The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Howcroft, T. K.
Right arrow Articles by Singer, D. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Howcroft, T. K.
Right arrow Articles by Singer, D. S.
The Journal of Immunology, 2005, 174: 2106-2115.
Copyright © 2005 by The American Association of Immunologists

A T Lymphocyte-Specific Transcription Complex Containing RUNX1 Activates MHC Class I Expression

T. Kevin Howcroft, Jocelyn D. Weissman, Anne Gegonne and Dinah S. Singer1

Experimental Immunology Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
MHC class I expression is subject to both tissue-specific and hormonal regulatory mechanisms. Consequently, levels of expression vary widely among tissues, with the highest levels of class I occurring in the lymphoid compartment, in T cells and B cells. Although the high class I expression in B cells is known to involve the B cell enhanceosome, the molecular basis for high constitutive class I expression in T cells has not been explored. T cell-specific genes, such as TCR genes, are regulated by a T cell enhanceosome consisting of RUNX1, CBF{beta}, LEF1, and Aly. In this report, we demonstrate that MHC class I gene expression is enhanced by the T cell enhanceosome and results from a direct interaction of the RUNX1-containing complex with the class I gene in vivo. T cell enhanceosome activation of class I transcription is synergistic with CIITA-mediated activation and targets response elements distinct from those targeted by CIITA. These findings provide a molecular basis for the high levels of MHC class I in T cells.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Major histocompatibility complex class I gene expression is regulated by developmental, tissue-specific, and hormonal/cytokine-mediated signals. Class I genes are constitutively expressed in all adult tissues, although relative levels of class I expression vary dramatically. The highest levels of expression occur in tissues and cells of the immune system, in particular T and B lymphocytes, whereas the lowest levels are observed in the nervous system and germline cells (1, 2, 3, 4, 5). Within any cell type, the levels of MHC class I expression are actively modulated by extrinsic signals. In general, cytokines induce increased expression, whereas hormones decrease expression (6). For example, IFN-{gamma} increases class I in nearly all tissues, whereas thyroid-stimulating hormone decreases it (6). The mechanisms that integrate these intrinsic and extrinsic regulatory signals are only beginning to be understood.

MHC class I expression is primarily transcriptionally regulated, and many of the DNA sequence elements that mediate both tissue-specific and hormonal/cytokine regulation have been identified (1, 3, 4). Tissue-specific expression is achieved through the combined effects of a promoter distal complex regulatory element and a series of promoter proximal elements. The promoter distal element, located between –700 and –800 bp, consists of overlapping enhancer and silencer elements (7). Silencer activity varies inversely with the level of class I expression in a given cell type. In cell types that express low levels of class I, such as liver or kidney, silencer activity dominates. In cell types that express high levels of class I, such as B lymphocytes, the silencer does not function (7). High class I expression in B lymphocytes is mediated by series of promoter proximal elements, located between –68 and –500 bp. These elements include enhancer A (8, 9, 10, 11, 12, 13), IFN-{gamma}-stimulated response element (14, 15, 16, 17, 18, 19), and a composite RFX/cAMP response element (CRE)2 (16, 20, 21). These same elements are also the targets of hormone/cytokine signals (6). A variety of DNA-binding transcription factors have been identified that interact with these promoter proximal DNA sequence elements. For example, a B lymphocyte-specific enhanceosome consisting of the coactivator CIITA and DNA-bound transcription factors RFX, CREB/ATF, and NF-Y leads to high cell surface class I and II expression in B lymphocytes (22, 23, 24, 25). CIITA, a transcriptional coactivator that induces both MHC class I and class II genes does not bind DNA directly, but rather depends on factors, such as RFX and CREB/ATF, that bind to the CRE element (16, 20, 21). The constitutively high level of expression of MHC class I in B lymphocytes is due, in part, to the presence of a CIITA enhanceosome complex that maintains high transcription rates of class I genes.

T cells, like B cells, express high levels of class I. However, T cells, unlike B cells, do not normally express CIITA. The only cells in which CIITA is constitutively expressed are APC types, such as B lymphocytes, dendritic cells, and macrophages (1, 4, 26, 27, 28, 29, 30). Although activated human T cells can be induced to express CIITA (31, 32, 33), the constitutively high levels of expression in T cells cannot be due to CIITA. Indeed, little is known about how this high class I expression is achieved in T cells. What is known about cell-type-specific expression in T cells is that expression of TCR{alpha} and TCR{beta} genes is regulated by a T cell-specific enhanceosome that consists of the transacting factors RUNX1 (previously known as AML1), CBF{beta}, and LEF1 and the coactivator Aly (34, 35, 36, 37, 38, 39, 40).

RUNX1 is a member of the RUNX family of transcription factors, which are essential for a number of cellular differentiation programs including osteogenesis, hematopoiesis, and gastric and neuronal development (41, 42, 43). RUNX1 expression is limited to hemopoietic tissues and is considered a master regulator of hematopoiesis (44, 45, 46). In addition to the TCR genes, RUNX1 regulates a number of genes involved in cell cycle and hemopoietic development, including the cytokine genes IL-3 (47), MIP-1{alpha} (48, 49), and GM-CSF (CSF2) (50), the macrophage CSF receptor (51, 52), and the tumor suppressor genes p21WAF-1 (53) and p14ARF (54). RUNX1 acts as both a transcriptional activator and repressor: RUNX1 represses CD4 gene expression by binding a silencer element in the CD4 locus (55, 56).

All RUNX family members contain the runt domain, which mediates DNA binding to a TG(T/C)GGT motif and interaction with its non-DNA binding partner CBF{beta} (57). CBF{beta} is ubiquitously expressed and dramatically increases the DNA-binding ability of runt-domain-containing transcription factors (46, 58). Genetic ablation of either RUNX1 or CBF{beta} results in embryonic lethality at E12.5 due to a complete lack of fetal liver hematopoiesis (41, 45, 46, 57).

The RUNX factors alone are relatively weak transcriptional regulators that interact with both coactivators and corepressor proteins. RUNX1 activation is increased by association with coactivators such as Aly, MOZ, and p300/CREB-binding protein (CBP); repression is mediated by recruitment of Groucho/transducin-like enhancer of split 1 and mSin3A corepressors (39, 40, 43, 48, 53, 59, 60). Whether activation or differentiation signals modify RUNX factors to specifically recruit certain cofactors and influence gene transcription patterns is not clear. In the T cell enhanceosome, RUNX1/CBF{beta} interact with the non-DNA binding coactivator Aly and LEF1 (36, 37, 38, 39, 40). LEF1 is a DNA binding protein expressed in T and early B lymphocytes that binds to the TTCAAAGG motif in the TCR{alpha} enhancer; LEF1 facilitates the assembly of the DNA-bound enhanceosome by inducing DNA bending through its high mobility group (HMG) domain (61, 62). In addition, the LEF1 activation domain contributes to enhanceosome-mediated enhancement of downstream TCR{alpha} promoter activity (37, 40, 62). Aly stabilizes the interactions of LEF1 and RUNX1/CBF{beta} with their respective DNA binding sites (40, 63). Whereas expression of LEF1 is restricted to T lymphocytes, Aly is ubiquitously expressed (40).

The existence of a T cell enhanceosome suggested the possibility that, like the B cell enhanceosome in B lymphocytes, it would be able to increase MHC class I transcription in T lymphocytes. In this report, we demonstrate that the T cell enhanceosome, consisting of RUNX1/CBF{beta}/LEF1/Aly, activates class I transcription both in T lymphocytes and when reconstituted in HeLa epithelial cells. Importantly, the T cell enhanceosome is associated with the class I promoter in vivo, suggesting that this activation directly affects the class I promoter. Furthermore, CIITA augmented the activation of the promoter by the T cell enhanceosome.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell lines and cultivation

HeLa epithelial cells were grown in DMEM supplemented with 10% FBS, 2 mM L-glutamine, 20 mM HEPES (pH 7.2), and gentamicin sulfate (10 µg/ml). The Jurkat (T cell) line was maintained in RPMI 1640 supplemented with 10% FBS, 2 mM L-glutamine, 55 µM 2-ME, 100 µM minimal essential amino acids, 1 mM sodium pyruvate, 20 mM HEPES (pH 7.2), and gentamicin sulfate (10 µg/ml). Cell lines were maintained in a humidified incubator at 37°C.

Plasmids and cloning strategies

The MHC class I promoter construct used in these studies derived from the swine class I gene PD1 (64, 65). The PD1 promoter truncation series, ligated to the cat gene (chloramphenicol acetyl transferase (CAT)) reporter, was previously described (66). The –209CAT and –209{Delta}CRE reporter constructs and CIITA expression vector were described previously (21). –416LUC was generated by ligating class I promoter sequences, extending from the 5' XbaI site to the HindIII site at position +14 of –416WT (21), into the NheI/HindIII sites of the pGL2B luciferase expression vector (Promega). M10 and M12 mutants were generated by replacing wild-type core promoter sequences between unique NarI (–52) and HindIII (+14) restriction sites with double-stranded oligonucleotides containing the indicated nucleotide mismatches (indicated by italics) in the RUNX1 binding region: wild type, –43TGCGGTTCCC–34; M10, –43TGCGGTCGTA–34; M12, –43GCTAGTTCCC–34. The CBF{beta}, wild-type and mutant RUNX1 (53, 67), LEF1, wild-type Aly and mutant Alys (40), and mutant CBF{beta}-MYH11 expression constructs (68) were previously described.

Transfections

Transient transfections were performed using a constant amount of DNA. Twenty-four hours before transfection, 1 x 106 HeLa were seeded in 100-mm tissue culture dishes. Transfections used standard calcium phosphate precipitation as previously described (69). The medium was replaced 24 h after transfection with fresh medium, and cells were harvested after an additional 24 h. Reporter activity was corrected by cotransfecting an internal control plasmid control, either pSV2LUC (200 ng) or CMV-{beta}-galactosidase (100 ng). Jurkat cells were transfected by electroporation (250 V; 975 {upsilon}F) using a BioRad Gene Pulser II electroporator. All CAT enzyme assays were measured in the linear range; control [14C]chloramphenicol values ranged between 20 and 80% among the different experiments. Luciferase determinations were made using a Monolight 2010 luminometer (Analytical Luminescence Laboratory).

Chromatin immunoprecipitation assay

Chromatin immunoprecipitation was performed on tissues from the B10.PD1 transgenic mouse (65) following the method of Oberley and Farnham (70). Precleared chromatin aliquots (average length 350–450 bp; ~125 µg) were kept for "total" or were immunoprecipitated with 1 µg of specific Ab: antiPol II (Santa Cruz Biotechnology; no. sc899), anti-Acetylated H3 (Upstate Biotechnology; no. 06-599), anti-Acetylated H4 (Upstate Biotechnology; no. 06-598), anti-AML1 (Oncogene Research Products; no. PC284L), or rabbit IgG control (Jackson ImmunoResearch Laboratories; no. 011000003). For the final purification step after Proteinase K digestion, proteins and contaminants were removed by extraction and precipitation. Pellets were resuspended in 10 mM Tris-Cl (pH7.5), 30 µl per sample. Real-time PCR was performed using the Applied Biosystems Sybr-Green Kit (no. 4309155) on the Applied Biosystems 7900 machine. "Total" samples were diluted 1/100 and 1 µl was used. Immunoprecipitated samples were diluted 1/4 and 1 µl was used. PCR cycles: stage 1, 95°C for 15 min; stage 2, 95°C for 15 min, hybridization C 15, 72°C for 15 min, 40 times; stage 3, 95°C for 15 min, hybridization C 15, ramp 0.2 to 95°C. PCR primers: proximal promoter, hybridization temp 60°C, 5', AGGCGTGGCTCTCAGGGTCTCAG, 3', TTCCCGATCCCGCACTCACCCGCCTTGGT; control distal promoter, hybridization temp 50°C, 5', CAATGTATTCGGTCTTAAAACTCTTAC, 3', CTGTCTGGCTCATGGGAAAACCACT. Threshold values were corrected for rabbit IgG background and relative protein occupancy was determined relative to "total."

RNA isolation and cytodot analysis

Total cellular RNA from transfected HeLa cells was isolated using RNAzol B (Tel-Test). RNA (20 µg) was blotted onto nytran nitrocellulose (Schleicher and Schuell) using a 96-well Minifold dot-blot arrray (Schleicher and Schuell), UV-cross-linked, and hybridized with MHC class I and control tubulin probes. The MHC class I probe was the 1.0-kb fragment of the pH 7 clone previously described (69), and the tubulin probe was obtained from Clontech Laboratories. Blots were hybridized at 42°C for 18 h; final washes were conducted at 65°C, 0.5x SSC, for the MHC class I probe or 42°C, 6x SSC for the tubulin probe. Hybridizations were analyzed using a Storm with ImageQuant software PhosphorImager (Molecular Dynamics) (Amersham Biosciences).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
To examine the possibility that the T cell enhanceosome regulates MHC class I expression, we first investigated whether any of the T cell enhanceosome components individually affected the level of class I promoter activity. Each of the components—RUNX1, its binding partner CBF{beta}, and LEF1—was introduced by transient transfection, along with an MHC class I promoter construct consisting of 416 bp of 5' regulatory sequences (–416WT) directing the expression of the CAT reporter into HeLa epithelial cells, which lack endogenous LEF1 and RUNX1. Although HeLa cells express basal levels of CBF{beta}, we also introduced an exogenous CBF{beta} expression vector to ensure that sufficient CBF{beta} protein was available to heterodimerize with RUNX1. Of the three individual components, only LEF1 showed a modest activation of MHC class I promoter (Fig. 1A). Similarly, any two pairs of the three components displayed only small activation of class I promoter activity (Fig. 1B). LEF1 and RUNX1 together displayed the largest effect, resulting in a 3-fold increase in promoter activity over either alone. A consistent 5-fold increase in promoter activity was observed when all three factors (RUNX1, CBF{beta}, and LEF1) were added (Fig. 1B).



View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 1. T cell-specific enhanceosome transacting factors activate MHC class I expression. A, HeLa epithelial cells were transiently transfected with an MHC class I promoter construct containing class I promoter sequences from –416 to +14 ligated to the CAT reporter gene (5 µg) designated –416WT and control, CBF{beta} (0.3 µg), LEF1 (0.3 µg), or RUNX1 (1 µg) expression constructs. B, HeLa epithelial cells were transiently transfected with –416WT (5 µg) and various combinations of control, CBF{beta} (0.3 µg), LEF1 (0.3 µg), or RUNX1 (1 µg) expression constructs in the presence (filled bars) or absence (stippled bars) of Aly (1 µg). C, HeLa epithelial cells were transiently transfected with –416WT (5 µg), LEF1 (0.3 µg), RUNX1 (1 µg), and either control Aly or mutant Alys expression constructs. For each transfection, a constant amount of DNA was transfected; totals were adjusted using backbone control vectors. Data are expressed as relative percentages of acetylation corrected to an internal transfection control, pSV2LUC. In this figure and all others, error bars indicate SE; where the SE is very small, the error bars may not be clearly visible.

 
In T lymphocytes, the RUNX1/CBF{beta} heterodimer and LEF1 interact with and recruit the coactivator Aly to form an enhancesome that activates T lymphocyte-specific genes, including the TCR{alpha}{beta} genes (36, 37, 38, 40). Aly alone increased MHC class I only modestly in the absence of either RUNX1 or LEF1 (Fig. 1B). However, an Aly-dependent increase was observed in the presence of any two pairs of DNA-binding factors (Fig. 1B). The Aly-dependent increase in class I promoter activity was greatest in the presence of LEF1 and RUNX1, whether CBF{beta} was present or not (Fig. 1B). These data suggest that Aly, through the formation of a T cell enhanceosome, synergizes with LEF1, RUNX1, and CBF{beta} transcription factors to activate the class I promoter. A mutant Aly (Alys), which has previously been shown not to activate the TCR{alpha} enhancer (40), does not activate the class I promoter in the presence of RUNX1 and LEF1 (Fig. 1C). Consistent with the constitutive expression of low levels of Aly in HeLa cells, class I promoter activity is somewhat reduced in the presence of Alys, which functions as a dominant negative.

To further examine the role of the T cell enhanceosome in class I promoter activity, we determined the effect of a mutant CBF{beta} protein (CBF{beta}-MYH11), which is known to disrupt RUNX1 activation (68), on RUNX1/LEF1-mediated activation of class I promoter activity. The class I promoter construct, –416WT, was cotransfected into HeLa cells with a constant amount of RUNX1/LEF1/CBF{beta} expression vectors and increasing amounts of either mutant CBF{beta}-MYH11 or control vectors. Increasing amounts of the mutant CBF{beta}-MYH11 increasingly inhibited class I promoter activity, demonstrating that it functions as a dominant negative of the RUNX1-mediated activation (Fig. 2A). These results are consistent with the interpretation that introduction into HeLa cells of exogenous RUNX1/LEF1/CBF{beta} leads to formation of a T cell enhanceosome that activates the class I promoter.



View larger version (25K):
[in this window]
[in a new window]
  		FIGURE 2. Mutant CBF{beta}-MYH11 abrogates T cell enhanceosome regulation of MHC class I expression. A, HeLa epithelial cells were transiently transfected with –416WT (5 µg) and either control (stippled bars) or CBF{beta} (0.3 µg), LEF1 (0.3 µg), and RUNX1 (1 µg) expression constructs (filled bars), along with increasing amounts of CBF{beta}-MYH11. B, Jurkat T lymphocytes were transiently transfected with –416WT (5 µg) and either control or CBF{beta}-MYH11 (1 µg). For each transfection, a constant amount of DNA was transfected; totals were adjusted using a backbone control vector. Data are expressed as relative percentages of acetylation corrected to an internal transfection control, pSV2LUC. Error bars indicate SE.

 
Taken together, these results demonstrate that the T lymphocyte-specific transcription factors, RUNX1 and LEF1, CBF{beta}, and the coactivator Aly, which form the T cell enhanceosome, activate the class I promoter, and the results also suggest that they contribute to the high levels of class I expression in T lymphocytes.

To extend this conclusion, we next determined whether the endogenous T cell enhanceosome in Jurkat T cells similarly activated the class I promoter. If the endogenous T cell enhanceosome activates class I expression, then cotransfection of the class I promoter with the mutant CBF{beta}-MYH11 into Jurkat T cells would repress class I promoter activity. Indeed, the presence of the mutant CBF{beta}-MYH11 sharply decreased the activity of the –416WT class I promoter construct in Jurkat T cells to half of its endogenous level (Fig. 2B). These data support the conclusion that the T cell enhanceosome plays an active role in establishing high levels of MHC class I expression in T lymphocytes.

These findings demonstrate that the T cell enhanceosome activates MHC class I expression, but they do not establish whether the effect is due to direct binding of the enhanceosome to the class I promoter or if it is due to an indirect effect. To determine whether the enhanceosome binds directly to the class I promoter, we performed chromatin immunoprecipitation assays on tissues from transgenic mice that contain a stably integrated MHC class I gene, PD1, transgene. Tissues that express low (brain), intermediate (kidney), and high (spleen) levels of MHC class I expression were included in the analysis (Fig. 3). The associations of RUNX1, RNA polymerase II (pol II), and acetylated histones H3 and H4 with both distal and proximal promoter sequences in each of the tissues were examined. As shown in Fig. 3, RNA pol II and the acetylated histones were detected bound to the proximal promoter region in spleen and kidney. Only acetylated H3 histone was clearly associated with the proximal promoter in the brain. The extent of binding correlates with the known levels of class I expression in each tissue: the greatest association with the class I promoter is in the spleen, which has the highest levels of class I expression, and the least association is with the brain, which expresses the lowest levels of class I. RUNX transcription factors were detected associated with proximal MHC class I promoter sequences in the spleen and kidney, but were not observed interacting with distal sequences. The extent of RUNX1 binding to the proximal promoter in spleen and kidney correlated with the extent of RNA pol II binding. (In contrast with RUNX1 binding, Oct-1 binding was detected on the distal, not the proximal, promoter (J. Weissman and D. Singer, unpublished observations).) The detection of RUNX binding to the proximal promoter in the kidney may reflect the presence of contaminating T cells from blood. Alternatively, because the anti-RUNX Ab used in these experiments does not discriminate between members of the RUNX family, it may have bound to a cross-reactive RUNX family member present in the kidney. Importantly, the present results indicate that 1) RUNX1 interacts with the MHC class I promoter in vivo and 2) the interaction maps to the promoter proximal sequences. These findings are consistent with the conclusion that the T cell enhanceosome directly activates the class I promoter in vivo.



View larger version (34K):
[in this window]
[in a new window]
  		FIGURE 3. Chromatin immunoprecipitation of the RUNX factors with the MHC class I promoter. Abs directed against acetylated histone H3 (AcH3), acetylated H4 (AcH4), RNA pol II (Pol II), and RUNX1 were used in chromatin immunoprecipitation assays. MHC class I proximal and distal (control) promoter regions were amplified from brain, kidney, and spleen. Threshold values were corrected for rabbit IgG background and relative protein occupancy was determined relative to "total" (see Materials and Methods).

 
To define the region of MHC class I proximal promoter responsive to a T lymphocyte-specific enhancer complex, we assessed the effect of T cell enhanceosome components on a series of 5' truncation reporter constructs of the PD1 MHC class I promoter in transiently transfected HeLa epithelial cells (Fig. 4A). The combination of only CBF{beta} and LEF1 did not significantly affect promoter activity of any of the constructs, consistent with the findings described above for the construct extending 416 bp upstream (see Fig. 1). Therefore, all transfection responses were normalized to the level of activity generated by the various promoter constructs in the presence of CBF{beta}+LEF1. The addition of RUNX1 (in the presence of CBF{beta}+LEF1) activates the –313CAT, –177CAT, and –127CAT truncation constructs to approximately the same level, namely 3- to 5-fold above the level of the control (Fig. 4A). In contrast, further truncation to –68CAT markedly reduces the ability of RUNX1 to activate the promoter. This maps a RUNX1-responsive region between –127 and –68 bp upstream of transcription initiation.



View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 4. Full activation of MHC class I promoter activity by the T cell enhanceosome requires an extended upstream region. A, HeLa epithelial cells were transiently transfected with 5 µg of different 5' truncation deletions of the MHC class I extended promoter (left) and CBF{beta} (0.3 µg), LEF1 (0.3 µg), and RUNX1 (1 µg) expression constructs. The filled bars represent class I reporter constructs with CBF{beta} and LEF1 alone and are normalized to 1. The light and dark hatched bars represent class I reporter constructs with CBF{beta}, LEF1, and RUNX1 in the absence or presence of Aly, respectively. B, Jurkat T cells were transiently transfected with 5 µg of either a wild-type class I promoter construct containing 416 bp of upstream sequences ligated to the luciferase reporter (–416LUC) or one of two constructs with targeted mutations within the consensus RUNX1 binding site, –38 to –43 bp (–416M12LUC, –416M10LUC) in the presence of CBF{beta} (0.3 µg) alone or in combination with RUNX1 (1 ug). C, The CRE element is not necessary for RUNX1-mediated transcriptional activation of the MHC class promoter. HeLa epithelial cells were transiently transfected with an MHC/class I reporter construct consisting of a 209-bp upstream class I promoter sequence ligated to the CAT reporter gene. Five micrograms of either wild-type (–209CAT) or mutated CRE (–209{Delta}CRE) constructs (left) were cotransfected with control (0.3 µg of LEF1; stippled bar) or 0.3 µg of LEF1 with RUNX1 (1 µg) in the absence (hatched bar) or presence (filled bar) of Aly (1 µg). For each transfection, a constant amount of DNA was transfected; totals were adjusted using a backbone control vector. Data are expressed as relative percentages of acetylation corrected to internal transfection controls, either CMV-{beta}-galactosidase or pSV2LUC. Error bars indicate SE. Fold activation, relative to control LEF1, is indicated above each bar. Because deletion of the CRE element reduces basal promoter activity by 0.32 (81.6 vs 25.7%), fold activation by RUNX1 and Aly is calculated relative to the promoter construct. Enhancer A, Binding site for NF6 B and other transcription factors; ISRE, IFN-stimulated response element for {alpha},{beta}-IFN; p, core promoter.

 
In the presence of both Aly and RUNX1, promoter constructs with 5' upstream sequences between –313 and –127 bp are activated ~10- to 15-fold (Fig. 4A). Further truncation to 68 bp of upstream sequence dramatically ablates this activation (Fig. 4A). Thus, the promoter region necessary for an Aly response maps to the same promoter segment as the RUNX1-responsive region, namely between –68 and –127 bp upstream, and defines these sequences as necessary for T cell enhanceosome activation.

Within the proximal class I promoter, there is a single consensus RUNX1 binding site, TGCGGT, at –38 to –43 bp, raising the possibility that it contributes to enhanceosome activation. We examined whether this site is critical for RUNX1-mediated activation by generating two mutations of this site within the context of the extended class I promoter and testing their ability to respond to RUNX1 in transient transfection assays in Jurkat T cells. As shown in Fig. 4B, both of the binding site mutations reduced promoter basal activity, but neither mutation completely abrogated the ability of RUNX1 to activate the promoter. Furthermore, purified recombinant RUNX1 protein did not bind the RUNX1 DNA consensus site in the proximal promoter or to any promoter DNA fragments further upstream, as assessed by gel mobility shift assays (T. K. Howcroft and D. S. Singer, unpublished observations). Therefore, the consensus RUNX1 binding sequence in the promoter proximal region is not essential for enhanceosome activation.

The minimal TCR{alpha} enhancer consists of a CRE element upstream of LEF1 and RUNX1 binding sites (37, 40). As noted above, the DNA segment between –68 bp and –127 bp does not contain the RUNX1 consensus binding site. Furthermore, there is no consensus LEF1 binding site within this segment, nor has LEF1 been shown to bind in gel shift assays (data not shown). Indeed, the only well-characterized regulatory element in this DNA segment is a CRE that serves to mediate both tissue-specific and dynamic transcriptional signaling of class I gene expression (6, 71). The CRE, located between –100 and –107 bp, is known to interact with members of the ATF/CREB family and has been shown to both positively and negatively regulate MHC class I transcription (6, 16, 71, 72, 73, 74, 75, 76). Activation by CIITA, the IFN-{gamma} mediator and B cell coactivator, depends on the CRE element: deletion of the CRE eliminates activation of the class I promoter by IFN-{gamma} (16, 20, 21). Therefore, we considered the possibility that the class I CRE element participated in T cell, as well as B cell, enhanceosome function. To address this possibility, the ability of a CRE deletion construct to respond to T cell enhanceosome activation was examined. The CRE element (–100 to –107) was deleted from a construct with 209 bp of upstream sequence; the parental –209 construct (–209CAT), like the –127 truncation, is activated by the T cell enhanceosome (Fig. 4C). Deletion of the CRE (–209{Delta}CRE) does not affect promoter activity in response to RUNX1 alone. Furthermore, deletion of the CRE (–209{Delta}CRE) does not eliminate promoter activation by the combination of RUNX1 and Aly, indicating that the CRE element is not essential for enhanceosome function. Indeed, deletion of the CRE modestly increases the response, suggesting that the CRE element functions as a silencer of T cell enhanceosome-mediated activation (Fig. 4C). Although it has not been possible to identify a single element within the DNA segment between –68 bp and –127 bp that is either required for promoter activity or that binds RUNX1/CBF{beta} or LEF1 in gel shift assays (data not shown), these data indicate that the T cell enhanceosome, unlike the B cell enhanceosome, does not depend on the CRE to activate the class I promoter. Rather, the T cell enhanceosome targets a response element distinct from that used by IFN-{gamma}/CIITA, providing a mechanism for T cells to further increase class I expression when CIITA is induced, either by IFN-{gamma} or in activated human T cells.

The above studies demonstrated the association of RUNX1 with the class I promoter in vivo and mapped the targeted DNA segment of the class I promoter. However, they did not demonstrate the necessity of DNA binding by RUNX1 for promoter activity. To determine whether the RUNX1 DNA binding domain is required for activity, we examined the ability of various RUNX1 mutants to activate the MHC class I promoter (Fig. 5). Regulation of RUNX1 activities is complex and several overlapping regulatory domains have been described. DNA binding and association of RUNX1 with CBF{beta} are mediated by the runt domain; the L148D runt domain mutant can bind CBF{beta} but cannot bind DNA (53). Two corepressors known to associate with RUNX1 bind to C-terminal regions: the transducin-like enhancer of split proteins, which are mammalian homologues of the Groucho family of corepressors, bind the C-terminal 5 residues (VWRPY) of RUNX1, whereas the corepressor mSin3A interacts with residues 208–237 (39, 43, 53). A broad nuclear matrix targeting sequence and a transactivation domain also map to the C-terminal region and partially overlap the repression domains (77, 78, 79). As shown in Fig. 5, the DNA binding domain mutant (L148D) was unable to support activated transcription, providing evidence that RUNX1 DNA binding is critical to enhancing class I promoter activity. In addition, RUNX1 mutants with either internal deletions or truncations in the C-terminal domain between 208 and 480 aa demonstrated reduced ability to activate the class I promoter, indicating that the activation domain also is required for optimal activation.



View larger version (27K):
[in this window]
[in a new window]
  		FIGURE 5. An intact RUNX1 protein is necessary for maximal activation of class I transcription. HeLa epithelial cells were transiently transfected with –416WT (5 µg), CBF{beta} (0.3 µg), LEF1 (0.3 µg), and wild-type or mutant RUNX1 (1 µg) expression constructs. For each transfection, a constant amount of DNA was transfected; totals were adjusted using a backbone control vector. Data are expressed as relative percentages of acetylation corrected to an internal transfection control, pSV2LUC. Error bars indicate SE. The hatched rectangle indicates the DNA-binding runt domain. The mutant RUNX1 protein, L148D, does not bind DNA.

 
The finding that T cell and B cell enhanceosomes target distinct regulatory elements within the class I promoter raised the question of whether these effectors would act independently or synergize with each other. To address this issue, the class I promoter construct was cotransfected into HeLa cells with various combinations of LEF1 and RUNX1 in the presence or absence of CIITA (Fig. 6, left panel). Under these conditions, LEF1 and RUNX1 together activated the class I promoter 7.3-fold. CIITA alone enhances class I promoter activity 6.6-fold, as we and others have demonstrated previously (16, 20, 21). However, in the presence of both LEF1 and RUNX1, CIITA dramatically increased promoter activity to 40.2-fold, suggesting that CIITA and the T cell enhanceosome act synergistically. This effect is in sharp contrast with the effect observed on the MHC class II DR{alpha} promoter. Unlike the class I promoter, the DR{alpha} promoter was transcriptionally silent in the absence of CIITA. CIITA induces the DR{alpha} promoter (Fig. 6, right panel). Importantly, the magnitude of CIITA activation of the DR{alpha} promoter was not increased by the presence of the T cell enhanceosome (Fig. 6, right panel). Thus, the synergy observed with the class I promoter is not universal.



View larger version (17K):
[in this window]
[in a new window]
  		FIGURE 6. RUNX1 synergizes with CIITA to activate MHC class I promoter activity. Left, HeLa epithelial cells were cotransfected with 5 µg of –416WT along with control, LEF1 (0.3 µg), RUNX1 (1 µg), both LEF1 and RUNX1, and either control (stippled bar) or CIITA (filled bar) expression constructs. Right, HeLa epithelial cells were cotransfected with 5 µg of DR{alpha}CAT along with control, LEF1 (0.3 µg), RUNX1 (1 µg), both LEF1 and RUNX1, and either control (stippled bar) or CIITA (filled bar) expression constructs. For each transfection, a constant amount of DNA was transfected; totals were adjusted using a backbone control vector. Data are expressed as relative percentages of acetylation corrected to an internal transfection control, pSV2LUC. Error bars indicate SE. Fold activation, relative to the control, is indicated above each bar. (In this experiment, exogenous Aly and CBF{beta} were not included, to allow the CIITA activation in the presence of LEF1 and RUNX1 to be maintained within the linear range.) These experiments were repeated twice in triplicate.

 
The above studies all suggest that the T cell enhanceosome activates the class I promoter. Because these conclusions were based on the use of reporter assays, it was important to verify that RUNX1, CBF{beta}, and LEF1 could lead to increased transcription of endogenous class I genes. Therefore, we assessed the levels of endogenous class I mRNA in HeLa cells transiently transfected with RUNX1/CBF{beta}/LEF1 in the absence and presence of Aly (Fig. 7). In the presence of RUNX1, CBF{beta}, and LEF1, endogenous class I RNA levels were increased 1.4-fold. Full reconstitution of the T cell enhanceosome with CBF{beta}, RUNX1, LEF1, and Aly further increased class I RNA levels to 2.4-fold. In control CIITA-transfected HeLa cells, endogenous class I message was increased 3.8-fold over mock-transfected control. Taken together, the above data suggest that RUNX1, CBF{beta}, and LEF1 cooperate with Aly to increase class I expression in T lymphocytes in vivo.



View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 7. The T cell enhanceosome increases steady-state MHC class I RNA levels in HeLa epithelial cells. HeLa epithelial cells were transiently transfected with either control or LEF1 (0.3 µg), CBF{beta} (0.3 µg), and RUNX1 (1 µg) in the absence (–Aly) or presence (+Aly) of 1 µg of Aly expression constructs. As a positive control, epithelial cells were also transfected with 2 µg of CIITA. Levels of MHC class I message, detected by Northern analysis of total RNA harvested 48 h after transfection, are expressed relative to control, which is set at 1. Fold change, relative to control, is expressed above each bar. All Northern analyses were normalized to endogenous tubulin. Similar results were obtained with Jurkat T cells.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Enhanceosomes are complexes of interacting transcription factors and DNA sequence elements, assembled to integrate various transcriptional signals at the promoter (80, 81). Enhanceosome assembly generally has been associated with the integration of extracellular signaling, because it allows combinatorial association of various proteins and sequence elements. One of the best-characterized enhanceosomes is that governing TCR gene expression (34, 35, 36, 37, 38, 39, 40). T cell maturation is accompanied by the activation of TCR genes through an enhanceosome consisting of the component proteins RUNX1, CBF{beta}, LEF1, and Aly. In the present study, we report that the TCR enhanceosome also regulates MHC class I gene expression, providing a molecular basis for the constitutively high levels of MHC class I expression in T lymphocytes.

Like the TCR genes, full activation of the MHC class I promoter requires all four enhanceosome proteins. Both RUNX1 and LEF1 are DNA binding proteins, whose consensus binding sites have been determined (67, 82, 83). RUNX1 binding to DNA is through its central runt domain, and activation of the class I promoter depends on both its DNA binding and activation domains. LEF1 is an HMG protein whose binding to DNA causes bending of the backbone (34, 62, 84, 85). Neither RUNX1 nor LEF1 alone significantly affected MHC class I expression in the nonlymphocyte HeLa epithelial cell line, which does not express either of these factors (data not shown). However, the combination of RUNX1 and LEF1 (along with excess CBF{beta} to ensure RUNX1 binding) resulted in an ~5-fold activation of class I expression. Both RUNX1 and LEF1 have been reported to bind to the coactivator Aly (40). Addition of Aly further augmented class I promoter activity in the presence of cotransfected RUNX1 and LEF1. Overexpression of a mutant Aly (Alys) not only failed to augment but actually repressed RUNX1 and LEF1-activated class I promoter activity in HeLa cells. Furthermore, abrogating RUNX1-dependent transcriptional activity by overexpressing the mutant CBF{beta}-MYH11 inhibited RUNX1 and LEF1-activated class I promoter activity in HeLa cells. Importantly, CBF{beta}-MYH11 reduced class I transcription in Jurkat T cells by interfering with endogenous RUNX1 transcription complexes. Taken together, these data indicate that high levels of MHC class I expression in T lymphocytes are due to a T lymphocyte-specific enhanceosome complex minimally composed of RUNX1, LEF1, CBF{beta}, and Aly.

Despite the similarities between MHC class I and TCR gene regulation by the TCR enhanceosome, there are surprising differences. In the TCR{alpha} gene, the organization of the enhancer that nucleates the enhanceosome consists of three DNA sequence elements, CRE, LEF1, and RUNX1 binding sites (34, 35, 36, 37, 38, 39, 40). All three elements are critical for TCR enhanceosome assembly and function. It is not clear how these elements participate in the activation of the class I promoter through the TCR enhanceosome. Although a LEF1 binding site is found within the extended MHC class I promoter (T. K. Howcroft and D. S. Singer, unpublished observations), it is not within the target region, –68 to –127 bp, of the promoter that is responsive to the TCR enhanceosome. A consensus RUNX1 sequence occurs within the core promoter region (–1 to –68 bp), but mutating it does not abrogate enhanceosome activation. Finally, the CRE element does not contribute to the enhanceosome activation of the MHC class I gene, although it is contained within the target region. Nevertheless, the RUNX1-containing complex is bound to the class I promoter in vivo. Thus, the nucleation of the enhanceosome must depend on novel sequence elements in the class I promoter.

High MHC class I expression in B lymphocytes has been shown to be due, at least in part, to the expression of the coactivator CIITA (16, 20, 21). Although constitutive CIITA expression is restricted to B lymphocytes and professional APCs, CIITA is also induced by the inflammatory cytokine IFN-{gamma} in most other cell types, including T cells (16, 20, 26, 86). CIITA expression is also induced in activated human T cells (31, 32, 33). CIITA interacts with the constitutively expressed DNA-binding transcription factors RFX5, NF-Y, and CREB to assemble a B lymphocyte-specific enhanceosome that regulates MHC class II gene expression (22, 23, 24, 25, 26, 86). Spilianakis et al. (23) have recently described the temporal recruitment of transcription factors, cofactors, and basal transcriptional components leading to the expression of the MHC class II DR{alpha} gene by IFN-{gamma}. CIITA is also a potent activator of MHC class I genes, where it is also thought to assemble a B cell enhanceosome. However, CIITA, which has intrinsic acetyl transferase activity, has been shown to bypass the requirement for the acetyl transferase activity of the TFIID constituent TAF1 to activate MHC class I expression (21). This raises the possibility that CIITA can assemble an alternative complex on the class I core promoter.

The regulatory DNA sequence elements and pathways targeted by CIITA and the TCR enhanceosome are largely distinct. CIITA activation of the class I promoter is dependent on the CRE element located at –100 bp to –107 bp within the TCR enhanceosome responsive region (16, 20, 21). Mutation of the CRE element, which eliminates CIITA-mediated activation (21), reduced but did not inhibit RUNX1 transactivation. Furthermore, the TCR enhanceosome recruits a CBP/pol II complex to effect an increased rate of transcription from the TCR{alpha} promoter (59, 60). In contrast, CIITA activation of the class I promoter is independent of the presence of CBP (21). These distinct regulatory pathways enable CIITA to synergize with the TCR enhanceosome in increasing MHC class I transcription, providing a molecular mechanism for CIITA-mediated activation of class I expression in T cells and for modulation of class I in T cells in response to infection.

The regulation of MHC class I expression by RUNX1 raises the interesting possibility that aberrant class I expression may contribute to the pathophysiology of RUNX1-related diseases. Aberrations in RUNX1 expression and function have been linked to leukemias, which result as a consequence of somatic chromosomal translocations involving transcription factor genes (43). A number of translocation breakpoint products have been identified that block the normal function of the RUNX1/CBF{beta} enhanceosome (27, 68, 87, 88). The (8;21) translocation, found in ~10–12% of acute myeloid leukemias, gives rise to AML1/ETO (new nomenclature: RUNX1-CBF2T1), consisting of the runt domain of RUNX1 in frame with almost the entire ETO gene (77, 89). AML1/ETO knock-in mice, similar to RUNX1–/– and CBF{beta}–/– null transgenic mice, fail to develop any hemopoietic lineages and die in utero (90, 91). AML1/ETO is thought to act as a dominant transcriptional repressor that deregulates the expression of RUNX1-responsive cytokine and/or tumor suppressor genes, severely impairing the normal differentiation process. Similarly, a mutated binding partner of RUNX1 identified in leukemias associated with Inv(16)(p13q22), CBF{beta}-MYH11, acts as a dominant negative inhibitor, although the mechanism of action is not clear (68, 87). As we have shown, CBF{beta}-MYH11 inhibits MHC class I promoter activity in Jurkat T cells (which do not express CIITA constitutively). Furthermore, AML-ETO is a potent repressor of MHC class I transcription (T.K. Howcroft and D.S. Singer, unpublished observations). Thus, it is likely that the AML1/ETO fusion protein, in addition to its effects on tumor suppressor genes, represses class I expression, thereby rendering the tumor cells invisible to immune surveillance.

Aberrant RUNX1 expression recently has also been correlated with the autoimmune diseases systemic lupus erythematosus, rheumatoid arthritis, and psoriasis (92, 93). A genome-wide analysis identified single nucleotide polymorphisms associated with each of these diseases which, when analyzed, mapped either to a RUNX1 binding site or to a variation in the RUNX1 gene expression. Based on these findings, it has been proposed that the RUNX family plays a critical role in the development of autoimmunity. Interestingly, previous studies from our laboratory have demonstrated that susceptibility to experimental systemic lupus erythematosus is dependent upon MHC class I expression: mice deficient in MHC class I expression are resistant to disease (6, 94, 95). Taken together with the present finding that RUNX1 (in the context of the enhanceosome) is a potent activator of MHC class I, these observations raise the possibility that the RUNX1 variants associated with autoimmune disease may display increased activity, leading to inappropriately high levels of MHC class I expression, which may contribute to the development of autoimmunity.


   Acknowledgments
 
We thank Drs. Susan McCarthy, Alfred Singer, and Helen Sabzevari for helpful discussions and critical review of the manuscript. We also acknowledge the generosity of Drs. Scott W. Hiebert, Rudolf Grosschedl, Pu Paul Liu, and Jenny Ting for providing expression plasmids.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Address correspondence and reprint requests to Dr. Dinah S. Singer, Experimental Immunology Branch, National Cancer Institute, Building 10, Room 4B-36, National Institutes of Health, 10 Center Drive, MSC 1360, Bethesda, MD 20892. E-mail address: dinah.singer{at}nih.gov Back

2 Abbreviations used in this paper: CRE, cAMP response element; CBP, CREB-binding protein; CAT, chloramphenicol acetyl transferase; RNA pol II, RNA polymerase II; HMG, high mobility group. Back

Received for publication August 31, 2004. Accepted for publication December 3, 2004.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. van den Elsen, P. J., T. M. Holling, N. van der Stoep, J. M. Boss. 2003. DNA methylation and expression of major histocompatibility complex class I and class II transactivator genes in human developmental tumor cells and in T cell malignancies. Clin. Immunol. 109:46.[Medline]
  2. Girdlestone, J.. 1996. Transcriptional regulation of MHC class I genes. Eur. J. Immunogenet. 23:395.[Medline]
  3. Singer, D. S., J. E. Maguire. 1990. Regulation of the expression of class I MHC genes. Crit. Rev. Immunol. 10:235.[Medline]
  4. Howcroft, T. K., D. S. Singer. 2003. Expression of nonclassical MHC class Ib genes: comparison of regulatory elements. Immunol. Res. 27:1.[Medline]
  5. Le Bouteiller, P.. 1994. HLA class I chromosomal region, genes, and products: facts and questions. Crit. Rev. Immunol. 14:89.[Medline]
  6. Singer, D. S., E. Mozes, S. Kirshner, L. D. Kohn. 1997. Role of MHC class I molecules in autoimmune disease. Crit. Rev. Immunol. 17:463.[Medline]
  7. Weissman, J. D., D. S. Singer. 1991. A complex regulatory DNA element associated with a major histocompatibility complex class I gene consists of both a silencer and an enhancer. Mol. Cell. Biol. 11:4217.[Abstract/Free Full Text]
  8. Girdlestone, J.. 2000. Synergistic induction of HLA class I expression by RelA and CIITA. Blood 95:3804.[Abstract/Free Full Text]
  9. Taniguchi, S. I., M. Shong, C. Giuliani, G. Napolitano, M. Saji, V. Montani, K. Suzuki, D. S. Singer, L. D. Kohn. 1998. Iodide suppression of major histocompatibility class I gene expression in thyroid cells involves enhancer A and the transcription factor NF-{kappa}B. Mol. Endocrinol. 12:19.[Abstract/Free Full Text]
  10. Gobin, S. J., V. Keijsers, M. van Zutphen, P. J. van den Elsen. 1998. The role of enhancer A in the locus-specific transactivation of classical and nonclassical HLA class I genes by nuclear factor {kappa}B. J. Immunol. 161:2276.[Abstract/Free Full Text]
  11. Giuliani, C., M. Saji, G. Napolitano, L. A. Palmer, S. I. Taniguchi, M. Shong, D. S. Singer, L. D. Kohn. 1995. Hormonal modulation of major histocompatibility complex class I gene expression involves an enhancer A-binding complex consisting of Fra-2 and the p50 subunit of NF-{kappa}B. J. Biol. Chem. 270:11453.[Abstract/Free Full Text]
  12. Israel, A., O. Le Bail, D. Hatat, J. Piette, M. Kieran, F. Logeat, D. Wallach, M. Fellous, P. Kourilsky. 1989. TNF stimulates expression of mouse MHC class I genes by inducing an NF{kappa}B-like enhancer binding activity which displaces constitutive factors. EMBO J. 8:3793.[Medline]
  13. Blanar, M. A., L. C. Burkly, R. A. Flavell. 1989. NF-{kappa}B binds within a region required for B-cell-specific expression of major histocompatibility complex class II gene E{alpha}d. Mol. Cell. Biol. 9:844.[Abstract/Free Full Text]
  14. Waring, J. F., J. E. Radford, L. J. Burns, G. D. Ginder. 1995. The human leukocyte antigen A2 interferon-stimulated response element consensus sequence binds a nuclear factor required for constitutive expression. J. Biol. Chem. 270:12276.[Abstract/Free Full Text]
  15. Baldwin, A. S., Jr, P. A. Sharp. 1987. Binding of a nuclear factor to a regulatory sequence in the promoter of the mouse H-2Kb class I major histocompatibility gene. Mol. Cell. Biol. 7:305.[Abstract/Free Full Text]
  16. Gobin, S. J., A. Peijnenburg, V. Keijsers, P. J. van den Elsen. 1997. Site {alpha} is crucial for two routes of IFN{gamma}-induced MHC class I transactivation: the ISRE-mediated route and a novel pathway involving CIITA. Immunity 6:601.[Medline]
  17. Gobin, S. J., M. van Zutphen, A. M. Woltman, P. J. van den Elsen. 1999. Transactivation of classical and nonclassical HLA class I genes through the IFN-stimulated response element. J. Immunol. 163:1428.[Abstract/Free Full Text]
  18. Kimura, A., A. Israel, O. Le Bail, P. Kourilsky. 1986. Detailed analysis of the mouse H-2Kb promoter: enhancer-like sequences and their role in the regulation of class I gene expression. Cell 44:261.[Medline]
  19. Girdlestone, J.. 1995. Regulation of HLA class I loci by interferons. Immunobiology 193:229.[Medline]
  20. Martin, B. K., K. C. Chin, J. C. Olsen, C. A. Skinner, A. Dey, K. Ozato, J. P. Ting. 1997. Induction of MHC class I expression by the MHC class II transactivator CIITA. Immunity 6:591.[Medline]
  21. Raval, A., T. K. Howcroft, J. D. Weissman, S. Kirshner, X. S. Zhu, K. Yokoyama, J. Ting, D. S. Singer. 2001. Transcriptional coactivator, CIITA, is an acetyltransferase that bypasses a promoter requirement for TAF(II)250. Mol. Cell 7:105.[Medline]
  22. Masternak, K., A. Muhlethaler-Mottet, J. Villard, M. Zufferey, V. Steimle, W. Reith. 2000. CIITA is a transcriptional coactivator that is recruited to MHC class II promoters by multiple synergistic interactions with an enhanceosome complex. Genes Dev. 14:1156.[Abstract/Free Full Text]
  23. Spilianakis, C., A. Kretsovali, T. Agalioti, T. Makatounakis, D. Thanos, J. Papamatheakis. 2003. CIITA regulates transcription onset viaSer5-phosphorylation of RNA Pol II. EMBO J. 22:5125.[Medline]
  24. Jabrane-Ferrat, N., N. Nekrep, G. Tosi, L. Esserman, B. M. Peterlin. 2003. MHC class II enhanceosome: how is the class II transactivator recruited to DNA-bound activators?. Int. Immunol. 15:467.[Abstract/Free Full Text]
  25. Masternak, K., W. Reith. 2002. Promoter-specific functions of CIITA and the MHC class II enhanceosome in transcriptional activation. EMBO J. 21:1379.[Medline]
  26. LeibundGut-Landmann, S., J. M. Waldburger, M. Krawczyk, L. A. Otten, T. Suter, A. Fontana, H. Acha-Orbea, W. Reith. 2004. Mini-review: specificity and expression of CIITA, the master regulator of MHC class II genes. Eur. J. Immunol. 34:1513.[Medline]
  27. Barseguian, K., B. Lutterbach, S. W. Hiebert, J. Nickerson, J. B. Lian, J. L. Stein, A. J. van Wijnen, G. S. Stein. 2002. Multiple subnuclear targeting signals of the leukemia-related AML1/ETO and ETO repressor proteins. Proc. Natl. Acad. Sci. USA 99:15434.[Abstract/Free Full Text]
  28. Waldburger, J. M., K. Masternak, A. Muhlethaler-Mottet, J. Villard, M. Peretti, S. Landmann, W. Reith. 2000. Lessons from the bare lymphocyte syndrome: molecular mechanisms regulating MHC class II expression. Immunol. Rev. 178:148.[Medline]
  29. Boss, J. M.. 1997. Regulation of transcription of MHC class II genes. Curr. Opin. Immunol. 9:107.[Medline]
  30. Mach, B., V. Steimle, E. Martinez-Soria, W. Reith. 1996. Regulation of MHC class II genes: lessons from a disease. Annu. Rev. Immunol. 14:301.[Medline]
  31. Holling, T., N. van der Stoep, E. Quinten, P. van den Elsen. 2002. Activated human T cells accomplish MHC class II expression through T cell-specific occupation of class II transactivator promoter III. J. Immunol. 168:763.[Abstract/Free Full Text]
  32. Holling, T., E. Schooten, P. van den Elsen. 2004. Function and regulation of MHC class II molecules in T-lymphocytes: of mice and men. Hum. Immunol. 65:282.[Medline]
  33. Wong, A. W., N. Ghosh, K. McKinnon, W. Reed, J. Piskurich, K. Wright, J. P. Ting. 2002. Regulation and specificity of MHCT2A promoter usage in human primary T lymphocytes and cell line. J. Immunol. 169:3112.[Abstract/Free Full Text]
  34. Giese, K., C. Kingsley, J. R. Kirshner, R. Grosschedl. 1995. Assembly and function of a TCR{alpha} enhancer complex is dependent on LEF-1-induced DNA bending and multiple protein-protein interactions. Genes Dev. 9:995.[Abstract/Free Full Text]
  35. Sun, W., B. J. Graves, N. A. Speck. 1995. Transactivation of the Moloney murine leukemia virus and T-cell receptor {beta}-chain enhancers by cbf and ets requires intact binding sites for both proteins. J. Virol. 69:4941.[Abstract]
  36. Ho, I. C., L. H. Yang, G. Morle, J. M. Leiden. 1989. A T-cell-specific transcriptional enhancer element 3' of C{alpha} in the human T-cell receptor {alpha} locus. Proc. Natl. Acad. Sci. USA 86:6714.[Abstract/Free Full Text]
  37. Mayall, T. P., P. L. Sheridan, M. R. Montminy, K. A. Jones. 1997. Distinct roles for P-CREB and LEF-1 in TCR{alpha} enhancer assembly and activation on chromatin templates in vitro. Genes Dev. 11:887.[Abstract/Free Full Text]
  38. Halle, J. P., P. Haus-Seuffert, C. Woltering, G. Stelzer, M. Meisterernst. 1997. A conserved tissue-specific structure at a human T-cell receptor {beta}-chain core promoter. Mol. Cell. Biol. 17:4220.[Abstract]
  39. Levanon, D., R. E. Goldstein, Y. Bernstein, H. Tang, D. Goldenberg, S. Stifani, Z. Paroush, Y. Groner. 1998. Transcriptional repression by AML1 and LEF-1 is mediated by the TLE/Groucho corepressors. Proc. Natl. Acad. Sci. USA 95:11590.[Abstract/Free Full Text]
  40. Bruhn, L., A. Munnerlyn, R. Grosschedl. 1997. ALY, a context-dependent coactivator of LEF-1 and AML-1, is required for TCR{alpha} enhancer function. Genes Dev. 11:640.[Abstract/Free Full Text]
  41. Lund, A. H., M. van Lohuizen. 2002. RUNX: a trilogy of cancer genes. Cancer Cell. 1:213.[Medline]
  42. Ito, Y.. 2004. Oncogenic potential of the RUNX gene family: "overview". Oncogene 23:4198.[Medline]
  43. Durst, K. L., S. W. Hiebert. 2004. Role of RUNX family members in transcriptional repression and gene silencing. Oncogene 23:4220.[Medline]
  44. Clevers, H. C., R. Grosschedl. 1996. Transcriptional control of lymphoid development: lessons from gene targeting. Immunol. Today 17:336.[Medline]
  45. de Bruijn, M. F., N. A. Speck. 2004. Core-binding factors in hematopoiesis and immune function. Oncogene 23:4238.[Medline]
  46. Kurokawa, M., H. Hirai. 2003. Role of AML1/Runx1 in the pathogenesis of hematological malignancies. Cancer Sci. 94:841.[Medline]
  47. Uchida, H., J. R. Downing, Y. Miyazaki, R. Frank, J. Zhang, S. D. Nimer. 1999. Three distinct domains in TEL-AML1 are required for transcriptional repression of the IL-3 promoter. Oncogene 18:1015.[Medline]
  48. Bristow, C. A., P. Shore. 2003. Transcriptional regulation of the human MIP-1{alpha} promoter by RUNX1 and MOZ. Nucleic Acids Res. 31:2735.[Abstract/Free Full Text]
  49. Choi, S. J., T. Oba, N. S. Callander, D. F. Jelinek, G. D. Roodman. 2003. AML-1A and AML-1B regulation of MIP-1{alpha} expression in multiple myeloma. Blood 101:3778.[Abstract/Free Full Text]
  50. Liu, H., M. Holm, X. Q. Xie, M. Wolf-Watz, T. Grundstrom. 2004. AML1/Runx1 recruits calcineurin to regulate granulocyte macrophage colony-stimulating factor by Ets1 activation. J. Biol. Chem. 279:29398.[Abstract/Free Full Text]
  51. Petrovick, M. S., S. W. Hiebert, A. D. Friedman, C. J. Hetherington, D. G. Tenen, D. E. Zhang. 1998. Multiple functional domains of AML1: PU.1 and C/EBP{alpha} synergize with different regions of AML1. Mol. Cell. Biol. 18:3915.[Abstract/Free Full Text]
  52. Zhang, D. E., C. J. Hetherington, S. Meyers, K. L. Rhoades, C. J. Larson, H. M. Chen, S. W. Hiebert, D. G. Tenen. 1996. CCAAT enhancer-binding protein (C/EBP) and AML1 (CBF{alpha}2) synergistically activate the macrophage colony-stimulating factor receptor promoter. Mol. Cell. Biol. 16:1231.[Abstract]
  53. Lutterbach, B., J. J. Westendorf, B. Linggi, S. Isaac, E. Seto, S. W. Hiebert. 2000. A mechanism of repression by acute myeloid leukemia-1, the target of multiple chromosomal translocations in acute leukemia. J. Biol. Chem. 275:651.[Abstract/Free Full Text]
  54. Hiebert, S. W., E. F. Reed-Inderbitzin, J. Amann, B. Irvin, K. Durst, B. Linggi. 2003. The t(8;21) fusion protein contacts co-repressors and histone deacetylases to repress the transcription of the p14ARF tumor suppressor. Blood Cells Mol. Dis. 30:177.[Medline]
  55. Telfer, J. C., E. E. Hedblom, M. K. Anderson, M. N. Laurent, E. V. Rothenberg. 2004. Localization of the domains in Runx transcription factors required for the repression of CD4 in thymocytes. J. Immunol. 172:4359.[Abstract/Free Full Text]
  56. Taniuchi, I., M. Osato, T. Egawa, M. J. Sunshine, S. C. Bae, T. Komori, Y. Ito, D. R. Littman. 2002. Differential requirements for Runx proteins in CD4 repression and epigenetic silencing during T lymphocyte development. Cell 111:621.[Medline]
  57. Ichikawa, M., T. Asai, S. Chiba, M. Kurokawa, S. Ogawa. 2004. Runx1/AML-1 ranks as a master regulator of adult hematopoiesis. Cell Cycle 3:722.[Medline]
  58. Kagoshima, H., K. Shigesada, M. Satake, Y. Ito, H. Miyoshi, M. Ohki, M. Pepling, P. Gergen. 1993. The Runt domain identifies a new family of heteromeric transcriptional regulators. Trends Genet. 9:338.[Medline]
  59. Yang, X. J.. 2004. The diverse superfamily of lysine acetyltransferases and their roles in leukemia and other diseases. Nucleic Acids Res. 32:959.[Abstract/Free Full Text]
  60. Yamaguchi, Y., M. Kurokawa, Y. Imai, K. Izutsu, T. Asai, M. Ichikawa, G. Yamamoto, E. Nitta, T. Yamagata, K. Sasaki, et al 2004. AML1 is functionally regulated through p300-mediated acetylation on specific lysine residues. J. Biol. Chem. 279:15630.[Abstract/Free Full Text]
  61. Travis, A., A. Amsterdam, C. Belanger, R. Grosschedl. 1991. LEF-1, a gene encoding a lymphoid-specific protein with an HMG domain, regulates T-cell receptor {alpha} enhancer function [corrected]. Genes Dev. 5:880.[Abstract/Free Full Text]
  62. Giese, K., R. Grosschedl. 1993. LEF-1 contains an activation domain that stimulates transcription only in a specific context of factor-binding sites. EMBO J. 12:4667.[Medline]
  63. Hsu, S. C., J. Galceran, R. Grosschedl. 1998. Modulation of transcriptional regulation by LEF-1 in response to Wnt-1 signaling and association with {beta}-catenin. Mol. Cell. Biol. 18:4807.[Abstract/Free Full Text]
  64. Singer, D. S., R. D. Camerini-Otero, M. L. Satz, B. Osborne, D. Sachs, S. Rudikoff. 1982. Characterization of a porcine genomic clone encoding a major histocompatibility antigen: expression in mouse L cells. Proc. Natl. Acad. Sci. USA 79:1403.[Abstract/Free Full Text]
  65. Frels, W. I., J. A. Bluestone, R. J. Hodes, M. R. Capecchi, D. S. Singer. 1985. Expression of a microinjected porcine class I major histocompatibility complex gene in transgenic mice. Science 228:577.[Abstract/Free Full Text]
  66. Howcroft, T. K., K. Strebel, M. A. Martin, D. S. Singer. 1993. Repression of MHC class I gene promoter activity by two-exon Tat of HIV. Science 260:1320.[Abstract/Free Full Text]
  67. Lutterbach, B., S. W. Hiebert. 2000. Role of the transcription factor AML-1 in acute leukemia and hematopoietic differentiation. Gene 245:223.[Medline]
  68. Adya, N., T. Stacy, N. A. Speck, P. P. Liu. 1998. The leukemic protein core binding factor {beta} (CBF{beta})-smooth-muscle myosin heavy chain sequesters CBF{alpha}2 into cytoskeletal filaments and aggregates. Mol. Cell. Biol. 18:7432.[Abstract/Free Full Text]
  69. Howcroft, T. K., J. C. Richardson, D. S. Singer. 1993. MHC class I gene expression is negatively regulated by the proto-oncogene, c-jun. EMBO J. 12:3163.[Medline]
  70. Oberley, M. J., P. J. Farnham. 2003. Probing chromatin immunoprecipitates with CpG-island microarrays to identify genomic sites occupied by DNA-binding proteins. Methods Enzymol. 371:577.[Medline]
  71. Kirshner, S., L. Palmer, J. Bodor, M. Saji, L. D. Kohn, D. S. Singer. 2000. Major histocompatibility class I gene transcription in thyrocytes: a series of interacting regulatory DNA sequence elements mediate thyrotropin/cyclic adenosine 3',5'-monophosphate repression. Mol. Endocrinol. 14:82.[Abstract/Free Full Text]
  72. Saji, M., M. Shong, G. Napolitano, L. A. Palmer, S. I. Taniguchi, M. Ohmori, M. Ohta, K. Suzuki, S. L. Kirshner, C. Giuliani, D. S. Singer, L. D. Kohn. 1997. Regulation of major histocompatibility complex class I gene expression in thyroid cells: role of the cAMP response element-like sequence. J. Biol. Chem. 272:20096.[Abstract/Free Full Text]
  73. Napolitano, G., V. Montani, C. Giuliani, S. Di Vincenzo, I. Bucci, V. Todisco, G. Laglia, A. Coppa, D. S. Singer, M. Nakazato, et al 2000. Transforming growth factor-{beta}1 down-regulation of major histocompatibility complex class I in thyrocytes: coordinate regulation of two separate elements by thyroid-specific as well as ubiquitous transcription factors. Mol. Endocrinol. 14:486.[Abstract/Free Full Text]
  74. Burke, P. A., S. Hirschfeld, Y. Shirayoshi, J. W. Kasik, K. Hamada, E. Appella, K. Ozato. 1989. Developmental and tissue-specific expression of nuclear proteins that bind the regulatory element of the major histocompatibility complex class I gene. J. Exp. Med. 169:1309.[Abstract/Free Full Text]
  75. Ishizu, A., K. Sawai, H. Ikeda, T. Hirano, N. Ishiguro, D. Meruelo. 2000. Transduction of a murine dominant negative activation transcription factor 1 increases cell surface expression of the class I MHC on a human epidermoid tumor cell line. Int. Immunol. 12:161.[Abstract/Free Full Text]
  76. Ishiguro, N., G. D. Brown, D. Meruelo. 1997. Activation transcription factor 1 involvement in the regulation of murine H-2Dd expression. J. Biol. Chem. 272:15993.[Abstract/Free Full Text]
  77. Meyers, S., S. W. Hiebert. 2000. Alterations in subnuclear trafficking of nuclear regulatory factors in acute leukemia. J. Cell. Biochem. Suppl. 35:93.
  78. Tang, L., B. Guo, A. Javed, J. Y. Choi, S. Hiebert, J. B. Lian, A. J. van Wijnen, J. L. Stein, G. S. Stein, G. W. Zhou. 1999. Crystal structure of the nuclear matrix targeting signal of the transcription factor acute myelogenous leukemia-1/polyoma enhancer-binding protein 2{alpha}B/core binding factor {alpha}2. J. Biol. Chem. 274:33580.[Abstract/Free Full Text]
  79. Zeng, C., A. J. van Wijnen, J. L. Stein, S. Meyers, W. Sun, L. Shopland, J. B. Lawrence, S. Penman, J. B. Lian, G. S. Stein, S. W. Hiebert. 1997. Identification of a nuclear matrix targeting signal in the leukemia and bone-related AML/CBF-{alpha} transcription factors. Proc. Natl. Acad. Sci. USA 94:6746.[Abstract/Free Full Text]
  80. Thanos, D., T. Maniatis. 1995. Virus induction of human IFN{beta} gene expression requires the assembly of an enhanceosome. Cell 83:1091.[Medline]
  81. Merika, M., D. Thanos. 2001. Enhanceosomes. Curr. Opin. Genet. Dev. 11:205.[Medline]
  82. Adya, N., L. H. Castilla, P. P. Liu. 2000. Function of CBF{beta}/Bro proteins. Semin. Cell Dev. Biol. 11:361.[Medline]
  83. Wheeler, J. C., K. Shigesada, J. P. Gergen, Y. Ito. 2000. Mechanisms of transcriptional regulation by Runt domain proteins. Semin. Cell Dev. Biol. 11:369.[Medline]
  84. Sheridan, P. L., C. T. Sheline, K. Cannon, M. L. Voz, M. J. Pazin, J. T. Kadonaga, K. A. Jones. 1995. Activation of the HIV-1 enhancer by the LEF-1 HMG protein on nucleosome-assembled DNA in vitro. Genes Dev. 9:2090.[Abstract/Free Full Text]
  85. Giese, K., J. Cox, R. Grosschedl. 1992. The HMG domain of lymphoid enhancer factor 1 bends DNA and facilitates assembly of functional nucleoprotein structures. Cell 69:185.[Medline]
  86. Reith, W., B. Mach. 2001. The bare lymphocyte syndrome and the regulation of MHC expression. Annu. Rev. Immunol. 19:331.[Medline]
  87. Lukasik, S. M., L. Zhang, T. Corpora, S. Tomanicek, Y. Li, M. Kundu, K. Hartman, P. P. Liu, T. M. Laue, R. L. Biltonen, N. A. Speck, J. H. Bushweller. 2002. Altered affinity of CBF{beta}-SMMHC for Runx1 explains its role in leukemogenesis. Nat. Struct. Biol. 9:674.[Medline]
  88. McNeil, S., C. Zeng, K. S. Harrington, S. Hiebert, J. B. Lian, J. L. Stein, A. J. van Wijnen, G. S. Stein. 1999. The t(8;21) chromosomal translocation in acute myelogenous leukemia modifies intranuclear targeting of the AML1/CBF{alpha}2 transcription factor. Proc. Natl. Acad. Sci. USA 96:14882.[Abstract/Free Full Text]
  89. Peterson, L. F., D. E. Zhang. 2004. The 8;21 translocation in leukemogenesis. Oncogene 23:4255.[Medline]
  90. Okuda, T., Z. Cai, S. Yang, N. Lenny, C. J. Lyu, J. M. van Deursen, H. Harada, J. R. Downing. 1998. Expression of a knocked-in AML1-ETO leukemia gene inhibits the establishment of normal definitive hematopoiesis and directly generates dysplastic hematopoietic progenitors. Blood 91:3134.[Abstract/Free Full Text]
  91. Higuchi, M., D. O’Brien, P. Kumaravelu, N. Lenny, E. J. Yeoh, J. R. Downing. 2002. Expression of a conditional AML1-ETO oncogene bypasses embryonic lethality and establishes a murine model of human t(8;21) acute myeloid leukemia. Cancer Cell. 1:63.[Medline]
  92. Tokuhiro, S., R. Yamada, X. Chang, A. Suzuki, Y. Kochi, T. Sawada, M. Suzuki, M. Nagasaki, M. Ohtsuki, M. Ono, et al 2003. An intronic SNP in a RUNX1 binding site of SLC22A4, encoding an organic cation transporter, is associated with rheumatoid arthritis. Nat. Genet. 35:341.[Medline]
  93. Coutinho, J.. 2004. RUNX1: transcription factor scores a hat-trick of autoimmune diseases. Clin. Genet. 65:180.
  94. Singer, D. S., H. Zinger, L. D. Kohn, E. Mozes. 1999. Differing MHC class I requirements for induction and propagation of experimental systemic lupus erythematosus. Eur. J. Immunol. 29:2259.[Medline]
  95. Mozes, E., L. D. Kohn, F. Hakim, D. S. Singer. 1993. Resistance of MHC class I-deficient mice to experimental systemic lupus erythematosus. Science 261:91.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
S. Charni, J. I. Aguilo, J. Garaude, G. de Bettignies, C. Jacquet, R. A. Hipskind, D. Singer, A. Anel, and M. Villalba
ERK5 Knockdown Generates Mouse Leukemia Cells with Low MHC Class I Levels That Activate NK Cells and Block Tumorigenesis
J. Immunol., March 15, 2009; 182(6): 3398 - 3405.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
A. S. Kotekar, J. D. Weissman, A. Gegonne, H. Cohen, and D. S. Singer
Histone Modifications, but Not Nucleosomal Positioning, Correlate with Major Histocompatibility Complex Class I Promoter Activity in Different Tissues In Vivo
Mol. Cell. Biol., December 15, 2008; 28(24): 7323 - 7336.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
J. A. Mertz, R. Kobayashi, and J. P. Dudley
ALY Is a Common Coactivator of RUNX1 and c-Myb on the Type B Leukemogenic Virus Enhancer
J. Virol., April 1, 2007; 81(7): 3503 - 3513.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
C Giuliani, M Saji, I Bucci, G Fiore, M Liberatore, D S Singer, F Monaco, L D Kohn, and G Napolitano
Transcriptional regulation of major histocompatibility complex class I gene by insulin and IGF-I in FRTL-5 thyroid cells.
J. Endocrinol., June 1, 2006; 189(3): 605 - 615.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Howcroft, T. K.
Right arrow Articles by Singer, D. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Howcroft, T. K.
Right arrow Articles by Singer, D. S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS