-fold higher compared with wild-type T cells, and dropped 3.8-fold after activation (data not shown). Consistent with the reported repressive effect of pro-IL-16 overexpression on Skp2 transcription in transfected Jurkat cells, the basal level of Skp2 mRNA was 4.3-fold increased in IL-16 null as compared with wild-type T cells (Fig. 6A). Expression of Skp2 increased 9.1-fold after activation in IL-16 null T cells, and increased 5.8-fold in wild-type T cells. Finally, there was no difference in basal p27Kip1 mRNA expression comparing IL-16 null and wild-type T cells. Activation with anti-CD3 resulted in a 9-fold decrease of p27Kip1 mRNA in wild-type T cells, and a 20.5-fold decrease in IL-16 null T cells (Fig. 6B). Together, these data demonstrate that the steady state level and activation-dependent increase in Skp2 mRNA expression are influenced by pro-IL-16, despite the lack of evidence for a dominant downstream effect on p27Kip1 protein levels.
|
|
|
|
| Discussion |
|---|
|
|
|---|
Pro-IL-16 is a bifunctional molecule; cleavage by caspase-3 releases the IL-16 cytokine that is exported to the extracellular space by an unknown mechanism to act in trans on IL-16-responsive cells through its interaction with CD4 and possibly other surface receptors (7, 20, 21). The remaining IL-16 prodomain contains PDZ domains and a CcN motif, suggesting functions involving protein-protein interactions and nuclear translocation. Indeed, Bannert et al. (22) identified myosin phosphatase-targeting subunits as PDZ-mediated binding partners of pro-IL-16 by yeast two-hybrid screening. In independent two-hybrid studies, we observed a similar interaction with myosin phosphatase-targeting subunits, and we also identified the adaptor protein Lasp-1 as a pro-IL-16-binding partner (S. Kim, unpublished observations). Lasp-1 is comprised of a LIM domain, a Src homology 3 domain, and an actin binding domain (23). These data suggest an association of pro-IL-16 or its prodomain with molecular complexes involving the cytoskeleton, but to date provide no further insight to its functions.
Building on the observation that expression of the IL-16 prodomain in tumor cell lines triggered growth arrest and apoptosis, Zhang et al. (9) have developed a solid body of evidence supporting a role for IL-16 in cell cycle regulation. In COS cells transfected with full-length pro-IL-16 constructs having N-terminal GFP and C-terminal FLAG fusions, they determined that full-length pro-IL-16 localizes to perinuclear and reticular regions in the cell. COS cells constitutively express activated caspase-3 and spontaneously cleave the transfected pro-IL-16. By confocal microscopy, the cleaved IL-16 prodomain fragment was observed to target the nucleus, and this was abrogated by mutation of the NLS. Expression of the IL-16 prodomain in transfected COS cells was also shown to mediate G0/G1 cell cycle arrest, and this activity was dependent on nuclear translocation. Subsequently, this group determined that nuclear translocation of the IL-16 prodomain is controlled by a phosphorylation-regulated CcN motif, and that mutation of either the CK2 substrate site or the cdc2 kinase impairs the ability of the IL-16 prodomain to induce G0/G1 cell cycle arrest (8). A mechanism for the influence of pro-IL-16 on T cell cycle was reported recently by Center et al. (10). Using Jurkat cells stably transfected with inducible pro-IL-16 expression vectors, it was shown that ectopic expression of pro-IL-16 stabilizes the cyclin-dependent kinase inhibitor p27Kip1 by repressing the transcription of Skp2, a critical component of the SCFSkp2 ubiquitin E3 ligase complex that degrades p27Kip1 and was sufficient to induce cell cycle arrest at G1 in pro-IL-16-negative Jurkat cells. Those studies did not address the question posed in this manuscript as to whether the loss of pro-IL-16 is necessary to permit entry of primary T cells into S phase following TCR activation and whether it is sufficient to permit normal resting T cells to proliferate without a stimulus. A critical role for pro-IL-16 in regulating T cell cycle was also suggested by the intriguing observation that pro-IL-16 is mutated in three additional T cell tumor lines (HUT78, SUP-T1, and H9). HUT78 and SUP-T1 lack nuclear expression of endogenous pro-IL-16 expression due to gene deletion. Pro-IL-16 is expressed in H9 cells, but in these cells NLS is mutated.
Based on the data from pro-IL-16-transfected cells, we anticipated that CD4+ T cells from mice deficient in IL-16 would exhibit a hyperproliferative phenotype. Indeed, basal and stimulated levels of Skp2 mRNA are elevated in IL-16 null CD4+ T cells consistent with the reported repression of Skp2 transcription by pro-IL-16 in transfected human cell lines. Despite the increase in Skp2 mRNA levels in IL-16 null mice, there is no corresponding reduction in p27Kip1 protein and no alternation in the dynamic regulation of p27Kip1 following T cell activation or IL-2 withdrawal. We found little evidence to suggest that T cells lacking pro-IL-16 are hyperproliferative. Following primary stimulation in vitro, IL-16 null T cells demonstrate a transient, but consistent increase in thymidine incorporation at 72 h. However, there is no consistent difference in CFSE dilution profiles, and there appears to be no net increase in proliferating cells or any difference in the survival of activated T cells. To circumvent the artificial conditions of in vitro T cell culture, we also analyzed the proliferation of T cells labeled in vivo with BrdU. These experiments failed to reveal any cell cycle differences in splenic or lymph node CD4+ T cells from wild-type and IL-16 null mice. Although the data do not support a role for pro-IL-16 in holding naive cells in G0, the differences in Skp2 mRNA expression and thymidine incorporation by IL-16 null cells suggest that pro-IL-16 functions in some way to influence T cell cycling following TCR activation. The apparently normal expression of p27Kip1 in IL-16 null T cells might reflect compensatory mechanisms established in development. Alternatively, our data could reflect a regulatory scheme in which the influence of endogenous pro-IL-16 and Skp2 on p27Kip1 is not a dominant factor for primary murine CD4+ T cells under the activation conditions that we studied. In this regard, degradation of p27Kip1 at the G0-G1 transition was reported to be mediated by Skp2-independent ubiquitination pathway (18). Thus, while the ectopic expression of nuclear pro-IL-16 is sufficient to maintain G1 in human T cell tumor lines, its absence is not sufficient to permit primary T cells to continuously cycle once activated.
Aside from the PDZ domains and other functional motifs shared with a wide range of genes, pro-IL-16 is a unique molecule with no apparent family members. The amino acid sequence of IL-16 is highly conserved across mammalian species, and this sequence conservation spans both cytokine domain and the prodomain of pro-IL-16 (3). These features suggest that IL-16 and the prodomain of its precursor protein serve important and potentially nonredundant functions in T cells. In the present study, we found that pro-IL-16 expression is dynamically regulated during CD4+ T activation. Although pro-IL-16 does not appear to check the proliferation of naive T cells, our data suggest a role for pro-IL-16 in T cell activation and cell cycle events that has yet to be identified. Macian et al. (24) reported that NF-AT activation by ionomycin induces a limited set of anergy-associated genes in T cells, and a functional state of TCR unresponsiveness. Based on our finding that ionomycin induces pro-IL-16 mRNA and protein down-regulation, we are currently investigating a possible role for pro-IL-16 in tolerance.
| Disclosures |
|---|
|
|
|---|
| Acknowledgments |
|---|
| Footnotes |
|---|
1 This work was supported by Grants HL72647 (to H.K.) and AI 50516, AI 35680, and HL32802 (to D.C.) from the National Institutes of Health. ![]()
2 Address correspondence and reprint requests to Dr. Hardy Kornfeld, Division of Pulmonary and Critical Care Medicine, University of Massachusetts Medical School, LRB-303, 55 Lake Avenue North, Worcester, MA 01655. E-mail address: Hardy.Kornfeld{at}umassmed.edu ![]()
3 Abbreviations used in this paper: NLS, nuclear localization signal; CsA, cyclosporin A; CK2, casein kinase, Skp, S-phase kinase-associated protein. ![]()
Received for publication March 16, 2004. Accepted for publication December 15, 2004.
| References |
|---|
|
|
|---|
, interleukin-18, and the interleukin-1
converting enzyme. Ann. NY Acad. Sci. 856:1.[Medline]
This article has been cited by other articles:
![]() |
T. Alvaro, M. Lejeune, J. F. Garcia, Ma. T. Salvado, C. Lopez, R. Bosch, J. Jaen, P. Escriva, and L. E. Pons Tumor-Infiltrated Immune Response Correlates with Alterations in the Apoptotic and Cell Cycle Pathways in Hodgkin and Reed-Sternberg Cells Clin. Cancer Res., February 1, 2008; 14(3): 685 - 691. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhang, M. Tuzova, Z.-X. J. Xiao, W. W. Cruikshank, and D. M. Center Pro-IL-16 Recruits Histone Deacetylase 3 to the Skp2 Core Promoter through Interaction with Transcription Factor GABP J. Immunol., January 1, 2008; 180(1): 402 - 408. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nakae, H. Suto, G. J. Berry, and S. J. Galli Mast cell-derived TNF can promote Th17 cell-dependent neutrophil recruitment in ovalbumin-challenged OTII mice Blood, May 1, 2007; 109(9): 3640 - 3648. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Stabile, T. Kinnaird, A. la Sala, S. K. Hanson, C. Watkins, U. Campia, M. Shou, S. Zbinden, S. Fuchs, H. Kornfeld, et al. CD8+ T Lymphocytes Regulate the Arteriogenic Response to Ischemia by Infiltrating the Site of Collateral Vessel Development and Recruiting CD4+ Mononuclear Cells Through the Expression of Interleukin-16 Circulation, January 3, 2006; 113(1): 118 - 124. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |