The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Canfield, S.
Right arrow Articles by Rothman, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Canfield, S.
Right arrow Articles by Rothman, P.
The Journal of Immunology, 2005, 174: 2494-2498.
Copyright © 2005 by The American Association of Immunologists

CUTTING EDGE

Cutting Edge: IL-4 Induces Suppressor of Cytokine Signaling-3 Expression in B Cells by a Mechanism Dependent on Activation of p38 MAPK1

Stephen Canfield2,*, Youngnam Lee*, Andreas Schröder* and Paul Rothman{dagger}

* Department of Medicine, Columbia University College of Physicians and Surgeons, New York, NY 10032; and {dagger} Department of Medicine, University of Iowa, Iowa City, IA 52242


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 
The signaling cascade initiated by IL-4 is classically divisible into two major pathways: one mediated by STAT6, and the other by insulin receptor substrates-1 and -2 via activation of PI3K. In murine splenic B cells, the suppressor of cytokine signaling (SOCS)3 is inducible by IL-4 via a mechanism independent of STAT6 and PI3K. SOCS3 expression increases 9-fold within 5 h of IL-4 treatment. This induction occurs normally in B cells deficient in STAT6 and is unaffected by pretreatment with the PI3K inhibitor wortmannin, or with the ERK pathway inhibitor, PD98059. However, the IL-4 induction of SOCS3 is blocked by inhibitors of either the JNK or p38 MAPK pathways (SP600125 and SB203580, respectively). Direct examination of these pathways reveals rapid, IL-4-directed activation of p38 MAPK, uncovering a previously unappreciated pathway mediating IL-4 signal transduction.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results and Discussion
 Disclosures
 References
 
Interleukin-4 signaling has classically been viewed as divisible along two major intracellular transduction pathways (1). One is initiated with recruitment to IL-4R{alpha} of STAT6 which, in B cells, is required for IL-4-mediated up-regulation of MHC II, induction of CD23 expression, and class switch to IgE (2, 3). The other involves recruitment to the IL-4R{alpha} chain of insulin receptor substrate-2 (IRS-2)3 (and to a lesser extent IRS-1) with resulting recruitment of PI3K, generation of phosphoinositides, and activation of downstream kinases (protein kinase C, Akt) which play a critical role in cell proliferation and resistance to apoptosis (4, 5). There remains controversy, however, surrounding the role of a third major signaling pathway, the MAPK family, in IL-4 signaling. Two members of this family, p38 MAPK and JNK, are activated by a number of hemopoietic cytokines, including IL-2, IL-3, IL-7, G-CSF, and erythropoietin (6, 7, 8, 9, 10). IL-4 has been a noted exception among growth-promoting cytokines, showing no evidence of JNK or p38 MAPK activation in mast cells (7, 10). Although activation of p38 MAPK by IL-4 has been demonstrated in the murine pro-B cell line BA/F3 (11), p38 is not activated by IL-4 treatment in the RAMOS 2G6 human B cell line (12).

Using B cells deficient in STAT6 and/or treated with the PI3K-specific inhibitor wortmannin, we identified by gene expression profiling a set of genes whose expression is regulated by IL-4 independent of STAT6 and PI3K signaling pathways. Most prominent among these is the suppressor of cytokine signaling (SOCS)3. SOCS3 has previously been shown to be induced in a variety of cell types by LPS and TNF-{alpha} (13), IL-6 (14), IL-10 (15), IFN-{gamma} (16), and GM-CSF (17) by both STAT-dependent (16) and STAT-independent (15) mechanisms. In the current studies, we demonstrate that the up-regulation of SOCS3 expression in murine B cells upon IL-4 stimulation is dependent on activity of both the p38 MAPK and JNK pathways, and in addition, that the p38 MAPK pathway is directly and rapidly activated by IL-4, independent of STAT activation. These findings definitively establish the importance of a MAPK-mediated arm of IL-4 signaling in B cells, independent of STAT6 and PI3K.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results and Discussion
 Disclosures
 References
 
Isolation and stimulation of splenic B lymphocytes

B cells were isolated using the MACS system (Miltenyi Biotec). All pretreatment protocols were conducted at 37°C for 40 min before addition of IL-4. Wortmannin (BioSource International) was used to inhibit PI3K at a concentration of 100 nM based on previously published studies in neutrophils (18). The ERK kinase I inhibitor PD98059 (Promega) was used at a concentration of 50 µM based on prior work (19). The JNK inhibitor SP600125 (BIOMOL) was used at a concentration of 50 µM based on previously published work in monocytes (20). The p38 MAPK inhibitor SB203580 was used at a concentration of 12.5 µM, based on previously published work in T cells (21). In addition, dose-response curves for SP600125 and SB203580 revealed that the above concentrations represented the lowest dose yielding maximal inhibition of SOCS3 expression in IL-4-treated B cells. Mock pretreatment was performed with vehicle alone (DMSO) (maximum concentration 0.25%). Following pretreatment, cells were treated with murine IL-4 (10 ng/ml) for 5 h. For MAPK activation studies, B cells were serum-starved for 8 h before pretreatment as described, and treatment with IL-4 (10 ng/ml) for 5–15 min.

MAPK immunoblots

B cells were lysed in 1x Triton lysis buffer (Cell Signaling Technology) and immunoblotting was performed as described previously (22) (80 µg/lane). Blots were probed with the following polyclonal antisera according to the manufacturer’s instructions: phospho-ERK1/2 and total ERK1/2 (Promega), phospho-JNK1/2 and total JNK1/2 (Cell Signaling Technology), phospho-p38 MAPK and total p38 MAPK (Cell Signaling Technology).

In vitro kinase assay

Total JNK-1/2 and p38 MAPK were serially immunoprecipitated from 300 µg of B cell lysate as previously described (22) using 1 µg of anti-JNK-1/2 or anti-p38 MAPK Abs (Cell Signaling Technology). Washed immune complexes were equilibrated in kinase buffer and the kinase reactions performed as described (14) using recombinant c-Jun (MBL International) and myelin basic protein (Upstate Biotechnology) as substrates for JNK and p38 MAPK, respectively.

RNA purification and real-time PCR

RNA was isolated using the RNEasy system (Qiagen). Reverse transcription and real-time PCR were performed using the OmniScript and QuantiTect SYBR Green systems (Qiagen) on an ABI 7700 cycler (Applied Biosystems) with the cycling parameters: 95°C, 15 min denaturation; 95°C, 15 s->60°C, 30 s x 40 cycles. PCR primers: SOCS3 forward, tggatcagtatgatgctcc; SOCS3 reverse, tgaggaagaagccaatctg; proteasome subunit {alpha} type 3 (PMSA3) forward, tttgaactggagctcagctgg; PMSA3 reverse, tccatggtgctagccatatgc; NF of IL-3 (NFIL3) forward, gggaatagcaaacttatctgc; NFIL3 reverse, ttacctggagtccgaagccgag. All cDNA samples were amplified in triplicate wells in each PCR assay. The PCR products for SOCS3, NFIL3, and PMSA3 were each subcloned into the plasmid pCR2.1 (Invitrogen Life Technologies) and used to create standard curves allowing calculation of copy number.

B cell transduction with dominant-negative p38{alpha} isoform

The p38 AF mutant has been described (23) and was the generous gift of Dr. J. Han (The Scripps Research Institute, La Jolla, CA). This cDNA was subcloned into the retroviral expression vector pMIG8, derived from the parent vector pMIG (24) by replacement of the gene encoding GFP with one encoding the extracellular and transmembrane domains of the human CD8{alpha} polypeptide. The transduction protocol was as described previously (24).

EMSAs

The STAT EMSA was performed using whole cell extracts from wild-type or STAT6-deficient B cells prepared by the Nonidet P-40 lysis method (25). The ATF-2 and Elk-1 EMSAs were performed using nuclear extracts prepared from BALB/c B cells as described (26). EMSA binding reactions were conducted as described (22). The following double-stranded probes were used: STAT (B2 Short probe, Ref.27), gatgattccccgaaatatc; ATF-2 (cAMP-responsive element binding protein (CREB) probe, Promega), tgagagattgcctgacgtcagagagctagca; Elk-1 (E74b probe, Ref.28), ctagagctgaataaccggaagtaactcat. The ATF-2 supershift was performed by addition of a total ATF-2-specific polyclonal Ab (Cell Signaling Technology) at a 1/20 dilution for the final 10 min of the binding reaction.


   Results and Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
Disclosures
 References
 
SOCS3 expression is up-regulated by IL-4 by a mechanism independent of STAT6 and PI3K

We have previously used microarray screening to group IL-4-responsive genes in murine B cells according to their dependence on STAT6 signaling (24). These studies highlighted a subset of genes regulated by IL-4 in a STAT6-independent manner, and the most highly induced among these was SOCS3. Quantitation of SOCS3 expression by real-time PCR confirmed equivalent fold induction by IL-4 in wild-type and STAT6-deficient B cells (Fig. 1A). This finding raised the possibility that an alternative STAT family member might be partially reconstituting IL-4 signaling in the absence of STAT6. However, when this was investigated by EMSA using an oligomeric probe previously shown to bind STAT 1, 3, 5a, 5b, and 6 (27), there was no evidence of an IL-4-inducible complex in the STAT6-deficient cells (Fig. 1B). In addition to EMSA, STAT1 and STAT3 phosphorylation were directly examined by immunoblot using their respective anti-phospho-STAT Abs. No evidence was found of phosphorylation of either STAT family member in wild-type or STAT6-deficient B cells on IL-4 treatment for 5–20 min (data not shown).



View larger version (35K):
[in this window]
[in a new window]
  		FIGURE 1. IL-4-mediated induction of SOCS3 independent of STAT activation. A, Dark bars, copies of SOCS3 mRNA per 100 copies of PMSA3 determined by real-time PCR (mean ± SD of triplicate reactions). Light bars, copies of NFIL3 mRNA per 10 copies of PMSA3. Cells were pretreated with vehicle alone (–) or with one of the following: wortmannin (WT), PD98059 (PD), SB203580 (SB), SP600125 (SP) targeting PI3K, ERK, p38 MAPK, and JNK pathways, respectively. Cells were then treated for 5 h with IL-4 (+) (or mock-treated (–)). Induction of SOCS3 and NFIL3 in STAT6-deficient B cells is depicted as indicated. Statistical significance of selected comparisons (Student’s t test) is indicated. Lack of statistical significance (n.s.) denotes p > 0.05. Data is representative of a minimum of three independent determinations. B, STAT EMSA using whole cell extracts derived from BALB/c wild-type or STAT6-deficient B cells as indicated. The probe used binds STAT1, 3, 5a, 5b, and 6 (27 ). Lanes 1 and 4, untreated; lanes 2, 3, 5, and 6, IL-4-treated (10 ng/ml) for 5 or 20 min as indicated. Data is representative of two independent trials.

 
One major STAT6-independent signaling pathway mediating IL-4 effects in B cells involves activation of PI3K, recruited to the IL-4R{alpha} cytoplasmic tail by IRS-2. The STAT6-independent induction of SOCS3, therefore, suggested that PI3K might be important in the regulation of SOCS3 expression by IL-4. However, pretreatment of B cells with the PI3K-specific inhibitor wortmannin had no effect on IL-4-mediated SOCS3 induction, although in control experiments it significantly reduced the induction of another IL-4 responsive gene, NFIL3, which is dependent on both STAT6 and PI3K activity for optimal induction by IL-4 (Fig. 1A). Taken together, these results suggested that the effects of IL-4 on SOCS3 expression are mediated by signaling pathways independent of STAT6 and PI3K.

MAPK inhibitors block the up-regulation of SOCS3 expression by IL-4

SOCS3 induction by IL-6 in the HepG2 cell line occurs via a pathway dependent on p38 MAPK (14), suggesting a possible role for MAPK family members in SOCS3 induction by IL-4 in B cells. This possibility was investigated using three pathway-specific MAPK inhibitors. Pretreatment of BALB/c B cells with PD98059, an inhibitor of ERK-kinase I (MEK-1) activation had no significant effect on the up-regulation of SOCS3 by IL-4 (Fig. 1A). In contrast, pretreatment of these cells with the JNK inhibitor SP600125 led to the near complete loss of detectable SOCS3 mRNA both in unstimulated (not shown), and in IL-4-stimulated cells (Fig. 1A), suggesting that JNK activity is required for basal expression of SOCS3, regardless of IL-4 treatment. Pretreatment of B cells with the p38 MAPK inhibitor SB203580 also dramatically inhibited the IL-4-induced up-regulation of SOCS3. In contrast to the JNK inhibitor, however, the p38 MAPK inhibitor affected only the IL-4-mediated up-regulation of SOCS3. In a dose-responsive manner, SB203580 reduced SOCS3 expression levels in IL-4-stimulated cells to the level of unstimulated cells, but not below this baseline (data not shown). Neither the JNK nor p38 MAPK inhibitors had a significant effect on IL-4 induction of NFIL3 (Fig. 1A), indicating that the effects of these inhibitors on SOCS3 induction are not a reflection of nonspecific toxicity. These results suggest that while basal JNK activity is required for SOCS3 expression, p38 MAPK activity is required for the induction of SOCS3 by IL-4.

IL-4 treatment of splenic B cells results in rapid activation of p38 MAPK

The inhibition of SOCS3 induction by SB203580 suggested that p38 MAPK may be activated in response to IL-4 treatment in these cells. Direct examination of the phosphorylation status of all three MAPK pathways by immunoblot analysis confirmed this to be the case. B cells serum-starved for 8 h showed no evidence of ERK-1/2 activation upon treatment with IL-4 for 5–15 min (Fig. 2A). Similar results were obtained when JNK-1/2 phosphorylation was examined (Fig. 2B). In contrast, p38 MAPK showed a marked increase in phosphorylation within 5 min of IL-4 treatment (Fig. 2C).



View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 2. Activation status of MAPK family members after IL-4 treatment of BALB/c B cells. Immunoblots (A–C) of B cells treated for 0, 5, or 15 min with IL-4 as indicated. Phosphorylation status of ERK1/2 (A), JNK (B), and p38 MAPK (C) were assayed using respective phosphospecific Abs. D, In vitro kinase assay: total JNK-1/2 and p38 MAPK were serially immunoprecipitated from 300 µg of lysate and incubated with either c-jun (JNK substrate) or MBP (p38 substrate) in the presence of [{gamma}-32P]ATP. Control lane (C): sorbitol-treated Jurkat T cells in parallel immunoprecipitation/kinase reactions. After JNK and p38 immunoprecipitations, 15 µg of lysate for each condition was immunoblotted for actin (lower panel). Immunoblots are representative of at least three independent assays; the in vitro kinase data are representative of two independent determinations.

 
The activation state of JNK and p38 MAPK was further investigated by in vitro kinase assay in B cells treated with IL-4 for 15 min. Total JNK-1/2 and p38 MAPK were serially immunoprecipitated from 300 µg of lysate and the resulting complexes were assayed for kinase activity using recombinant c-Jun and myelin basic protein (MBP) as substrates for JNK and p38, respectively. IL-4 treatment resulted in no significant increase in JNK activity as evidenced by the lack of increased c-Jun phosphorylation in vitro (Fig. 2D). In contrast, p38 MAPK showed dramatically increased activity following IL-4 treatment, evidenced by increased phosphorylation of MBP. Taken together, these results confirm that while basal JNK activity is required for SOCS3 expression, the JNK pathway itself is not activated by IL-4 treatment. The p38 MAPK pathway, in contrast, is rapidly activated in B cells by treatment with IL-4, and this activation is required for IL-4 induction of SOCS3 expression.

IL-4 treatment of splenic B cells results in activation of transcription factors ATF-2 and Elk-1, substrates of p38 MAPK

The activation of p38 MAPK by IL-4 was pursued further by examining the phosphorylation status of two transcription factors, ATF-2 and Elk-1, which are targets of p38 MAPK. Activation of ATF-2 was assayed by EMSA using a double-stranded oligomer containing a consensus CREB binding site. Activation of Elk-1 was similarly assayed using an oligomer containing the Drosophila E-74 ets binding site, which has been shown to bind the Elk-1 DNA binding domain with high affinity and specificity (28). ATF-2 was rapidly activated (within 5 min of IL-4 treatment), producing a specific retarded species on EMSA (Fig. 3). The identity of the induced complex was verified by supershift using an ATF-2-specific Ab. Both p38 MAPK and JNK-1/2 are capable of ATF-2 phosphorylation. However, while pretreatment of the cells with the p38 MAPK inhibitor SB203580 resulted in complete abrogation of the ATF-2-containing complex induced by IL-4, this complex remained inducible in cells pretreated with the JNK-specific inhibitor SP600125.



View larger version (87K):
[in this window]
[in a new window]
  		FIGURE 3. EMSA for ATF-2 and Elk-1 activation after IL-4 treatment. BALB/c B cells were pretreated with SB203580 (SB), SP600125 (SP), or mock (–), followed by IL-4 treatment for 5 min and preparation of nuclear extracts. Left panel, IL-4 induction of ATF-2 binding activity represented by appearance of a new retarded species (arrow to left of panel); mobility of this species is further retarded (arrowhead to left of panel) by addition of an anti-ATF-2 supershift Ab ("ATF", lane 5) but not by rabbit preimmune serum ("Rab", lane 6). Right panel, IL-4 induction of Elk-1 binding activity represented by the appearance of a retarded species (arrow to left of panel); specificity of DNA binding is confirmed by competition with unlabeled probe in 10-fold (fifth lane) and 100-fold (sixth lane) excess. Each EMSA is representative of three independent assays.

 
B cell treatment with IL-4 also augmented the DNA-binding activity of Elk-1 (Fig. 3). The specificity of the induced complex was confirmed by competition using unlabeled oligomer in 10- and 100-fold excess. As was the case with ATF-2, pretreatment of the cells with SB203580 abrogated the IL-4-mediated induction of the Elk-1 complex, whereas inhibition of the JNK pathway by pretreatment with SP600125 had little if any effect on Elk-1 activation. These results confirm the activation of the p38 MAPK pathway, including two of its target transcription factors, upon IL-4 treatment and highlight the importance of p38 MAPK relative to JNK in mediating these phosphorylation events. The objective of these experiments was to corroborate the IL-4-mediated activation of p38 MAPK by identifying p38 substrates activated upon IL-4 treatment. It is of interest to note, however, that comparison of the SOCS3 5' genomic region with the TRANSFAC database (29, 30) reveals a predicted cAMP-responsive binding element (position –718 relative to the transcriptional start site) as well as two predicted Elk-1 binding elements (positions –1297 and +811 relative to the transcriptional start, the latter lying in the first intron of the SOCS3 gene). These sequence-based predictions are informing ongoing work characterizing the roles of ATF-2 and Elk-1 in the transcriptional regulation of SOCS3.

The IL-4-induced increase in SOCS3 expression is inhibited in B cells bearing a dominant-negative form of p38{alpha} MAPK

Site-directed mutagenesis of the threonine/tyrosine dual phosphorylation motif on p38 MAPK renders it incapable of being activated, and this mutant (p38 AF) exerts a dominant-negative effect on native p38 MAPK signaling (23). The p38 AF mutant was introduced by retroviral transduction into LPS-activated B cells (required for transduction), and its effect on IL-4-mediated SOCS3 induction was evaluated by real-time PCR (Fig. 4). Notably, as a result of LPS treatment, SOCS3 expression was elevated 15-fold in both vector- and p38 AF-transduced populations relative to freshly isolated B cells, consistent with published data demonstrating LPS induction of SOCS3 (13). Despite the LPS effect, however, IL-4 produced a significant and reproducible 2-fold increase in SOCS3 expression among the vector-transduced B cells. This induction was abrogated in cells expressing the dominant-negative p38 mutant. The p38 AF-transduced cells responded to IL-4 with a 4- to 5-fold induction of NFIL3, however, indicating that IL-4 signaling independent of p38 MAPK remains intact in this population. This data reaffirms the p38 MAPK dependence of SOCS3 induction by IL-4 using a highly specific biological inhibitor, a dominant-negative p38 mutant.



View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 4. Effect of dominant-negative p38 MAPK mutant on IL-4-mediated SOCS3 induction. Copies of SOCS3 (dark bars) or NFIL3 (light bars) mRNA per 100 copies of PMSA3 determined by real-time PCR as in Fig. 1. B cells were transduced with the dominant-negative p38 MAPK mutant (p38 AF) or empty vector. IL-4 treatment as in Fig. 1. Data is representative of three independent determinations.

 
The findings detailed here represent the first demonstration that MAPK family members participate in IL-4 signaling in primary lymphocytes. Our results differ from those of Foltz et al. (7), in which IL-4 treatment failed to activate p38 MAPK in mast cells. This discrepancy may highlight inherent differences in signal pathway use between these two cell types. The studies presented here also represent the first evidence that SOCS3 expression is up-regulated by IL-4 in primary B cells, and we have found similar induction by IL-4 in splenic T lymphocytes as well (our unpublished data). Interestingly, high SOCS3 expression relative to SOCS1 in CD4+ T cells has been reported to be a marker of Th2 lineage commitment (31). Although the mechanism of this elevation in SOCS3 expression has not been resolved, the current data suggest that IL-4 signaling itself, integral to Th2 differentiation, may be responsible for the maintenance of high SOCS3 expression in these cells. Our results clearly establish the p38 MAPK pathway as one element of the IL-4 signaling cascade, and a critical component for the up-regulation of SOCS3. Further work will be required to define the role of p38 MAPK signals in the overall biology of the IL-4 response.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by an Educational Research Trust award (to S.C.) from the American Academy of Allergy, Asthma, and Immunology and by National Institutes of Health Grant R01 AI54821 (to P.R.). Back

2 Address correspondence and reprint requests to Dr. Stephen Canfield, Department of Medicine, Columbia University College of Physicians and Surgeons, 630 West 168th Street, New York, NY 10032. E-mail address: smc12{at}columbia.edu Back

3 Abbreviations used in this paper: IRS, insulin receptor substrate; SOCS, suppressor of cytokine signaling; PMSA3, proteasome subunit {alpha} type 3; NFIL3, NF of IL-3; CREB, cAMP-responsive element binding protein; MBP, myelin basic protein. Back

Received for publication November 16, 2004. Accepted for publication January 9, 2005.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 Disclosures
 References
 

  1. Pernis, A., B. Witthuhn, A. D. Keegan, K. Nelms, E. Garfein, J. N. Ihle, W. E. Paul, J. H. Pierce, P. Rothman. 1995. Interleukin 4 signals through two related pathways. Proc. Natl. Acad. Sci. USA 92:7971.[Abstract/Free Full Text]
  2. Linehan, L. A., W. D. Warren, P. A. Thompson, M. J. Grusby, M. T. Berton. 1998. STAT6 is required for IL-4-induced germline Ig gene transcription and switch recombination. J. Immunol. 161:302.[Abstract/Free Full Text]
  3. Takeda, K., T. Tanaka, W. Shi, M. Matsumoto, M. Minami, S. Kashiwamura, K. Nakanishi, N. Yoshida, T. Kishimoto, S. Akira. 1996. Essential role of Stat6 in IL-4 signaling. Nature 380:627.[Medline]
  4. Paul, W. E.. 1997. Interleukin 4: signalling mechanisms and control of T cell differentiation. Ciba Found. Symp. 204:208.[Medline]
  5. Zamorano, J., H. Y. Wang, L.-M. Wang, J. H. Pierce, A. D. Keegan. 1996. IL-4 protects cells from apoptosis via the insulin receptor substrate pathway and a second independent signaling pathway. J. Immunol. 157:4926.[Abstract]
  6. Crawley, J. B., L. Rawlinson, F. V. Lali, T. H. Page, J. Saklatvala, B. M. Foxwell. 1997. T cell proliferation in response to interleukins 2 and 7 requires p38 MAP kinase activation. J. Biol. Chem. 272:15023.[Abstract/Free Full Text]
  7. Foltz, I. N., J. C. Lee, P. R. Young, J. W. Schrader. 1997. Hemopoietic growth fators with the exception of interleukin-4 activate the p38 mitogen-activated protein kinase pathway. J. Biol. Chem. 272:3296.[Abstract/Free Full Text]
  8. Nagata, Y., T. Moriguchi, E. Nishida, K. Tdokoro. 1997. Activation of p38 MAP kinase pathway by erythropoietin and interleukin-3. Blood 90:929.[Abstract/Free Full Text]
  9. Nagata, Y., E. Nishida, K. Todoloro. 1997. Activation of JNK signaling pathway by erythropoietin, thrombopoietin, and interleukin-3. Blood 89:2664.[Abstract/Free Full Text]
  10. Foltz, I. N., J. W. Schrader. 1997. Activation of the stress-activated protein kinases by multiple hematopoietic growth factors with the exception of interleukin-4. Blood 89:3092.[Abstract/Free Full Text]
  11. Hunt, A. E., L. M. Williams, F. V. Lali, B. M. J. Foxwell. 2002. IL-4 regulation of p38 MAPK signaling is dependent on cell type. Cytokine 18:295.[Medline]
  12. Pesu, M., S. Aittomaki, K. Takaluoma, A. Lagerstedt, O. Silvennoinen. 2002. p38 mitogen-activated protein kinase regulates interleukin-4-induced gene expression by stimulating STAT-6-mediated transcription. J. Biol. Chem. 277:38254.[Abstract/Free Full Text]
  13. Bode, J. G., A. Nimmesgern, J. Schmitz, F. Schaper, M. Schmitt, W. Frisch, D. Haussinger, P. C. Heinrich, L. Graeve. 1999. LPS and TNF{alpha} induce SOCS3 mRNA and inhibit IL-6-induced activation of STAT3 in macrophages. FEBS Lett. 463:365.[Medline]
  14. Bode, J. G., S. Ludwig, C. A. Correia Freitas, F. Schaper, M. Ruhl, S. Melmed, P. C. Heinrich, D. Haussinger. 2001. The MKK6/p38 mitogen-activated protein kinase pathway is capable of inducing SOCS3 gene expression and inhibits IL-6-induced transcription. Biol. Chem. 382:1447.[Medline]
  15. Cassatella, M. A., S. Gasperini, C. Bovolenta, F. Calzetti, M. Vollebregt, P. Scapini, M. Marchi, R. Suzuki, A. Suzuki, A. Yoshimura. 1999. Interleukin-10 (IL-10) selectively enhances CIS3/SOCS3 mRNA expression in human neutrophils: evidence for an IL-10-induced pathway that is independent of STAT protein activation. Blood 94:2880.[Abstract/Free Full Text]
  16. Gatto, L., C. Berlato, V. Poli, S. Tininini, I. Kinjyo, A. Yoshimura, M. A. Cassatella, F. Bazzoni. 2004. Analysis of SOCS-3 promoter responses to interferon {gamma}. J. Biol. Chem. 279:13746.[Abstract/Free Full Text]
  17. Jackson, S. H., C.-R. Yu, R. M. Mahdi, S. Ebong, C. E. Egwuagu. 2004. Dendritic cell maturation requires STAT1 and is under the feedback regulation of suppressors of cytokine signaling. J. Immunol. 172:2307.[Abstract/Free Full Text]
  18. Arcaro, A., M. Wymann. 1993. Wortmannin is a potent phosphatidylinositol 3-kinase inhibitor: the role of phosphatidylinositol 3,4,5-triphosphate in neutrophil responses. Biochem. J. 296:297.
  19. Dudley, D. T., L. Pang, S. J. Decker, A. J. Bridges, A. R. Saltiel. 1995. A synthetic inhibitor of the mitogen-activated protein kinase cascade. Proc. Natl. Acad. Sci. USA 92:7686.[Abstract/Free Full Text]
  20. Bennet, B., D. Sasaki, B. Murray, E. O’Leary, S. Sakata, W. Xu, J. Leisten, A. Motiwala, S. Pierce, Y. Satoh, et al 2001. SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase. Proc. Natl. Acad. Sci. USA 98:13681.[Abstract/Free Full Text]
  21. Yu, J. J., C. S. Tripp, J. H. Russel. 2003. Regulation and phenotype of an innate Th1 cell: role of cytokines and the p38 kinase pathway. J. Immunol. 171:6112.[Abstract/Free Full Text]
  22. Danial, N., A. Pernis, P. Rothman. 1995. Jak-STAT signaling induced by the v-Abl oncogene. Science 269:1875.[Abstract/Free Full Text]
  23. Ludwig, S., A. Hoffmeyer, M. Goebeler, K. Kilian, H. Hafner, B. Neufeld, J. Han, U. R. Rapp. 1998. The stress inducer arsenite activates mitogen-activated protein kinases extracellular signal-related kinases 1 and 2 via a MAPK kinase 6/p38-dependent pathway. J. Biol. Chem. 273:1917.[Abstract/Free Full Text]
  24. Schroder, A. J., P. Pavlidis, A. Arimura, D. Capece, P. Rothman. 2002. STAT6 serves as a positive and negative regulator of gene expression in IL-4-stimulated B lymphocytes. J. Immunol. 168:996.[Abstract/Free Full Text]
  25. Rothman, P., B. Kreider, M. Azam, D. Levy, U. Wegenka, A. Eilers, T. Decker, F. Horn, H. Kashleva, J. N. Ihle. 1994. Cytokines and growth factors signal through tyrosine phosphorylation of a family of related transcription factors. Immunity 1:456.
  26. Andrews, N., D. Faller. 1991. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res. 19:2499.[Free Full Text]
  27. Schindler, C., H. Kashleva, A. Pernis, R. Pine, P. Rothman. 1994. STF-IL-4: a novel IL-4-induced signal transducing factor. EMBO J. 13:1350.[Medline]
  28. Shore, P., L. Bisset, J. Lakey, J. P. Waltho, R. Virden, A. D. Sharrocks. 1995. Characterization of the Elk-1 ETS DNA-binding domain. J. Biol. Chem. 270:5805.[Abstract/Free Full Text]
  29. Heinemeyer, T., E. Wingender, I. Reuter, H. Hermjakob, A. Kel, O. Kel, E. Ignatieva, E. Ananko, O. Podkolodnaya, F. Kolpakov, et al 1998. Databases on transcriptional regulation: TRANSFAC, TRRD, and COMPEL. Nucleic Acids Res. 26:364.
  30. Quandt, K., K. Frech, H. Karas, E. Wingender, T. Werner. 1995. MatInd and MatInspector–new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res. 23:4878.[Abstract/Free Full Text]
  31. Egwuagu, C. E., C.-R. Yu, M. Zhang, R. M. Mahdi, S. J. Kim, I. Gery. 2002. Suppressors of cytokine signaling proteins are differentially expressed in Th1 and Th2 cells: implications for Th cell lineage commitment and maintenance. J. Immunol. 168:3181.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 BloodHome page
J. Van den Bossche, P. Bogaert, J. van Hengel, C. J. Guerin, G. Berx, K. Movahedi, R. Van den Bergh, A. Pereira-Fernandes, J. M. C. Geuns, H. Pircher, et al.
Alternatively activated macrophages engage in homotypic and heterotypic interactions through IL-4 and polyamine-induced E-cadherin/catenin complexes
Blood, November 19, 2009; 114(21): 4664 - 4674.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
R. Caruso, C. Stolfi, M. Sarra, A. Rizzo, M. C. Fantini, F. Pallone, T. T. MacDonald, and G. Monteleone
Inhibition of monocyte-derived inflammatory cytokines by IL-25 occurs via p38 Map kinase-dependent induction of Socs-3
Blood, April 9, 2009; 113(15): 3512 - 3519.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
J. W. McAlees and V. M. Sanders
Hematopoietic Protein Tyrosine Phosphatase Mediates {beta}2-Adrenergic Receptor-Induced Regulation of p38 Mitogen-Activated Protein Kinase in B Lymphocytes
Mol. Cell. Biol., February 1, 2009; 29(3): 675 - 686.
[Abstract] [Full Text] [PDF]

Home page
 Sci SignalHome page
N. M. Heller, X. Qi, I. S. Junttila, K. A. Shirey, S. N. Vogel, W. E. Paul, and A. D. Keegan
Type I IL-4Rs Selectively Activate IRS-2 to Induce Target Gene Expression in Macrophages
Sci. Signal., December 23, 2008; 1(51): ra17 - ra17.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
I. Nieto-Vazquez, S. Fernandez-Veledo, C. de Alvaro, and M. Lorenzo
Dual Role of Interleukin-6 in Regulating Insulin Sensitivity in Murine Skeletal Muscle
Diabetes, December 1, 2008; 57(12): 3211 - 3221.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
X. Lu, R. Malumbres, B. Shields, X. Jiang, K. A. Sarosiek, Y. Natkunam, T. Tiganis, and I. S. Lossos
PTP1B is a negative regulator of interleukin 4-induced STAT6 signaling
Blood, November 15, 2008; 112(10): 4098 - 4108.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
H. Qin, S. A. Niyongere, S. J. Lee, B. J. Baker, and E. N. Benveniste
Expression and Functional Significance of SOCS-1 and SOCS-3 in Astrocytes
J. Immunol., September 1, 2008; 181(5): 3167 - 3176.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
F. J. Steyn, G. M. Anderson, and D. R. Grattan
Hormonal Regulation of Suppressors of Cytokine Signaling (SOCS) Messenger Ribonucleic Acid in the Arcuate Nucleus during Late Pregnancy
Endocrinology, June 1, 2008; 149(6): 3206 - 3214.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
H. Qin, K. L. Roberts, S. A. Niyongere, Y. Cong, C. O. Elson, and E. N. Benveniste
Molecular Mechanism of Lipopolysaccharide-Induced SOCS-3 Gene Expression in Macrophages and Microglia
J. Immunol., November 1, 2007; 179(9): 5966 - 5976.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
F. J. Dufort, B. F. Bleiman, M. R. Gumina, D. Blair, D. J. Wagner, M. F. Roberts, Y. Abu-Amer, and T. C. Chiles
Cutting Edge: IL-4-Mediated Protection of Primary B Lymphocytes from Apoptosis via Stat6-Dependent Regulation of Glycolytic Metabolism
J. Immunol., October 15, 2007; 179(8): 4953 - 4957.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
C. Ratthe, M. Pelletier, S. Chiasson, and D. Girard
Molecular mechanisms involved in interleukin-4-induced human neutrophils: expression and regulation of suppressor of cytokine signaling
J. Leukoc. Biol., May 1, 2007; 81(5): 1287 - 1296.
[Abstract] [Full Text] [PDF]

Home page
 Mol Cancer ResHome page
W. Komyod, M. Bohm, D. Metze, P. C. Heinrich, and I. Behrmann
Constitutive Suppressor of Cytokine Signaling 3 Expression Confers a Growth Advantage to a Human Melanoma Cell Line
Mol. Cancer Res., March 1, 2007; 5(3): 271 - 281.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
C. Ehlting, W. S. Lai, F. Schaper, E. D. Brenndorfer, R.-J. Matthes, P. C. Heinrich, S. Ludwig, P. J. Blackshear, M. Gaestel, D. Haussinger, et al.
Regulation of Suppressor of Cytokine Signaling 3 (SOCS3) mRNA Stability by TNF-{alpha} Involves Activation of the MKK6/p38MAPK/MK2 Cascade
J. Immunol., March 1, 2007; 178(5): 2813 - 2826.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
H. Qin, C. A. Wilson, K. L. Roberts, B. J. Baker, X. Zhao, and E. N. Benveniste
IL-10 Inhibits Lipopolysaccharide-Induced CD40 Gene Expression through Induction of Suppressor of Cytokine Signaling-3
J. Immunol., December 1, 2006; 177(11): 7761 - 7771.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
N. Vazquez, T. Greenwell-Wild, S. Rekka, J. M. Orenstein, and S. M. Wahl
Mycobacterium avium-induced SOCS contributes to resistance to IFN-{gamma}-mediated mycobactericidal activity in human macrophages
J. Leukoc. Biol., November 1, 2006; 80(5): 1136 - 1144.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
S. Gentili, M. J. Waters, and I. C. McMillen
Differential regulation of suppressor of cytokine signaling-3 in the liver and adipose tissue of the sheep fetus in late gestation
Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2006; 290(4): R1044 - R1051.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Canfield, S.
Right arrow Articles by Rothman, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Canfield, S.
Right arrow Articles by Rothman, P.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS