The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pike, K. A.
Right arrow Articles by Ratcliffe, M. J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pike, K. A.
Right arrow Articles by Ratcliffe, M. J. H.
The Journal of Immunology, 2005, 174: 2012-2020.
Copyright © 2005 by The American Association of Immunologists

Dual Requirement for the Ig{alpha} Immunoreceptor Tyrosine-Based Activation Motif (ITAM) and a Conserved Non-Ig{alpha} ITAM Tyrosine in Supporting Ig{alpha}{beta}-Mediated B Cell Development1

Kelly A. Pike*,{dagger} and Michael J. H. Ratcliffe2,*,{dagger}

* Department of Immunology, University of Toronto, and {dagger} Sunnybrook and Women’s College Health Sciences Center, Toronto, Ontario, Canada


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Surface Ig (sIg) expression is a critical checkpoint during avian B cell development. Only cells that express sIg colonize bursal follicles, clonally expand, and undergo Ig diversification by gene conversion. Expression of a heterodimer, in which the extracellular and transmembrane domains of murine CD8{alpha} or CD8{beta} are fused to the cytoplasmic domains of chicken Ig{alpha} (chIg{alpha}) or Ig{beta}, respectively (murine CD8{alpha} (mCD8{alpha}):chIg{alpha} + mCD8{beta}:chIg{beta}), or an mCD8{alpha}:chIg{alpha} homodimer supported bursal B cell development as efficiently as endogenous sIg. In this study we demonstrate that B cell development, in the absence of chIg{beta}, requires both the Ig{alpha} ITAM and a conserved non-ITAM Ig{alpha} tyrosine (Y3) that has been associated with binding to B cell linker protein (BLNK). When associated with the cytoplasmic domain of Ig{beta}, the Ig{alpha} ITAM is not required for the induction of strong calcium mobilization or BLNK phosphorylation, but is still necessary to support B cell development. In contrast, mutation of the Ig{alpha} Y3 severely compromised calcium mobilization when expressed as either a homodimer or a heterodimer with the cytoplasmic domain of Ig{beta}. However, coexpression of the cytoplasmic domain of Ig{beta} partially complemented the Ig{alpha} Y3 mutation, rescuing higher levels of BLNK phosphorylation and, more strikingly, supporting B cell development.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Both murine and avian BCR complexes include Ig H and L chains in association with the Ig{alpha}{beta} heterodimer. Signaling downstream of the BCR complex originates from the Ig{alpha} and Ig{beta} cytoplasmic domains, both of which contain ITAMs (1, 2). Cross-linking of the BCR complex leads to Src family kinase-mediated phosphorylation of the Ig{alpha}{beta} ITAM tyrosines, promoting recruitment and activation of the kinase Syk, thereby initiating several downstream signaling pathways leading to B cell survival, differentiation, and proliferation (3, 4). In mice expressing a BCR complex that lacks the cytoplasmic domains of Ig{alpha} and Ig{beta}, B cell development is arrested at the pre-BI cell stage, indicating that the Ig{alpha}{beta} heterodimer is required for B cell differentiation (5).

In the chicken, B cell development occurs in the bursa of Fabricius, a gut-associated lymphoid organ (6, 7). Nevertheless as in the mouse, surface Ig (sIg)3 expression is a critical checkpoint in avian B cell development. Only those B cell precursor cells that have undergone productive rearrangement at both the H and L chain loci and express a functional BCR complex at the cell surface colonize bursal follicles, expand, and diversify their Ig loci by gene conversion (8, 9). Subsequent corticomedullary redistribution and emigration to the periphery also require maintained sIg expression, because bursal cells losing sIg expression are eliminated by apoptosis (10).

In the absence of receptor ligation, both Src family kinases and Syk associate with the Ig{alpha}{beta} heterodimer with low affinity and may support basal signaling (11, 12). It has been suggested that such basal signaling, initiated from the BCR complex in the absence of receptor ligation, is sufficient to support the development of B cells. To address this possibility, both murine and avian truncated µ receptor complexes (Tµ), which lack the V(D)J encoded determinants, but maintain the ability to associate with the Ig{alpha}{beta} heterodimer, have been generated and have been shown to support early B cell development (13, 14, 15). Although these results suggested that there is no requirement for BCR ligation during the early stages of B cell development in mouse or in chicken, both murine and avian Tµ complexes included extracellular domains that could have been involved in receptor-ligand interactions. In this regard, the mammalian pre-BCR complex has been shown to interact with several stromal ligands (16, 17, 18, 19).

More recently, the cytoplasmic domains of the Ig{alpha}/Ig{beta} heterodimer have been targeted to the cell surface in the absence of any of the extracellular domains associated with the BCR complex. The cytoplasmic domains of murine Ig{alpha} and Ig{beta}, targeted together to the cell surface by a palmitoylation motif, are sufficient to generate immature B cells (20). In the chick we have used the extracellular and transmembrane domains of murine CD8{alpha} and CD8{beta} to target the cytoplasmic domains of chicken Ig{alpha} (chIg{alpha}) and chIg{beta} to the cell surface. Using retroviral gene transfer in vivo, we have shown that the cytoplasmic domains of the Ig{alpha}{beta} heterodimer are as efficient as endogenous µ in supporting the early stages of B cell development (21). As such, it can be concluded that basal signals generated after surface expression of the Ig{alpha}{beta} cytoplasmic domains are sufficient to support B cell differentiation.

We have also reported that surface targeting of the cytoplasmic domain of Ig{alpha} alone, in the absence of Ig{beta}, can support B cell development in the chick embryo. Moreover, we demonstrated that both calcium mobilization and support of B cell development require the Ig{alpha} ITAM tyrosines (21, 22). However, the cytoplasmic domain of Ig{alpha} is highly conserved in regions outside the ITAM (23), and it has remained unclear whether such regions are also required for B cell differentiation. In particular, a third tyrosine, C-terminal to the Ig{alpha} ITAM, that we have designated Y3 is conserved and has been suggested to recruit B cell linker protein (BLNK; also known as SLP-65 or BASH) to the BCR complex (24, 25). BLNK is an adaptor protein involved in the recruitment of Grb2/Sos, phospholipase C{gamma}2a (PLC{gamma}2a) and Vav to the BCR complex (26, 27, 28), and as a consequence promotes viability, proliferation, and activation. Deletion of BLNK in the DT40 B cell line has a profound effect on signaling downstream of the BCR complex, including the lost ability of the BCR complex to induce calcium mobilization (29). The importance of BLNK in signaling downstream of the BCR complex directly correlates with its critical role during B cell development in mammals. BLNK knockout mice display a partial block in B cell development, resulting in a severely diminished pool of peripheral mature B cells (30, 31, 32, 33).

Phosphorylation of non-ITAM tyrosines in Ig{alpha} has been implicated as crucial for BLNK recruitment to the BCR complex (24). Recruitment of BLNK to the BCR complex and its subsequent phosphorylation lead to its association with both PLC{gamma}2a and Btk, thereby promoting PLC{gamma}2a activation (29, 34). Activation of PLC{gamma}2a results in the production of inositol triphosphate, which ultimately results in the release of calcium from intracellular stores and the influx of extracellular calcium (35). Not surprisingly, ablation of PLC{gamma}2a in the DT40 bursal cell line results in a complete loss of calcium mobilization after sIg receptor ligation (36). Similarly, PLC{gamma}2a knockout mice have a reduced number of peripheral mature B cells due to a block of pre-B cell differentiation (37), suggesting a critical role for PLC{gamma}2a in B cell development.

To directly determine the relative importance of the Ig{alpha} ITAM and conserved Y3 residue, we have assessed the ability of receptor mutants to support signaling after their ligation in vitro and to support B cell development after expression in vivo. Mutations of both the Ig{alpha} ITAM and the Ig{alpha} Y3 residue were found to compromise signaling downstream of the Ig{alpha} cytoplasmic domain, correlating with the inability of the mutated Ig{alpha} cytoplasmic domain to support B cell development in the absence of Ig{beta}. In the context of the Ig{alpha}{beta} heterodimer, however, the Ig{alpha} ITAM is not required for calcium mobilization or BLNK phosphorylation, whereas it is absolutely required for B cell development. As such, the Ig{beta} ITAM cannot functionally compensate for the disrupted Ig{alpha} ITAM during B cell development. Unlike the Ig{alpha} ITAM, the Ig{alpha} Y3 residue remains crucial for a robust calcium response induced by the Ig{alpha}{beta} heterodimer. Strikingly, however, the Ig{alpha}{beta} heterodimer does not require the Ig{alpha} Y3 residue to support B cell development. We have therefore demonstrated that although the Y3 residue may be involved in signaling downstream of the BCR complex, the function(s) of the Ig{alpha} Y3 residue required for early B cell development can also be provided by the cytoplasmic domain of Ig{beta}.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Site-directed mutagenesis of murine CD8{alpha} (mCD8{alpha}):chIg{alpha}

The mCD8{alpha}:chIg{alpha}, mCD8{alpha}:chIg{beta}, and mCD8{beta}:chIg{beta} chimeric constructs were generated previously (21). Point mutations of the Ig{alpha} cytoplasmic domain were introduced using the QuikChange Site-Directed Mutagenesis kit (Stratagene), which involves amplification of a parental vector with complimentary reverse oligonucleotides in which the mutation (underlined) is incorporated. The mCD8{alpha}:chIg{alpha}F1F2 mutant was generated by amplification of the Cla12L-mCD8{alpha}:chIg{alpha}F2 plasmid (21) with the {alpha}{alpha}F1(5'), GGAGAACCTCTTTGAGGGCCTGGATTTGG, and {alpha}{alpha}F1(3'), CCAAATCCAGGCCCTCAAAGAGGTTCTCC primers. The mCD8{alpha}:chIg{alpha}F3 mutant was generated by the amplification of Cla12L-mCD8{alpha}:chIg{alpha} plasmid (21) with {alpha}{alpha}F3(5'), CGCCCGCAGCCCACCTTTGAGGACG, and {alpha}{alpha}F3(3'), CGTCCTCAAAGGTGGGCTGCGGGCG primers. The mutations were confirmed by sequencing (York University). Mutated mCD8{alpha}:chIg{alpha} sequences were excised by ClaI digestion and cloned into the unique ClaI site of replication-competent avian leukosis virus with splice acceptor (RCAS)-Bryan polymerase (BP)A (38).

Retroviral gene transfer

The RCAS vectors are derived from the Rous sarcoma virus and are organized as follows: long terminal repeat (LTR)-gag-pol-env-splice acceptor-cloning site-LTR. Expression of mCD8:chIg genes, inserted into the cloning site, is driven by transcription from the 5' LTR promoter and subsequent splicing of transcripts (38).

Line O chicken embryo fibroblasts (CEFs; Regional Poultry Research Laboratories) were transfected with the RCAS-mCD8:chIg vectors as previously described (13). One week after transfection, CEFs were tested for surface expression of the mCD8:chIg chimeric proteins and injected into line 22 chick embryos (Charles River Laboratories) on day 3 of embryogenesis.

The DT40 frameshift (sIg–) cell line (provided by Dr. J. M. Buerstedde, GSF, Institute for Molecular Radiobiology, Neuherberg-Munich, Germany) was infected with the various RCAS-mCD8:chIg retroviruses. Surface Ig– DT40 cells (1 x 104) were cocultured with 1 x 106 appropriately transfected CEFs in a final volume of 2 ml of IMDM/2% chicken serum containing 8 µg/ml 1,5-dimethyl-1,5-diazaundecamethylene polymethobromide, hexadimethrine bromide (Sigma-Aldrich), for 24 h. The infected nonadherent DT40 cells were allowed to expand and were then sorted based on surface expression of mCD8{alpha} or mCD8{beta} using the FACSAria (BD Biosciences).

Abs and flow cytometry

Surface expression of the chimeric proteins in vivo and in vitro was detected using the anti-mCD8{alpha} (53-6.72) and anti-mCD8{beta} (53.8.84) Abs (provided by Dr. P. Hugo, PROCREA BioSciences). Cell suspensions of bursal cells generated at the time of hatching were also stained for the pan B cell marker ChB6 and µ as previously described (13).

DT40 cell stimulation, immunoprecipitation, and Western blotting

Before all stimulations, samples were prewarmed to 37°C for 2 min. Total cell lysates were generated from 1 x 106 cells stimulated with either anti-mCD8{beta} (53-5.8.84) or anti-mCD8.2{alpha} (D9; provided by Dr. P. Hugo) for 2 min. Reactions were stopped by the addition of ice-cold phosphate buffer. Cells were then pelleted and resuspended in SDS loading dye, boiled, and electrophoresed. After transfer onto nitrocellulose, membranes were probed with the biotinylated anti-phosphotyrosine Ab 4G10 (39) and developed with streptavidin-coupled HRP (Southern Biotechnologies). Membranes were then stripped and probed for actin (AC-40; Sigma-Aldrich) as described previously (21).

The mCD8:chIg homodimers and heterodimers were immunoprecipitated from cell lysates after either Ab cross-linking or pervanadate stimulation. In the case of Ab cross-linking, 10 x 106 cells were resuspended in 500 µl of IMDM and were stimulated with either anti-mCD8{beta} (53-5.8.84) or anti-mCD8.2{alpha} (D9) for 2 min. For pervanadate simulation, 2 x 106 cells were resuspended in 100 µl of IMDM to which 100 µl of prewarmed 50 µM pervanadate (prepared as described previously (40)) was added. After stimulation, cells were washed in ice-cold phosphate buffer, pelleted, and lysed in 1% detergent Nonidet P-40 buffer (1% Nonidet P-40, 150 mM NaCl, and 10 mM Tris, pH 7.5) containing phosphatase and protease inhibitors for 1 h at 4°C. Lysates were then centrifuged, and the supernatant was added to anti-mCD8{alpha} (53-6.7.2)-coupled cyanogen bromide-activated Sepharose beads (Amersham Biosciences) or to anti-chBLNK (provided by Dr. T. Kurosaki, Institute for Liver Research, Kansai Medical University, Moriguchi, Japan)-coupled protein A-Sepharose beads (Sigma-Aldrich) and incubated overnight at 4°C. Washed beads were resuspended in SDS loading dye and boiled for 5 min. The supernatant was then electrophoresed, transferred to nitrocellulose (Amersham Biosciences), and probed with 4G10. Membranes were subsequently stripped and probed for total BLNK using the anti-chBLNK Ab. Quantification of bands was performed by scanning densitometry.

Calcium mobilization assays

All calcium fluxes were performed as previously described, but were analyzed on FACSAria (BD Biosciences) (41).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Ig{alpha} ITAM is required for Ig{alpha}{beta}-mediated B cell development

Expression of the mCD8{alpha}:chIg{alpha} chimeric protein either alone (Fig. 1A) or together with mCD8{beta}:chIg{beta} (Fig. 1B) supports all the early stages of chicken B cell development, including colonization of bursal follicles, oligoclonal expansion of B cells within bursal follicles, and onset of repertoire diversification by gene conversion (21). Site-directed mutagenesis of both Ig{alpha} ITAM tyrosine residues to phenylalanine (mCD8{alpha}:chIg{alpha}F1F2) abolished the ability of Ig{alpha} to support B cell development in the absence of Ig{beta} (22) (Fig. 1C). Although mCD8{alpha}:chIg{alpha}F1F2 is expressed on the surface of B-lineage B cells at similar levels to the mCD8{alpha}:chIg{alpha} protein, all mCD8{alpha}:chIg{alpha}F1F2-expressing B cells coexpressed endogenous µ. This confirms previous findings with the mCD8{alpha}:chIg{alpha}F2 receptor containing a single tyrosine to phenylalanine mutation in the Ig{alpha} ITAM (21), lending additional support to our conclusion that signaling downstream of the Ig{alpha} ITAM is required to support chicken B cell development.



View larger version (52K):
[in this window]
[in a new window]
  		FIGURE 1. The Ig{alpha} ITAM is required for B cell development in vivo. Bursal cells were isolated from neonatal chicks infected on day 3 of embryogenesis with the RCAS(BP)A-mCD8{alpha}:chIg{alpha} (A), RCAS(BP)A-mCD8{alpha}:chIg{alpha} + RCAS(BP)B-mCD8{beta}:chIg{beta} (B), RCAS(BP)A-mCD8{alpha}:chIg{alpha}F1F2 (C), or RCAS(BP)A-mCD8{alpha}:chIg{alpha} F1F2 + RCAS(BP)B-mCD8{beta}:chIg{beta} (D) retroviruses. Cell suspensions were stained for ChB6, µ, mCD8{alpha}, and mCD8{beta}. Representative contour plots of 30,000 cells are shown gated on ChB6+ cells. Numbers indicate the percentage of ChB6+ cells within the respective quadrant.

 
Nonetheless, the endogenous BCR complex includes both Ig{alpha} and Ig{beta}, each of which contains an ITAM motif involved in BCR signaling (1, 2). Therefore, although the expression of an mCD8{alpha}:chIg{beta} chimeric protein alone does not support B cell development (21, 22), we addressed the possibility that functional motifs in the cytoplasmic domain of Ig{beta} could complement the ITAM-deficient mCD8{alpha}:chIg{alpha}F1F2 and provide sufficient signals to support B cell development. Chicks were therefore coinfected with RCAS(BP)A-mCD8{alpha}:chIg{alpha}F1F2 and RCAS(BP)B:mCD8{beta}:chIg{beta} viruses. High levels of mCD8{alpha}:chIg{alpha}F1F2 and mCD8{beta}:chIg{beta} coexpression were observed in 11 neonatal chicks analyzed. However, all B-lineage bursal cells in RCAS(BP)A-mCD8{alpha}:chIg{alpha}F1F2 + RCAS(BP)B:mCD8{beta}:chIg{beta}-infected chicks were µ+ (Fig. 1D). Therefore, expression of the cytoplasmic domain of Ig{beta} does not complement the ITAM deficiency of the mCD8{alpha}:chIg{alpha}F1F2 protein, and consequently, the Ig{alpha} ITAM plays a unique role in supporting B cell development.

Ig{alpha} ITAM is not required for Ig{alpha}{beta} induction of strong calcium mobilization

The mCD8{alpha}:chIg{alpha}F1F2 chimeric protein failed to support the induction of calcium mobilization when expressed in sIg– DT40 B lymphoma cells and cross-linked with anti-CD8{alpha} Abs (Fig. 2, A and B). This is consistent with our previous finding that the single tyrosine to phenylalanine mutant mCD8{alpha}:chIg{alpha}F2 chimeric protein failed to support calcium mobilization (21). We have also reported that the cytoplasmic domain of Ig{beta}, when expressed as a mCD8{alpha}:chIg{beta} chimeric homodimer, fails to support calcium mobilization in DT40 cells (21).



View larger version (41K):
[in this window]
[in a new window]
  		FIGURE 2. The Ig{alpha} ITAM is not required for signaling downstream of the Ig{alpha}{beta} heterodimer. A, Sublines of the sIg– variant of the DT40 bursal lymphoma were established by viral infection. Expression levels of the chimeric homodimers and heterodimers were determined by staining for mCD8{alpha} and mCD8{beta}. Contour plots of 10,000 events are shown. B, The sIg– DT40 sublines were loaded with Indo-1 and stimulated with anti-mCD8{alpha}. Arrows indicate the addition of the cross-linking Ab. C, Uninfected sIg– DT40 cells and infected sIg– DT40 sublines were left unstimulated (–) or were stimulated (+) with anti-mCD8{alpha} (D9) for 2 min. After stimulation, the sIg– DT40 sublines were lysed, and BLNK was immunoprecipitated. Immunoprecipitates were separated by SDS-PAGE, transferred to nitrocellulose, and probed with 4G10 for phosphotyrosines. Membranes were stripped and reprobed for total BLNK. D, CD8 homodimers were immunoprecipitated with anti-mCD8{alpha} (53-6.7.2)-coupled Sepharose beads from cells stimulated with either the anti-CD8{alpha} (D9) Ab (top panel) or 25 µm pervanadate (bottom panel). Immunoprecipitates were separated by SDS-PAGE and analyzed by Western blotting for phosphotyrosines using the 4G10 Ab. E, CD8 heterodimers were immunoprecipitated with anti-mCD8{beta} (53-8.84)-coupled Sepharose beads from cells stimulated with either the anti-CD8{alpha} (D9) Ab (top panel) or 25 µm pervanadate (bottom panel). The positions of mCD8{alpha}:chIg{alpha} and its mutants ({alpha}{alpha}) and of mCD8{beta}:chIg{beta} ({beta}{beta}) are indicated.

 
To assess the capacity of the mCD8{alpha}:chIg{alpha}F1F2 + mCD8{beta}:chIg{beta} heterodimer to support calcium mobilization in DT40 cells, the sIg– DT40 cell line was coinfected with RCAS(BP)A-mCD8{alpha}:chIg{alpha}F1F2 + RCAS(BP)B:mCD8{beta}:chIg{beta} viruses and sorted based on surface expression of the heterodimer (Fig. 2A). Cross-linking of the mCD8{alpha}:chIg{alpha}F1F2 + mCD8{beta}:chIg{beta} heterodimer with anti-mCD8{alpha} (Fig. 2B) or anti-mCD8{beta} (data not shown) Abs led to a rapid rise in calcium, which was comparable in duration and amplitude to that with either the mCD8{alpha}:chIg{alpha} homodimer or the mCD8{alpha}:chIg{alpha} + mCD8{beta}:chIg{beta} heterodimer. Therefore, although the Ig{alpha} ITAM provides unique signals required for B cell development in vivo, it is not required for the induction of strong calcium mobilization in vitro when expressed in conjunction with the cytoplasmic domain of Ig{beta}.

Compelling evidence implicates BLNK phosphorylation as critical in coupling BCR ligation to strong calcium mobilization (42). It was therefore of interest to determine the status of BLNK phosphorylation after cross-linking of either the mCD8{alpha}:chIg{alpha}F1F2 homodimer or the mCD8{alpha}:chIg{alpha}F1F2 + mCD8{beta}:chIg{beta} heterodimer. After stimulation with anti-CD8 Abs, BLNK was immunoprecipitated from cell lysates, and its state of tyrosine phosphorylation was assessed by Western blotting. Whereas cross-linking the unmodified mCD8{alpha}:chIg{alpha} homodimer resulted in strong BLNK phosphorylation, this was not seen after cross-linking the mCD8{alpha}:chIg{alpha}F1F2 homodimer (Fig. 2C). Ligation of the mCD8{alpha}:chIg{alpha}F1F2 + mCD8{beta}:chIg{beta} heterodimer, however, resulted in phosphorylation of BLNK. Thus, BLNK can be phosphorylated in the absence of the Ig{alpha} ITAM, thereby providing a possible means by which the mCD8{alpha}:chIg{alpha}F1F2 + mCD8{beta}:chIg{beta} heterodimer can support a robust calcium mobilization.

Thus, we have demonstrated that when the cytoplasmic domain of Ig{alpha} is expressed independently of Ig{beta}, the Ig{alpha} ITAM is required for BLNK phosphorylation and calcium mobilization in vitro as well as for B cell development in the chick embryo. However, when the cytoplasmic domain of Ig{alpha} is expressed in association with the cytoplasmic domain of Ig{beta}, the Ig{alpha} ITAM is dispensable for BLNK phosphorylation and strong calcium mobilization, but remains required for B cell development.

Ig{beta} cross-linking can induce BLNK phosphorylation independently of Ig{alpha}

In addition to the ITAM tyrosines, the cytoplasmic domain of chicken Ig{alpha} contains a third conserved tyrosine residue, which we have designated Y3. Phosphorylation of the murine equivalent, Y204, has been implicated in the association of Ig{alpha} with BLNK (24, 25). Not surprisingly, cross-linking the mCD8{alpha}:chIg{alpha}F1F2 homodimer did not result in phosphorylation of the Y3 residue (Fig. 2D), consistent with the lack of BLNK phosphorylation and subsequent calcium mobilization. Surprisingly, however, cross-linking of the mCD8{alpha}:chIg{alpha}F1F2 + mCD8{beta}:chIg{beta} heterodimer also did not result in Ig{alpha} Y3 phosphorylation (Fig. 2E) despite high levels of calcium mobilization and BLNK phosphorylation. Thus, when the heterodimer was cross-linked with anti-mCD8{alpha} Abs and immunoprecipitated with anti-mCD8{beta} Abs, no phosphorylation of mCD8{alpha}:chIg{alpha}F1F2 was observed. In contrast, the mCD8{beta}:chIg{beta} was heavily phosphorylated after heterodimer cross-linking (Fig. 2E). Equivalent results were obtained when the heterodimer was cross-linked with anti-mCD8{beta} and immunoprecipitated with anti-mCD8{alpha}-coupled beads (data not shown). Therefore, in the absence of the Ig{alpha} ITAM, the Y3 residue is not phosphorylated after cross-linking of the mCD8{alpha}:chIg{alpha}F1F2 + mCD8{beta}:chIg{beta} heterodimer.

We verified that we could detect phosphorylation of the Y3 residue by stimulating mCD8{alpha}:chIg{alpha}F1F2 + mCD8{beta}:chIg{beta}-expressing DT40 cells with pervanadate, a potent phosphatase inhibitor. A 2-min stimulation with 25 µM pervanadate led to tyrosine phosphorylation of both mCD8{alpha}:chIg{alpha}F1F2 and mCD8{beta}:chIg{beta} (Fig. 2, D and E).

Given the lack of tyrosine phosphorylation of the Ig{alpha} Y3 residue after cross-linking of the mCD8{alpha}:chIg{alpha}F1F2 + mCD8{beta}:chIg{beta} heterodimer, we addressed the possibility that the cytoplasmic domain of Ig{beta} could play a role in the phosphorylation of BLNK. Initially, DT40 cells expressing the mCD8{alpha}:chIg{beta} chimeric protein (Fig. 3A) were stimulated with cross-linking Abs, after which the chimeric protein was immunoprecipitated. Western blotting for protein tyrosine phosphorylation demonstrated that Ab cross-linking results in the phosphorylation of the cytoplasmic domain of Ig{beta} (Fig. 3B), consistent with evidence we have previously reported demonstrating that the cytoplasmic domain of Ig{beta}, when expressed in the absence of the cytoplasmic domain of Ig{alpha}, can imitate significant protein tyrosine phosphorylation (21).



View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 3. The cytoplasmic domain of Ig{beta} induces the phosphorylation of BLNK. A, The sIg– variant of the DT40 bursal lymphoma was infected with either the RCAS(BP)A-mCD8{alpha}:chIg{alpha} or the RCAS(BP)A-mCD8{alpha}:chIg{beta} retrovirus and sorted based on surface expression of mCD8{alpha}. Expression levels of the chimeric homodimers were determined by staining for mCD8{alpha}. Histograms of 10,000 events are shown. B, Chimeric homodimers were cross-linked with anti-mCD8{alpha} (D9) and immunoprecipitated with anti-mCD8{alpha} (53-6.72)-coupled Sepharose beads. Immunoprecipitates were separated by SDS-PAGE and transferred to nitrocellulose. Membranes were probed for protein tyrosine phosphorylation. C, Uninfected sIg– DT40 cells and the infected sIg– DT40 sublines were left unstimulated (–) or were stimulated (+) with anti-mCD8{alpha} (D9) for 2 min. BLNK was immunoprecipitated from cell lysates, separated by SDS-PAGE, transferred to nitrocellulose, and probed for phosphotyrosines with 4G10. Membranes were stripped and reprobed for total BLNK. D, The sIg– DT40 sublines were loaded with Indo-1 and stimulated with anti-mCD8{alpha}. Arrows indicate the addition of the cross-linking Ab.

 
We show in this study that the cytoplasmic domain of Ig{beta} is also sufficient to support the induction of BLNK phosphorylation (Fig. 3C). After Ab cross-linking of the mCD8{alpha}:chIg{beta} chimeric protein, total BLNK was immunoprecipitated from generated cell lysates. Western blotting for the tyrosine phosphorylation clearly demonstrated that after receptor cross-linking, the cytoplasmic domains of both Ig{alpha} and Ig{beta} can independently induce BLNK phosphorylation (Fig. 3C). These results provide a plausible rationale for the induction of BLNK phosphorylation and calcium mobilization by the mCD8{alpha}:chIg{alpha}F1F2 + mCD8{beta}:chIg{beta} heterodimer in the absence of phosphorylation of the Y3 residue of mCD8{alpha}:chIg{alpha}F1F2. Nonetheless, the inability of the mCD8{alpha}:chIg{beta} chimeric receptor to mobilize calcium (Fig. 3D) despite significant levels of BLNK phosphorylation (Fig. 3C) clearly demonstrates that although BLNK phosphorylation may be necessary for calcium mobilization, it is not sufficient to support a calcium response.

F3 mutation alters signaling capacity of mCD8{alpha}:chIg{alpha} in DT40 cells

The ability of the mCD8{alpha}:chIg{alpha}F1F2 + mCD8{beta}:chIg{beta} heterodimer to induce the phosphorylation of BLNK and a robust calcium response after Ab cross-linking, despite the absence of Y3 phosphorylation, led us to assess the importance of the Y3 residue in Ig{alpha}-mediated signaling and B cell development. To this end, the Y3 residue was mutated to phenylalanine by site-directed mutagenesis (mCD8{alpha}:chIg{alpha}F3) to yield a domain that retains the Ig{alpha} ITAM.

The sIg– DT40 bursal lymphoma was infected with RCAS(BP)A-mCD8{alpha}:chIg{alpha}F3 alone or was coinfected with both RCAS(BP)A-mCD8{alpha}:chIg{alpha}F3 and RCAS(BP)B-mCD8{beta}:chIg{beta} retroviruses. The F3 mutation did not affect surface expression of the chimeric protein, because the expression levels of the mCD8{alpha}:chIg{alpha}F3 mutant were comparable to those of the mCD8{alpha}:chIg{alpha} chimeric protein when expressed singly or in association with the mCD8{beta}:chIg{beta}, and cells were subsequently sorted based on surface expression of the chimeric receptors (Fig. 4A).



View larger version (34K):
[in this window]
[in a new window]
  		FIGURE 4. Ig{alpha} Y3 residue is required for full calcium mobilization. The sIg– DT40 lymphoma was infected with the retroviruses indicated, then sorted for surface expression of mCD8. A, After sorting, expression levels of the chimeric homodimer or heterodimer were determined by staining for mCD8{alpha} and mCD8{beta}. Contour plots of 10,000 events are shown. B, The sIg– DT40 sublines were loaded with Indo-1 and stimulated with anti-mCD8{alpha} (D9). Arrows indicate the addition of the cross-linking Ab.

 
Stimulation of mCD8{alpha}:chIg{alpha}F3-expressing DT40 cells with the anti-mCD8{alpha} Ab resulted in a calcium flux of markedly reduced amplitude compared with that observed after cross-linking of mCD8{alpha}:chIg{alpha}. Cross-linking the mCD8{alpha}:chIg{alpha}F3 + mCD8{beta}:chIg{beta} heterodimer with anti-mCD8{alpha} (Fig. 4B) or anti-mCD8{beta} (data not shown) initiated a similarly rapid, but reduced, calcium flux compared with that observed after cross-linking of mCD8{alpha}:chIg{alpha} + mCD8{beta}:chIg{beta}.

Cross-linking of either the mCD8{alpha}:chIg{alpha}F3 homodimer with anti-mCD8{alpha} or the mCD8{alpha}:chIg{alpha}F3 + mCD8{beta}:chIg{beta} heterodimer with anti-mCD8{beta} resulted in an increase in total protein phosphorylation (Fig. 5A). Although qualitative and quantitative differences were observed after stimulation of cells expressing mCD8{alpha}:chIg{alpha}F3 compared with those expressing mCD8{alpha}:chIg{alpha}, this, nonetheless, supports the conclusion that substantial signaling occurs downstream of the Ig{alpha} and/or Ig{beta} ITAMs.



View larger version (66K):
[in this window]
[in a new window]
  		FIGURE 5. The Ig{alpha} Y3 residue is not required for Ig{alpha}{beta} induction of BLNK phosphorylation. A, Uninfected sIg– DT40 cells and the infected sIg– DT40 sublines were left unstimulated (–) or were stimulated (+) with anti-mCD8{alpha} (D9) for 2 min. Total cell lysates were resolved by SDS-PAGE, Western blotted, and probed for tyrosine-phosphorylated proteins. The membrane was then stripped and reprobed for actin. B, After stimulation of the sIg– DT40 sublines for 2 min with the anti-mCD8{alpha} (D9) Ab, cells were lysed, and BLNK was immunoprecipitated. Immunoprecipitates were separated by SDS-PAGE and analyzed by Western blotting using the 4G10 Ab to detect phosphotyrosines. Membranes were stripped and reprobed for total BLNK. C, CD8 homodimers were immunoprecipitated with anti-mCD8{alpha} (53-6.7.2)-coupled Sepharose beads from cells stimulated with the anti-CD8{alpha} (D9) Ab Immunoprecipitates were separated by SDS-PAGE and analyzed by Western blotting for phosphotyrosines using the 4G10 Ab. CD8 heterodimers were immunoprecipitated with anti-mCD8{beta} (53-8.84)-coupled Sepharose beads from cells stimulated with the anti-CD8{alpha} (D9) Ab.

 
Given the reduction in calcium mobilization in the F3 mutants, we verified the state of BLNK phosphorylation after ligation of mCD8{alpha}:chIg{alpha}F3 either alone or in combination with mCD8{beta}:chIg{beta}. When expressed in the absence of Ig{beta}, the mCD8{alpha}:chIg{alpha}F3 protein initiated a significant increase in BLNK tyrosine phosphorylation (Fig. 5B) albeit at reduced levels (~50%, as detected by scanning densitometry) compared with mCD8{alpha}:chIg{alpha}. Moreover, when expressed in association with the cytoplasmic domain of Ig{beta}, the F3 mutation did not compromise the extent of BLNK phosphorylation compared with the wild-type Ig{alpha} domain. Specifically, scanning densitometry did not reveal significant differences between BLNK phosphorylation after cross-linking mCD8{alpha}:chIg{alpha} +mCD8{beta}:chIg{beta} and that after cross-linking mCD8{alpha}:chIg{alpha}F3 +mCD8{beta}:chIg{beta}. We can conclude, therefore, that the cytoplasmic domain of Ig{beta} can complement the Y3 to F3 mutation in the cytoplasmic domain of Ig{alpha} with respect to the level of BLNK phosphorylation, but not calcium mobilization. As a consequence, we can also conclude that the level of calcium response after receptor cross-linking is not quantitatively limited by the level of BLNK phosphorylation.

After cross-linking of either mCD8{alpha}:chIg{alpha}F3 or CD8{alpha}:chIg{alpha}F3 +mCD8{beta}:chIg{beta} with the appropriate Abs, the chimeric proteins were immunoprecipitated and probed for tyrosine phosphorylation. The mCD8{alpha}:chIg{alpha}F3 is inducibly tyrosine phosphorylated whether expressed as a homodimer or a heterodimer with mCD8{beta}:chIg{beta} (Fig. 5C). Therefore, we can conclude that that the Ig{alpha} F3 mutation does not inhibit Ig{alpha} ITAM phosphorylation. Similarly, the levels of mCD8{beta}:chIg{beta} phosphorylation indicate that the Ig{alpha} F3 mutation does not alter the capacity of mCD8{beta}:chIg{beta} to become inducibly tyrosine phosphorylated in the heterodimer.

Murine CD8{alpha}:chIg{alpha}F3 does not support B cell development

To determine whether the Y3 residue is required for Ig{alpha}-supported B cell development, chick embryos on day 3 of embryogenesis were infected with RCAS(BP)A-mCD8{alpha}:chIg{alpha}F3. As observed in neonatal chicks infected with RCAS(BP)A-mCD8{alpha}:chIg{alpha}, bursae isolated from RCAS(BP)A-mCD8{alpha}:chIg{alpha}F3-infected chicks were of normal size and cellularity and contained normal numbers of B cells identified as ChB6+. In 13 RCAS(BP)A-mCD8{alpha}:chIg{alpha}F3 chicks analyzed, 30–80% of bursal B cells expressed mCD8{alpha}:chIg{alpha}F3, which reflects a viral penetrance comparable to that observed in RCAS(BP)A-mCD8{alpha}:chIg{alpha}-infected chicks (Fig. 6A).



View larger version (30K):
[in this window]
[in a new window]
  		FIGURE 6. The Ig{alpha} Y3 residue is not required for Ig{alpha}{beta} mediated B cell development in vivo. Cell suspensions were generated from neonatal chicks that were infected on day 3 of embryogenesis with either the RCAS(BP)A-mCD8{alpha}:chIg{alpha}F3 (A) or the RCAS(BP)A-mCD8{alpha}:chIg{alpha} F3 + RCAS(BP)B-mCD8{beta}:chIg{beta} (B) retrovirus. Cell suspensions were stained for ChB6, µ, mCD8{alpha}, and mCD8{beta}. Representative contour plots of 30,000 cells are shown gated on ChB6+ cells. Numbers indicate the percentage of ChB6+ cells within the respective quadrant.

 
In the RCAS(BP)A-mCD8{alpha}:chIg{alpha}F3-infected chicks, bursal B cells expressed the mutant mCD8{alpha}:chIg{alpha} F3 chimeric protein at levels comparable to those observed on bursal cells expressing mCD8{alpha}:chIg{alpha}. However, despite the high levels of mCD8{alpha}:chIg{alpha}F3 expression, all mCD8{alpha}:chIg{alpha}F3-positive B cells coexpressed µ (Fig. 5A). Therefore, in addition to the Ig{alpha} ITAM, the Ig{alpha} Y3 residue plays a critical role in the ability of the Ig{alpha} cytoplasmic domain to support B cell development when expressed in the absence of the cytoplasmic domain of Ig{beta}.

Murine CD8{alpha}:chIg{alpha}F3 in association with mCD8{beta}:chIg{beta} supports B cell development

Having shown that the Ig{alpha} ITAM is necessary for B cell development, we assessed whether the Y3 residue is also required for B cell development in the context of heterodimer expression. Chick embryos were therefore coinfected with RCAS(BP)A-mCD8{alpha}:chIg{alpha}F3 and RCAS(BP)B-mCD8{beta}:chIg{beta}. Neonatal chicks contained a population of µ– cells, all of which expressed both mCD8{alpha} and mCD8{beta}. In 12 chicks expressing high levels of both mCD8{alpha} and mCD8{beta}, 8–35% of bursal B cells were µ–, mCD8{alpha}+ and mCD8{beta}+ (Fig. 6B). In such chicks, all µ– cells expressed both mCD8{alpha}:chIg{alpha}F3 and mCD8{beta}:chIg{beta}, confirming the previous conclusion that the expression of mCD8{alpha}:chIg{alpha}F3 alone was not sufficient to support chicken B cell development.

Therefore, the cytoplasmic domain of Ig{beta} can complement the Y3 to F3 mutation in the cytoplasmic domain of Ig{alpha} with respect to its ability to support B cell development. B cell development, therefore, requires an intact Ig{alpha} ITAM motif as well as a conserved non-Ig{alpha} ITAM tyrosine that can be provided by either the Y3 residue of Ig{alpha} or the cytoplasmic domain of Ig{beta}.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
We have used retroviral infection of chick embryos with RCAS-mCD8:chIg viruses to target the cytoplasmic domains of chicken Ig{alpha} and Ig{beta}, either independently or in combination, to the cell surface of B cell precursors in vivo. Because retroviral transduction of B cell precursors is not 100%, cells expressing the chimeric mCD8:chIg compete with cells expressing the endogenous BCR complex for oligoclonal colonization of bursal follicles. Therefore, within each individual chick the efficiency of chimeric mCD8:chIg receptors to support B cell development can be directly compared with the efficiency of the endogenous BCR complex (21).

Using this system, we have previously demonstrated that expression of the mCD8{alpha}:chIg{alpha} homodimeric receptor is sufficient to support bursal follicle colonization and B cell proliferation with an efficiency indistinguishable from that of the endogenous BCR complex. It was therefore concluded that surface expression of the cytoplasmic domain of Ig{alpha} alone, in the absence of overt ligation, is sufficient to support B cell development (21). In direct contrast, the mCD8{alpha}:chIg{beta} chimeric receptor does not support B cell development and indeed, in the absence of the cytoplasmic domain of Ig{alpha}, selectively inhibits B cell differentiation (22).

In this report we have demonstrated that the Ig{alpha} ITAM tyrosines are uniquely required for the Ig{alpha}{beta} heterodimer to support B cell development. In the absence of Ig{beta}, the Ig{alpha}F1F2 mutant failed to support B cell development. Moreover, the Ig{alpha}F1F2 mutant failed to support B cell development even when associated with the unmodified Ig{beta}. Therefore, the Ig{beta} ITAM in combination with the Ig{alpha}F1F2 cytoplasmic domain is not sufficient to activate signaling pathways required to support B cell development. These results lend additional support to the conclusion that Ig{alpha} activates distinct signaling pathways compared with Ig{beta} (2, 43, 44, 45) and that the Ig{beta} ITAM is therefore not functionally equivalent to the Ig{alpha} ITAM.

Our observation that mCD8{alpha}:chIg{alpha}F1F2 + mCD8{beta}:chIg{beta} does not support development is based on the lack of µ–mCD8{alpha}+ bursal B cells. We have previously shown that mCD8{alpha}:chIg{alpha} mediates allelic exclusion, albeit incompletely (21). Importantly, among µ–mCD8{alpha}+ B cells that also contain V(D)J rearrangements, the majority of rearrangements were out of frame. As a consequence, if mCD8{alpha}:chIg{alpha}F1F2 + mCD8{beta}:chIg{beta} failed to mediated allelic exclusion, one would also expect the majority of rearrangements to be similarly out of frame. It follows, therefore, that cells containing such rearrangements would be µ– and be revealed as a µ–mCD8{alpha}+ bursal cell population. The absence of such a population allows us to conclude that the lack of µ–mCD8{alpha}+ cells is a direct consequence of the inability of mCD8{alpha}:chIg{alpha}F1F2 + mCD8{beta}:chIg{beta} to support B cell development.

Our results are in contrast to murine in vivo studies that suggest that the Ig{alpha} ITAM is not uniquely required for B cell development. Specifically, in the Ig{alpha}FF/FF knockin mouse, in which the Ig{alpha}FF is equivalent to our mCD8{alpha}:chIg{alpha}F1F2, normal numbers of pro-, pre-, and immature B cells are observed, whereas the recirculating B cell population is only slightly reduced (46). The discrepancy between the conclusions made in mice and those made in this study in chickens may reflect a difference in BCR signaling requirements during B cell development in the mouse vs the chicken. Alternatively, it is possible that a BCR complex in which the Ig{alpha} ITAM has been compromised is less efficient than the wild-type BCR complex in supporting B cell development. If such were the case, chicken B cells expressing the mCD8{alpha}:chIg{alpha}F1F2 + mCD8{beta}:chIg{beta} chimeric heterodimer would be competed out by cells expressing the endogenous BCR complex. In contrast, in the Ig{alpha}FF/FF knockin mouse, all B cells express the mutated Ig{alpha} and as such are not subject to competition with a wild-type BCR complex.

The amplitude and duration of calcium signals discriminate between the activation of different transcription factors, such as NF-{kappa}B, NF-AT, and JNK, thereby influencing whether a cell undergoes further differentiation, proliferation, or apoptosis (47, 48). Signaling downstream of Ig{alpha} and Ig{beta} results in distinct patterns of calcium mobilization. Although Ig{alpha} induces an initial release of calcium from intracellular stores, followed by the influx of extracellular calcium, signaling downstream of Ig{beta} only initiates transient oscillatory releases of calcium from intracellular stores detected at the individual cell level (43). The mCD8{alpha}:chIg{alpha} chimera supported an influx of extracellular calcium equivalent to that seen after cross-linking of the BCR, whereas mCD8{alpha}:chIg{beta} did not initiate a calcium flux detectable at the population level (21). These observations suggest that a receptor competent to induce calcium mobilization when cross-linked in vitro may be required to support the development of chicken B cells in vivo.

Despite the fact that ligation of either mCD8{alpha}:chIg{alpha}F1F2 or mCD8{alpha}:chIg{beta} alone failed to result in detectable calcium mobilization, coexpression of mCD8{alpha}:chIg{alpha}F1F2 with mCD8{beta}:chIg{beta} resulted in a receptor complex capable of supporting a strong calcium response. The membrane-proximal events that lead to calcium mobilization remain to be fully elucidated. However, phosphorylation of the adaptor protein BLNK is required for the induction of calcium mobilization by the BCR complex (42), and the presence or the absence of BLNK phosphorylation shown in this study after cross-linking of the mCD8{alpha}:chIg{alpha}F1F2 + mCD8{beta}:chIg{beta} heterodimer or the mCD8{alpha}:chIg{alpha}F1F2 homodimer, respectively, is consistent with this requirement.

As would be expected, phosphorylation of the non-ITAM Y3 residue was not observed after cross-linking the mCD8{alpha}:chIg{alpha}F1F2 homodimer. In addition, cross-linking the mCD8{alpha}:chIg{alpha}F1F2 homodimer failed to induce BLNK phosphorylation. This is consistent with a model in which Syk recruitment to a phosphorylated ITAM induces phosphorylation of the Ig{alpha} Y3 residue, leading to the recruitment and phosphorylation of BLNK, Also consistent with this model, cross-linking the mCD8{alpha}:chIg{alpha}F1F2 + mCD8{beta}:chIg{beta} heterodimer leads to BLNK phosphorylation, and one could predict that Syk is recruited to the Ig{beta} ITAM, leading to phosphorylation of the Ig{alpha} Y3 residue initiating BLNK recruitment and phosphorylation.

However, several lines of evidence described in this study are not consistent with this simple model. Cross-linking of mCD8{alpha}:chIg{alpha}F1F2, when expressed as a heterodimer with mCD8{beta}:chIg{beta}, failed to induce Y3 phosphorylation despite high levels of Ig{beta} ITAM phosphorylation. Thus, phosphorylation of the Ig{beta} ITAM is not sufficient to support Ig{alpha} Y3 phosphorylation (Fig. 2E). Nevertheless, stimulation of DT40 cells expressing the mCD8{alpha}:chIg{alpha}F1F2 + mCD8{beta}:chIg{beta} heterodimer resulted in substantial BLNK phosphorylation and subsequent calcium mobilization. Therefore, phosphorylation of the Ig{alpha} Y3 residue is not an absolute requirement for BLNK phosphorylation and calcium mobilization. It is, therefore, likely that the Ig{alpha}{beta} heterodimer can induce BLNK phosphorylation through alternative means.

In murine Ig{alpha}, both Y204 and Y176 residues have been implicated in promoting BLNK recruitment and phosphorylation (24, 25). Although the murine Y176 residue is not conserved in the chicken, where it is replaced by glycine, the Y204 residue and sequences surrounding Y204 are highly conserved (23). Given that cross-linking of the mCD8{alpha}:chIg{alpha}F1F2 + mCD8{alpha}:chIg{beta} heterodimer on the surface of DT40 cells resulted in calcium mobilization in the absence of phosphorylation of the Ig{alpha} Y3 residue, a residue(s) within the cytoplasmic domain of the avian Ig{beta} may contribute to BLNK phosphorylation. In this regard, we demonstrate in this study that the cytoplasmic domain of Ig{beta} can independently induce BLNK phosphorylation after receptor cross-linking despite published evidence that the cytoplasmic domain of Ig{beta} cannot physically recruit BLNK. At this point it is unclear whether BLNK is directly recruited to the chimeric receptors that contain the Ig{alpha}F3 mutation. It is reasonable to expect that recruitment to the receptor is required for BLNK phosphorylation. However, given that BLNK itself associates with a wide variety of binding partners, it remains possible that BLNK recruitment to receptors containing the F3 mutation may be indirect. Under such circumstances, we would predict that BLNK could be recruited to either the Ig{alpha} cytoplasmic domain (mCD8{alpha}:chIg{alpha}F3) or the Ig{beta} cytoplasmic domain (mCD8{alpha}:chIg{alpha}F3 + mCD8{beta}:chIg{beta}), consistent with our demonstration that the mCD8{alpha}:chIg{beta} chimeric receptor mediates BLNK phosphorylation.

The inability of the mCD8{alpha}:chIg{alpha}F1F2 + mCD8{beta}:chIg{beta} heterodimer to support B cell development did not address the possibility that the Ig{alpha} Y3 residue was also required. Therefore, we assessed the requirement for the Ig{alpha} Y3 residue in B cell development. Expression of the mCD8{alpha}:chIg{alpha}F3 homodimer in chick B cell precursors did not support B cell development in the absence of endogenous µ. Thus, although expression of a receptor containing the Ig{alpha} ITAM is required to support B cell development, the Ig{alpha} ITAM by itself is not sufficient.

However, when expressed in conjunction with mCD8{beta}:chIg{beta}, the Ig{alpha} Y3 residue is not required to support B cell development. Thus, in RCAS(BP)A-mCD8{alpha}:chIg{alpha}F3 + RCAS(BP)B-mCD8{beta}:chIg{beta}-infected chicks, populations of mCD8{alpha}+/mCD8{beta}+/µ– cells were identified. Thus, a residue(s) in the cytoplasmic domain of Ig{beta} can functionally replace the Ig{alpha} Y3 residue in B cell development.

However, although the level of BLNK phosphorylation after cross-linking the mCD8{alpha}:chIg{alpha}F3 + mCD8{beta}:chIg{beta} heterodimer is markedly increased compared with that seen after cross-linking the mCD8{alpha}:chIg{alpha}F3 homodimer, the calcium flux induced by cross-linking this heterodimer was indistinguishable from that seen after ligation of the mCD8{alpha}:chIg{alpha}F3 homodimer. Therefore, although calcium mobilization requires BLNK phosphorylation, it must also be limited by signals downstream of the BCR complex distinct from the BLNK phosphorylation seen in this study.

BLNK couples BCR ligation to several distinct signaling pathways. In addition to the PLC{gamma}2a/Btk calcium pathway, BLNK interacts with the Grb2/Sos, leading to MAPK activation, and the Vav pathway, promoting the activation of the Rho family ofGTPases. Evidence indicates that this is accomplished by multiple docking sites on BLNK (42). In particular, phosphorylation on distinct sites is responsible for allowing BLNK to recruit PLC{gamma}2a and Btk. As a consequence, it is possible that after cross-linking of the mCD8{alpha}:chIg{alpha}F3 + mCD8{beta}:chIg{beta} heterodimer, although BLNK is heavily phosphorylated, it may not be phosphorylated on all residues required for efficient coupling to calcium mobilization. Nonetheless, the expression of this heterodimer is sufficient to support B cell development, suggesting that signals required for strong calcium mobilization are dispensable for B cell development in the chick embryo.

It is possible, therefore, that depending on the means by which it is recruited to the Ig{alpha}{beta} heterodimer, BLNK becomes phosphorylated on distinct tyrosine residues and as a result potentiates the activation of distinct downstream signaling pathways. Thus, in the context of the mCD8{alpha}:chIg{alpha}F3 + mCD8{beta}:chIg{beta} heterodimer, BLNK may be selectively phosphorylated, allowing coupling to pathways critical for supporting B cell development, but not efficient coupling to pathways required for strong calcium mobilization.

The difference between the signaling capacity of a receptor in vitro and its ability to support B cell development in vivo may reflect intrinsic differences between DT40 cells and primary B cells. Nevertheless, DT40, a chicken bursal B cell lymphoma, clearly shares many signaling characteristics of primary B cells, and BCR-mediated signaling in DT40 deletion mutants frequently parallels inhibited B cell development when the homologous molecule(s) is deleted in mice (3).

Through the comparison of DT40 cells and primary B cells isolated from RCAS-mCD8:chIg-infected chicks, we have shown that the ability of a receptor complex to support B cell development in vivo is independent of its ability to support strong calcium mobilization in vitro. These observations indicate that despite a crucial role for calcium mobilization in development, there is also a requirement for coupling of the Ig{alpha}{beta} heterodimer to other signaling pathways during B cell development.

We also provide data regarding the key residues required during B cell development. The Ig{alpha} ITAM is required for the Ig{alpha} cytoplasmic domain to support B cell development, either independently or in combination with the cytoplasmic domain of Ig{beta}. Such a requirement argues that the Ig{alpha} ITAM has a crucial role in the activation of critical signaling pathways distinct from those activated downstream of Ig{beta}. Nevertheless, the Ig{alpha} ITAM by itself is not sufficient to support B cell development; rather, an additional residue(s) is required to activate complimentary signaling pathways. In an apparent redundancy of function, either the Ig{alpha} Y3 residue or residues in the cytoplasmic domain of Ig{beta} are sufficient to activate such signals.


   Acknowledgments
 
We thank Gisele Knowles for expert assistance with flow cytometry, and Trista Murphy for Ab preparation. We are grateful to Dr. T. Kurosaki for providing us with the anti-chBLNK Ab, and to Dr. P. Hugo for providing the anti-CD8 Abs.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by Canadian Institutes of Health Research Grant MT10040 (to M.J.H.R.). K.A.P. was supported by the Fonds de la Recherche en Santé du Québec FRSQ-FCAR-Santé doctoral research bursary. Back

2 Address correspondence and reprint requests to Dr. Michael J. H. Ratcliffe, Department of Immunology, University of Toronto, 1 King’s College Circle, Toronto, Ontario, Canada M5S 1A8. E-mail address: michael.ratcliffe{at}utoronto.ca Back

3 Abbreviations used in this paper: sIg, surface Ig; BLNK, B cell linker protein; BP, Bryan polymerase; CEF, chicken embryo fibroblast; chIg, chicken Ig; LTR, long terminal repeat; mCD8, murine CD8; PLC{gamma}2a, phospholipase C{gamma}2a; RCAS, replication-competent avian leukosis virus with splice acceptor; Tµ, truncated Ig µ-chain. Back

Received for publication August 12, 2004. Accepted for publication November 23, 2004.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Reth, M.. 1989. Antigen receptor tail clue. Nature 338:383.[Medline]
  2. Sanchez, M., Z. Misulovin, A. L. Burkhardt, S. Mahajan, T. Costa, R. Franke, J. B. Bolen, M. Nussenzweig. 1993. Signal transduction by immunoglobulin is mediated through Ig{alpha} and Ig{beta}. J. Exp. Med. 178:1049.[Abstract/Free Full Text]
  3. Kurosaki, T.. 1999. Genetic analysis of B cell antigen receptor signaling. Annu. Rev. Immunol. 17:555.[Medline]
  4. Campbell, K. S.. 1999. Signal transduction from the B cell antigen-receptor. Curr. Opin. Immunol. 11:256.[Medline]
  5. Reichlin, A., Y. Hu, E. Meffre, H. Nagaoka, S. Gong, M. Kraus, K. Rajewsky, M. C. Nussenzweig. 2001. B cell development is arrested at the immature B cell stage in mice carrying a mutation in the cytoplasmic domain of immunoglobulin {beta}. J. Exp. Med. 193:13.
  6. Weill, J. C., C. A. Reynaud. 1987. The chicken B cell compartment. Science 238:1094.[Abstract/Free Full Text]
  7. Ratcliffe, M. J. H., E. Paramithiotis. 1990. The end can justify the means. Semin. Immunol. 2:217.[Medline]
  8. McCormack, W. T., L. W. Tjoelker, C. F. Barth, L. M. Carlson, B. Petryniak, E. H. Humphries, C. B. Thompson. 1989. Selection for B cells with productive IgL gene rearrangements occurs in the bursa of Fabricius during chicken embryonic development. Genes Dev. 3:838.[Abstract/Free Full Text]
  9. Pike, K. A., M. J. H. Ratcliffe. 2002. Cell surface immunoglobulin receptors in B cell development. Semin. Immunol. 14:351.[Medline]
  10. Paramithiotis, E., K. A. Jacobsen, M. J. H. Ratcliffe. 1995. Loss of surface immunoglobulin expression precedes B cell death by apoptosis in the bursa of Fabricius. J. Exp. Med. 181:105.[Abstract/Free Full Text]
  11. Pleiman, C. M., C. Abrams, L. T. Gauen, W. Bedzyk, J. Jongstra, A. S. Shaw, J. C. Cambier. 1994. Distinct p53/56lyn and p59fyn domains associate with nonphosphorylated and phosphorylated Ig{alpha}. Proc. Natl. Acad. Sci. USA 91:4268.[Abstract/Free Full Text]
  12. Hutchcroft, J. E., M. L. Harrison, R. L. Geahlen. 1992. Association of the 72-kDa protein-tyrosine kinase PTK72 with the B cell antigen receptor. J. Biol. Chem. 267:8613.[Abstract/Free Full Text]
  13. Sayegh, C. E., S. L. Demaries, S. Iacampo, M. J. H. Ratcliffe. 1999. Development of B cells expressing surface immunoglobulin molecules that lack V(D)J-encoded determinants in the avian embryo bursa of Fabricius. Proc. Natl. Acad. Sci. USA 96:10806.[Abstract/Free Full Text]
  14. Shaffer, A. L., M. S. Schlissel. 1997. A truncated heavy chain protein relieves the requirement for surrogate light chains in early B cell development. J. Immunol. 159:1265.[Abstract]
  15. Muljo, S. A., M. S. Schlissel. 2002. The variable, CH1, CH2 and CH3 domains of Ig heavy chain are dispensable for pre-BCR function in transgenic mice. Int. Immunol. 14:577.[Abstract/Free Full Text]
  16. Gauthier, L., B. Rossi, F. Roux, E. Termine, C. Schiff. 2002. Galectin-1 is a stromal cell ligand of the pre-B cell receptor (BCR) implicated in synapse formation between pre-B and stromal cells and in pre-BCR triggering. Proc. Natl. Acad. Sci. USA 99:13014.[Abstract/Free Full Text]
  17. Bradl, H., H. M. Jack. 2001. Surrogate light chain-mediated interaction of a soluble pre-B cell receptor with adherent cell lines. J. Immunol. 167:6403.[Abstract/Free Full Text]
  18. Ohnishi, K., F. Melchers. 2003. The nonimmunoglobulin portion of {lambda}5 mediates cell-autonomous pre-B cell receptor signaling. Nat. Immunol. 4:849.[Medline]
  19. Bradl, H., J. Wittmann, D. Milius, C. Vettermann, H. M. Jack. 2003. Interaction of murine precursor B cell receptor with stroma cells is controlled by the unique tail of {lambda}5 and stroma cell-associated heparan sulfate. J. Immunol. 171:2338.[Abstract/Free Full Text]
  20. Bannish, G., E. M. Fuentes-Panana, J. C. Cambier, W. S. Pear, J. G. Monroe. 2001. Ligand-independent signaling functions for the B lymphocyte antigen receptor and their role in positive selection during B lymphopoiesis. J. Exp. Med. 194:1583.[Abstract/Free Full Text]
  21. Pike, K. A., S. Iacampo, J. E. Friedmann, M. J. H. Ratcliffe. 2004. The cytoplasmic domain of Ig{alpha} is necessary and sufficient to support efficient early B cell development. J. Immunol. 172:2210.[Abstract/Free Full Text]
  22. Pike, K. A., E. Baig, M. J. H. Ratcliffe. 2004. The avian B-cell receptor complex: distinct roles of Ig{alpha} and Ig{beta} in B-cell development. Immunol. Rev. 197:10.[Medline]
  23. Sayegh, C. E., S. L. Demaries, K. A. Pike, J. E. Friedman, M. J. H. Ratcliffe. 2000. The chicken B-cell receptor complex and its role in avian B-cell development. Immunol. Rev. 175:187.[Medline]
  24. Kabak, S., B. J. Skaggs, M. R. Gold, M. Affolter, K. L. West, M. S. Foster, K. Siemasko, A. C. Chan, R. Aebersold, M. R. Clark. 2002. The direct recruitment of BLNK to immunoglobulin {alpha} couples the B-cell antigen receptor to distal signaling pathways. Mol. Cell. Biol. 22:2524.[Abstract/Free Full Text]
  25. Engels, N., B. Wollscheid, J. Wienands. 2001. Association of SLP-65/BLNK with the B cell antigen receptor through a non-ITAM tyrosine of Ig{alpha}. Eur. J. Immunol. 31:2126.[Medline]
  26. Hashimoto, S., A. Iwamatsu, M. Ishiai, K. Okawa, T. Yamadori, M. Matsushita, Y. Baba, T. Kishimoto, T. Kurosaki, S. Tsukada. 1999. Identification of the SH2 domain binding protein of Bruton’s tyrosine kinase as BLNK–functional significance of Btk-SH2 domain in B-cell antigen receptor-coupled calcium signaling. Blood 94:2357.[Abstract/Free Full Text]
  27. Fu, C., A. C. Chan. 1997. Identification of two tyrosine phosphoproteins, pp70 and pp68, which interact with phospholipase C{gamma}, Grb2, and Vav after B cell antigen receptor activation. J. Biol. Chem. 272:27362.[Abstract/Free Full Text]
  28. Fu, C., C. W. Turck, T. Kurosaki, A. C. Chan. 1998. BLNK: a central linker protein in B cell activation. Immunity 9:93.[Medline]
  29. Ishiai, M., M. Kurosaki, R. Pappu, K. Okawa, I. Ronko, C. Fu, M. Shibata, A. Iwamatsu, A. C. Chan, T. Kurosaki. 1999. BLNK required for coupling Syk to PLC{gamma}2 and Rac1-JNK in B cells. Immunity 10:117.[Medline]
  30. Xu, S., S. C. Wong, K. P. Lam. 2000. Cutting edge: B cell linker protein is dispensable for the allelic exclusion of immunoglobulin heavy chain locus but required for the persistence of CD5+ B cells. J. Immunol. 165:4153.[Abstract/Free Full Text]
  31. Xu, S., J. E. Tan, E. P. Wong, A. Manickam, S. Ponniah, K. P. Lam. 2000. B cell development and activation defects resulting in xid-like immunodeficiency in BLNK/SLP-65-deficient mice. Int. Immunol. 12:397.[Abstract/Free Full Text]
  32. Xu, S., K. P. Lam. 2002. Delayed cellular maturation and decreased immunoglobulin {kappa} light chain production in immature B lymphocytes lacking B cell linker protein. J. Exp. Med. 196:197.[Abstract/Free Full Text]
  33. Jumaa, H., B. Wollscheid, M. Mitterer, J. Wienands, M. Reth, P. J. Nielsen. 1999. Abnormal development and function of B lymphocytes in mice deficient for the signaling adaptor protein SLP-65. Immunity 11:547.[Medline]
  34. Baba, Y., S. Hashimoto, M. Matsushita, D. Watanabe, T. Kishimoto, T. Kurosaki, S. Tsukada. 2001. BLNK mediates Syk-dependent Btk activation. Proc. Natl. Acad. Sci. USA 98:2582.[Abstract/Free Full Text]
  35. Kurosaki, T., A. Maeda, M. Ishiai, A. Hashimoto, K. Inabe, M. Takata. 2000. Regulation of the phospholipase C-{gamma}2 pathway in B cells. Immunol. Rev. 176:19.[Medline]
  36. Takata, M., Y. Homma, T. Kurosaki. 1995. Requirement of phospholipase C-{gamma}2 activation in surface immunoglobulin M-induced B cell apoptosis. J. Exp. Med. 182:907.[Abstract/Free Full Text]
  37. Hashimoto, A., K. Takeda, M. Inaba, M. Sekimata, T. Kaisho, S. Ikehara, Y. Homma, S. Akira, T. Kurosaki. 2000. Cutting edge: essential role of phospholipase C-{gamma}2 in B cell development and function. J. Immunol. 165:1738.[Abstract/Free Full Text]
  38. Hughes, S. H., J. J. Greenhouse, C. J. Petropoulos, P. Sutrave. 1987. Adaptor plasmids simplify the insertion of foreign DNA into helper-independent retroviral vectors. J. Virol. 61:3004.[Abstract/Free Full Text]
  39. Cohen, B., M. Yoakim, H. Piwnica-Worms, T. M. Roberts, B. S. Schaffhausen. 1990. Tyrosine phosphorylation is a signal for the trafficking of pp85, an 85-kDa phosphorylated polypeptide associated with phosphatidylinositol kinase activity. Proc. Natl. Acad. Sci. USA 87:4458.[Abstract/Free Full Text]
  40. Weinands, J., O. Larbolette, M. Reth. 1996. Evidence for a preformed transducer complex organized by the B cell antigen receptor. Proc. Natl. Acad. Sci. USA 93:7865.[Abstract/Free Full Text]
  41. Ratcliffe, M. J. H., L. Tkalec. 1990. Cross-linking of the surface immunoglobulin on lymphocytes from the bursa of Fabricius results in second messenger generation. Eur. J. Immunol. 20:1073.[Medline]
  42. Chiu, C. W., M. Dalton, M. Ishiai, T. Kurosaki, A. C. Chan. 2002. BLNK: molecular scaffolding through ’cis’-mediated organization of signaling proteins. EMBO J. 21:6461.[Medline]
  43. Choquet, D., G. Ku, S. Cassard, B. Malissen, H. Korn, W. H. Fridman, C. Bonnerot. 1994. Different patterns of calcium signaling triggered through two components of the B lymphocyte antigen receptor. J. Biol. Chem. 269:6491.[Abstract/Free Full Text]
  44. Cassard, S., D. Choquet, W. H. Fridman, C. Bonnerot. 1996. Regulation of ITAM signaling by specific sequences in Ig{beta} B cell antigen receptor subunit. J. Biol. Chem. 271:23786.[Abstract/Free Full Text]
  45. Clark, M. R., K. S. Campbell, A. Kazlauskas, S. A. Johnson, M. Hertz, T. A. Potter, C. Pleiman, J. C. Cambier. 1992. The B cell antigen receptor complex: association of Ig{alpha} and Ig{beta} with distinct cytoplasmic effectors. Science 258:123.[Abstract/Free Full Text]
  46. Kraus, M., L. I. Pao, A. Reichlin, Y. Hu, B. Canono, J. C. Cambier, M. C. Nussenzweig, K. Rajewsky. 2001. Interference with immunoglobulin (Ig){alpha} immunoreceptor tyrosine-based activation motif (ITAM) phosphorylation modulates or blocks B cell development, depending on the availability of an Ig{beta} cytoplasmic tail. J. Exp. Med. 194:455.[Abstract/Free Full Text]
  47. Dolmetsch, R. E., R. S. Lewis, C. C. Goodnow, J. I. Healy. 1997. Differential activation of transcription factors induced by Ca2+ response amplitude and duration. Nature 386:855.[Medline]
  48. Healy, J. I., R. E. Dolmetsch, L. A. Timmerman, J. G. Cyster, M. L. Thomas, G. R. Crabtree, R. S. Lewis, C. C. Goodnow. 1997. Different nuclear signals are activated by the B cell receptor during positive versus negative signaling. Immunity 6:419.[Medline]



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
Y. Imamura, A. Oda, T. Katahira, K. Bundo, K. A. Pike, M. J. H. Ratcliffe, and D. Kitamura
BLNK Binds Active H-Ras to Promote B Cell Receptor-mediated Capping and ERK Activation
J. Biol. Chem., April 10, 2009; 284(15): 9804 - 9813.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
E. M. Fuentes-Panana, G. Bannish, F. G. Karnell, J. F. Treml, and J. G. Monroe
Analysis of the Individual Contributions of Ig{alpha} (CD79a)- and Igbeta (CD79b)-Mediated Tonic Signaling for Bone Marrow B Cell Development and Peripheral B Cell Maturation
J. Immunol., December 1, 2006; 177(11): 7913 - 7922.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pike, K. A.
Right arrow Articles by Ratcliffe, M. J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pike, K. A.
Right arrow Articles by Ratcliffe, M. J. H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS