|
|
||||||||
Regulates TLR-Dependent Gene Expression of IFN-
, IFN-
, IL-28, and IL-291
Department of Microbiology, National Public Health Institute, Helsinki, Finland
| Abstract |
|---|
|
|
|---|
, IFN-
, IL-28, and IL-29 expression in human macrophages. IFN-
pretreatment of macrophages was required for efficient TLR3 and TLR4 agonist-induced activation of IFN-
, IFN-
, IL-28, and IL-29 genes. TLR7/8 agonist weakly activated IFN-
, IFN-
, IL-28, and IL-29 genes, whereas TLR2 agonist was not able to activate these genes. IFN-
enhanced TLR responsiveness in macrophages by up-regulating the expression of TLR3, TLR4, and TLR7. IFN-
also enhanced the expression of TLR signaling molecules MyD88, TIR domain-containing adaptor inducing IFN-
, I
B kinase-
, receptor interacting protein 1, and IFN regulatory factor 7. Furthermore, the activation of transcription factor IFN regulatory factor 3 by TLR3 and TLR4 agonists was dependent on IFN-
pretreatment. In conclusion, our results suggest that IFN-
sensitizes cells to microbial recognition by up-regulating the expression of several TLRs as well as adapter molecules and kinases involved in TLR signaling. | Introduction |
|---|
|
|
|---|
TLR signaling is mediated by adapter proteins and protein kinases, ultimately leading to the activation of IFN regulatory factor (IRF)3 and NF-
B family of transcription factors and subsequent induction of TLR-regulated genes. The TLR signal transduction pathways are activated when the cytoplasmic Toll/IL-1 receptor (TIR) domain of TLRs recruits cytosolic TIR-domain containing adapter molecules to the receptor complex (13). Most TLRs utilize a common adaptor molecule MyD88 that mediates the activation of NF-
B and AP-1. However, TLR3 and TLR4 use other adaptor molecules as well, since their ligands induce IFN-
expression independently of MyD88 (14, 15). Recently, it was shown that TIR domain-containing adaptor inducing IFN-
(TRIF) mediates signal transduction downstream of TLR3 and TLR4 (16, 17, 18, 19). The hierarchy of TRIF-dependent signaling needs further elucidation, but it is known that TRIF mediates the activation of both IRF3 and NF-
B. TRIF associates with IRF3-activating I
B kinase-
(IKK
) and TANK-binding kinase-1 (TBK1) (20) and the disruption of these genes in mice results in defective TLR3- and TLR4-mediated IFN responses (16, 21, 22). Furthermore, TLR3/TRIF-induced NF-
B activation is dependent on receptor interacting protein (RIP) kinases (23). Ultimately, the differences in TLR signaling are reflected to differences in TLR-activated gene expression.
Here we have studied TLR2, TLR3, TLR4, TLR7/8 agonists-induced expression of IFN-
, IFN-
, and novel type I IFN homologues, IL-28 (IFN-
2/3) and IL-29 (IFN-
1) (24, 25) in human monocyte-derived macrophages. We report that TLR3 and TLR4 ligand-induced IFN-
, IFN-
, IL-28, and IL-29 gene expression in macrophages is dependent on IFN-
. Our results suggest that IFN-
-dependent responsiveness to TLR triggering is achieved by IFN-
-regulated expression of TLRs and TLR-specific signaling components.
| Materials and Methods |
|---|
|
|
|---|
Human macrophages were obtained from leukocyte-rich buffy coats from healthy blood donors (Finnish Red Cross Blood Transfusion Service, Helsinki, Finland). PBMCs were isolated from buffy coats by density gradient centrifugation using Ficoll-Paque (Amersham Pharmacia Biotech). Monocytes were allowed to adhere to plastic six-well plates (Falcon Multiwell; BD Biosciences) and differentiated into macrophages for 1 wk in macrophage serum-free medium (Invitrogen Life Technologies) supplemented with GM-CSF (10 ng/ml; Nordic Biosite), 0.6 µg/ml penicillin and 60 µg/ml streptomycin. In all experiments, cells from four different blood donors were used. Human NK-92 cell line was obtained from American Type Culture Collection (ATCC CRL-2407) and maintained in continuous culture in MEM
medium supplemented with 12% horse serum (Invitrogen Life Technologies), 12% FCS (Integro), 0.2 mM i-inositol, 20 mM folic acid, 40 mM 2-ME, 2 mM L-glutamine, antibiotics, and 100 IU/ml IL-2 (Chiron). Before stimulation, NK-92 cells were starved in IL-2-free RPMI 1640 media for 18 h. All experiments were performed three times with similar results.
Cytokines and TLR ligands
Human leukocyte IFN-
was provided by the Finnish Red Cross Blood Transfusion Service and was used at 100 IU/ml. IFN-
(Schering-Plough) was used at 100 IU/ml. TLR3 ligand poly(I:C) (Sigma-Aldrich), TLR2 ligand Pam3Cys (EMC Microcollections), TLR4 ligand LPS (Escherichia coli 0111:B4; Sigma-Aldrich) and TLR7/8 ligand R848 (InVivoGen) were used at 30 µg/ml, 100 ng/ml, 1 µg/ml and 1 µg/ml, respectively. TLR stimulations were performed in RPMI 1640 medium containing 10% FCS.
RNA isolation and Northern blot analysis
Total cellular RNA was isolated with the RNeasy kit (Qiagen) according to the manufacturers instructions. Samples containing equal amounts of RNA (10 µg) were size fractioned on 1% formaldehyde-agarose gel, transferred to a nylon membrane (Hybond; Amersham Biosciences) and hybridized with IFN-
2 (26), IFN-
(27), IL-28, IL-29, MyD88 (28), TRIF, TRIF-related adaptor molecule (TRAM), IKK
, TBK1, RIP1, IRF1 (26), IRF7, IFN-
(29), TLR3, TLR4, TLR7, or TLR8, (30) probes. Probes for IL-28, IL-29, TRIF, TRAM, IKK
, TBK1, IRF7, and RIP1 were cloned from total cellular RNA obtained from Sendai virus-infected macrophages by RT-PCR using oligonucleotides GTCTCCACAGGATCCGCAGGCCTT and CAGCCAGGGGGATCCTTTTTTGGG (IL-28), GAAGGCCAGGGATCCCTTGGAAGA and GTGTCAGGTGGATCCAGGGTGGGT (IL-29), GAACAGGGATCCTATAACTTTGTGATCCTC and GTGGGGGGATCCGGTGTTGGCCACCTTCCT (TRIF), GGGCAAAGGGGATCCTTTCTCGGGGAA and GCACAGTGTGGATCCAAGTCCAGGATA (TRAM), TCAGACGGATCCAGGTGCTGGGACTCTAT and TACATGGGATCCGAAGCATCCAGCAGA (IKK
), ATTGCAGGATCCGATTTACTATCAGTTC and CTAAAGGGATCCAACGTTGCGAAGGCCAC (TBK1), ATGATGGTCGGATCCAGCGCCCCTGGG and GCTCAGGCGGGATCCGTGCTGGCGAGA (IRF7), and AAAGAAAGAGGATCCAAACGAAAA and GCTGTTCCTGGATCCAGTGGTCTT (RIP1). To ensure equal RNA loading,
-actin mRNA expression was analyzed. The probes were labeled with [
-32P]dATP (3000 Ci/mmol; Amersham Biosciences) using a random primed DNA labeling kit (Boehringer Mannheim). The membranes were hybridized (Ultrahyb; Ambion) and washed in 1x SSC/0.1% SDS and exposed to Kodak AR X-omat films at 70°C using intensifying screens.
Western blot analysis
Equal amounts of proteins were separated on SDS-PAGE with the Laemmli buffer system and transferred onto Immobilon-P membranes (Millipore). The membranes were blocked with PBS containing 5% nonfat milk and were stained with anti-TBK1 (SC-9085; Santa Cruz Biotechnology), anti-IKK
(SC-9913), or anti-RIP1 (SC-7881) Abs followed by staining with peroxidase conjugated anti-rabbit or anti-goat IgG (DakoCytomation) and visualization with the ECL system (Amersham Biosciences).
Oligonucleotide DNA precipitation
Equal amounts of cells (1 x 107/sample) were harvested and nuclear extracts were prepared by lysing the cells in buffer containing 10 mM HEPES-KOH, 10 mM KCl, 1.5 mM MgCl2, 0.5 mM DTT, 1 mM Na3VO4, and a protease inhibitor mixture (Complete; Roche). The remaining nuclei were lysed in 10 mM HEPES, 400 mM KCl, 10% glycerol, 2 mM EDTA, 1 mM EGTA, 0.01% Triton X-100, 0.5 mM DTT, 1 mM Na3VO4, and a protease inhibitor mixture. DNA binding proteins were incubated for 2 h with streptavidin-agarose beads (Pierce) coupled to 5'-biotinylated oligonucleotides: IFN-
14 positive regulatory domain (PRD)-like (GGATCCGGAAAGCCAAAAGAGAAGTAGAAAAAAA), IFN-
PRDI-III (GGATCCCACTTTCACTTCTCCCTTTCAGTTTTC), and IFN-
PRDII (GGATCCGGAATTTCCCGGAATTTCCC) (31, 32) (DNA Technology). The binding reactions were performed for 2 h at +4°C in binding buffer (10 mM HEPES, 133 mM KCl, 10% glycerol, 2 mM EDTA, 1 mM EGTA, 0.01% Triton X-100, 0.5 mM DTT, 1 mM Na3VO4, and a protease inhibitor mixture) followed by washing the unbound proteins with binding buffer. The oligonucleotide-bound proteins were released in SDS sample buffer, separated on SDS-PAGE, and transferred onto Immobilon-P membranes (Millipore). The proteins were visualized with the ECL system by using guinea pig anti-IRF-3 (IFN-
PRDI-III precipitated), anti-IRF1, anti-IRF7 (IFN-
14 PRD-like precipitated), or rabbit anti-p50 (SC-7178; Santa Cruz Biotechnology), anti-p65 (SC-372), anti-c-rel (SC-70), anti-RelB (SC-226) (IFN-
PRDII precipitated) Abs and peroxidase conjugated goat anti-rabbit or anti-guinea pig IgG (DakoCytomation). Guinea pig anti-IRF-1 Abs have been previously described (33). Anti-IRF3 and anti-IRF7 were prepared in guinea pigs by immunizing the animals four times at 4-wk intervals with preparative SDS-PAGE (BioRad) purified baculovirus-expressed proteins (20 µg per immunization).
Biological IFN-
assay
Cell culture supernatants were treated at pH 2, and IFN-
titer was measured in HEp2 cells by vesicular stomatitis virus plaque reduction assay as previously described (34). The results are shown as international units per milliliter, using IFN-
preparation as a standard.
| Results |
|---|
|
|
|---|
pretreatment enhances TLR- and virus-induced IFN gene expression
Type I IFNs are an essential factor in the activation of multiple genes during viral infections. TLR2, TLR3, TLR4, TLR7, TLR8, and TLR9 are associated with virus-induced immune response and antiviral immunity (35). Hence, we determined IFN-
, IFN-
, IL-28, and IL-29 mRNA expression in macrophages stimulated with TLR2, TLR3, TLR4, or TLR7/8 ligands Pam3Cys, poly(I:C), LPS, or R848, respectively. TLR9 ligand was not included in our studies since TLR9 gene was not found to be expressed in macrophages (data not shown). As shown in Fig. 1, IFN-
pretreatment of macrophages was required for efficient TLR3 and TLR4 ligand-induced IFN-
, IFN-
, IL-28, and IL-29 mRNA expression. TLR7/8 stimulation resulted in a weak induction of IFN genes in IFN-
-pretreated macrophages, whereas TLR2 ligand was not able to induce IFN mRNA expression, regardless of IFN-
pretreatment. These results demonstrate that TLR2, TLR3, TLR4, and TLR7/8 differ in their ability to induce IFN-
, IFN-
, IL-28, and IL-29 gene expression in human macrophages. Furthermore, IFN-
pretreatment was required for the TLR-actived expression of these genes.
|
positively regulated TLR-mediated IFN production in human macrophages, we determined whether virus-induced IFN production was also enhanced by IFN-
pretreatment (Fig. 2). Both influenza A and Sendai virus-infected human macrophages are known to produce type I IFNs (36, 37). Sendai virus activated high IFN-
, IFN-
, IL-28, and IL-29 mRNA expression in macrophages, which was further enhanced by IFN-
pretreatment. Densitometric scanning with image analysis software (Kodak Digital Science) showed that IFN-
enhances Sendai virus-induced IFN gene expression in macrophages by
2-fold. Similar to TLR3 ligand, influenza A virus-induced IFN-
, IFN-
, IL-28, and IL-29 gene expression was strongly enhanced by IFN-
pretreatment (Fig. 2).
|
enhances expression of TLRs and TLR signaling molecules
TLR signaling leads to the activation of NF-
B and IRF families of transcription factors. To date, five potential TIR domain-containing TLR adaptor molecules have been identified (38). Since IFN-
enhanced TLR-activated IFN production in macrophages, we studied whether IFN-
affected the expression of TLRs and TLR signaling molecules. TLR3, TLR4, and TLR7 mRNA expression was clearly enhanced by IFN-
(Fig. 3). This confirms our previous observations that IFN-
regulates TLR gene expression in macrophages (30). IFN-
also up-regulated mRNA expression of MyD88, a common adaptor molecule associated with TLR signaling (Fig. 4A). However, TLR3 and TLR4 signal MyD88-independently via another adaptor molecule TRIF, leading to the activation of IRF3 and NF-
B (16, 17, 19). TRIF mRNA expression was up-regulated in macrophages by IFN-
. TRIF mediates TLR4-specific, MyD88-independent gene expression with TRAM (18, 39). TRAM gene expression was not affected by IFN-
.
|
|
(20, 40). Since the activation of IRF family of transcription factors is essential for IFN-
and IFN-
production, we analyzed the expression of IRFs, TBK1 and IKK
in macrophages. TBK1 and IKK
are basally expressed in macrophages (Fig. 4, A and B). IKK
mRNA and protein expression was clearly up-regulated in response to IFN-
stimulation, whereas only a modest increase in TBK1 mRNA and protein expression was observed. IFN-
does not affect IRF3 gene expression (41), whereas IRF1 and IRF7 gene expression was activated by IFN-
treatment (Fig. 4A). RIP1 is a TLR3/TRIF-specific mediator of NF-
B activation (23). RIP1 mRNA and protein expression was also strongly enhanced by IFN-
(Fig. 4, A and B). We conclude that besides stimulating the expression of TLR3 and TLR4, IFN-
regulates TLR-mediated gene activation in macrophages by enhancing the expression of TLR3- and TLR4-specific signaling molecules.
TLR ligand-induced IRF and NF-
B activation
To gain more insight into TLR3-, TLR4-, TLR7-, and TLR8-regulated IFN induction in human macrophages, we studied the activation of the IRF family of transcription factors in TLR3, TLR4, and TLR7/8 ligand-stimulated macrophages. Nuclear extracts from TLR ligand-stimulated cells were precipitated with oligonucleotides containing an IRF binding site from IFN-
or IFN-
genes. Oligonucleotide-bound transcription factors were analyzed by Western blotting (Fig. 5A). Basal IRF3 DNA binding to IFN-
promoter PRDI-PRDIII region was detected in untreated macrophages. Both TLR3 and TLR4 ligands induced the phosphorylation of IRF3, and this phosphorylation was clearly higher in TLR3/4-stimulated cells that were pretreated with IFN-
. No IRF7 DNA binding to IFN-
14 PRD-like element was observed in untreated macrophages. However, enhanced IRF7 DNA binding was detected in IFN-
pretreated cells, and this binding was clearly increased by TLR3 and TLR4 stimulation. IRF1 DNA binding to IFN-
14 PRD-like element was also activated by TLR3 and TLR4 ligands. As in the case of IRF7, clearly stronger binding of IRF1 was observed in cells pretreated with IFN-
. Interestingly, TLR7/8 ligand R848 activated IRF1 DNA binding to IFN-
14 PRD-like element, but no significant IRF3 phosphorylation or IRF7 DNA binding was seen. In contrast, R848 weakly inhibited IRF3 and IFN-
-induced IRF7 DNA binding.
|
B transcription factors regulate type I IFN gene expression. We studied the effect of TLR stimulation to NF-
B DNA binding activity with oligonucleotide immunoprecipitation method. TLR3, TLR4, and TLR7/8 ligands enhanced p50, p65, c-rel, and RelB DNA binding to IFN-
promoter PRDII element (Fig. 5B). IFN-
pretreatment as such enhanced the DNA binding of NF-
B p65 protein. TLR3 ligand-induced p65 DNA binding was clearly enhanced in IFN-
-pretreated cells. In conclusion, our results show that especially TLR3 ligand-induced IRF3 and NF-
B activation and TLR4 ligand-induced IRF3 activation were enhanced in IFN-
-pretreated cells.
Cell culture supernatants from TLR3, TLR4, and TLR7/8 ligand-stimulated macrophages have antiviral and IFN-
-inducing activity
IFN-
has been shown to induce IFN-
production from NK and T cells (37, 42, 43). We determined the IFN-
-inducing activity of cell culture supernatants from TLR ligand-stimulated macrophages. Macrophages were stimulated with TLR2, TLR3, TLR4, and TLR7/8 ligands for 20 h, after which the macrophage cell culture supernatants were collected and subjected onto NK-92 cells. After 3 h of stimulation with macrophage supernatants, NK-92 cells were harvested and their IFN-
mRNA expression was analyzed by Northern blotting (Fig. 6A). Supernatants from TLR3 and TLR4 ligand-stimulated macrophages induced IFN-
gene expression in NK-92 cells only when macrophages had been pretreated with IFN-
. This demonstrates the importance of IFN-
in sensitizing the macrophages for TLR3 and TLR4 signaling.
|
pretreatment was absolutely required for TLR3 and TLR4 ligand-induced antiviral activity (Fig. 6B). Supernatants from TLR2 ligand-treated macrophages had neither antiviral nor IFN-
inducing activity. These results correlate well with IFN-
, IFN-
, IL-28, and IL-29 mRNA expression patterns presented in Fig. 1. Cell culture supernatants from TLR7/8 ligand-stimulated macrophages had both antiviral and IFN-
-inducing activity (Fig. 6, A and B). Thus, despite hardly detectable IFN-
, IFN-
, IL-28, and IL-29 mRNA expression by Northern blotting (Fig. 1), TLR7/8 triggering as such enhances the production of antiviral cytokines in macrophages. | Discussion |
|---|
|
|
|---|
2/3 and IFN-
1, respectively), posses antiviral activity and their production is induced by viral infection in several cell types (24, 25, 44). There is evidence that virus infection-induced cytokine production is mediated throught TLRs (45). In this report we have examined the involvement of TLRs in IFN gene expression, by using agonists for those TLRs, that have been associated with RNA virus infections. We show that these TLRs selectively mediate IFN gene expression in human monocyte-derived primary macrophages. In addition, we provide evidence that IFN-
sensitizes the cells to microbial stimulation by up-regulating the expression of TLRs and various adaptor molecules and kinases involved in TLR signaling.
It has been well established that several IFN-
genes are regulated by a positive feedback mechanism by type I IFN-induced IRF7 during virus infection (46). In addition, type I IFNs are essential for TLR3- and TLR4-induced gene activation (14, 47, 48, 49, 50). In our study, TLR3 and TLR4 ligand-induced IFN-
and IFN-
gene expression was strongly enhanced by IFN-
pretreatment of macrophages. Similarly, IL-28 and IL-29 expression was induced by TLR3 and TLR4 stimulation and their expression, too, was dramatically enhanced when macrophages were pretreated with IFN-
. Thus, the positive feedback loop associated with IFN-
and IFN-
induction (51, 52, 53) is also involved in the regulation of IL-28 and IL-29 gene expression. TLR7/8 ligand induced a weak expression of IFN-
, IFN-
, IL-28, and IL-29 genes in IFN-
-pretreated macrophages whereas TLR2 ligand was completely unable to activate these genes. In conclusion, our results suggest that IL-28 and IL-29 genes are regulated in similar fashion as IFN-
and IFN-
genes.
TLR signal transduction is regulated by adaptor proteins acting downstream of TLRs, resulting in the activation of NF-
B and IRF family of transcription factors (13). TLR3 and TLR4 are unique among TLRs since they are capable of mediating MyD88-independent NF-
B and IRF3 activation via TRIF (16, 17, 18). Both MyD88 and TRIF expression in human macrophages was enhanced by IFN-
(Fig. 4). In addition to our previously described activation of TLR3 gene expression (30), IFN-
up-regulated expression of TLR4 in macrophages. Therefore, the essential components involved in TLR3- and TLR4-mediated intracellular signaling pathways are up-regulated by IFN-
, giving a putative molecular explanation for the enhanced responsiveness of macrophages to TLR3 and TLR4 triggering after IFN-
stimulation.
Type I IFN gene expression is tightly regulated by transcription factors belonging to the NF-
B and IRF families. Upon appropriate signals, IRF3 and NF-
B are activated and transported into the nucleus where they regulate IFN-
and IFN-
gene expression. The first wave of IFN-
and/or IFN-
produced stimulates IRF7 expression, which activates the expression of most IFN-
subtype genes (51, 52, 53). Thus, IRF7 is considered to be one of the key regulators of type I IFN production. Our knowledge of molecular mechanisms that regulate virus infection-induced or TLR-mediated activation of IRF3 and IRF7 was greatly improved when TBK1 and IKK
were identified to be IRF3- and IRF7-activating kinases (20, 40). In addition, it was recently shown that a serine-threonine kinase, RIP1, mediates TLR3/TRIF-specific NF-
B activation (23). In macrophages IKK
and especially RIP1 mRNA and protein expressions were clearly enhanced by IFN-
stimulation. Up-regulation of RIP1 and IKK
expression is likely to contribute to enhanced NF-
B and IRF3 activation, respectively, which we observed after TLR3 stimulation in IFN-
-pretreated macrophages. RIP1 is specifically involved in TLR3/TRIF signaling pathway and, therefore, it is conceivable that the observed up-regulation of RIP1 gene expression by IFN-
does not affect TLR4 ligand-induced NF-
B activation. However, IFN-
pretreatment strongly enhanced TLR4 ligand-induced IRF3 activation and this likely explains the increased IFN-
gene expression in these cells.
TLR7 and TLR8 recognize viral ssRNA (10, 11, 12) and, therefore, they can be considered as crucial receptors recognizing the genetic material of RNA viruses. TLR7/8-specific ligand, R848 induces IFN-
or IL-12 production in human myeloid or plasmacytoid DCs, respectively (54). This demonstrates that TLR7 and TLR8 mediate their effects in a cell type-specific manner. Although R848 did not stimulate significant IFN-
1, IFN-
2, IFN-
4, IFN-
, IFN-
, IL-28, or IL-29 mRNA expression in macrophages (Fig. 1 and data not shown), it was able to induce type I IFN-like antiviral activity especially in cells that were pretreated with IFN-
. This suggests that TLR7/8 ligand-induced gene expression in human macrophages should be by DNA microarray analysis.
In addition to IFNs, TLR triggering induces the production of a variety of chemotactic and immunomodulatory cytokines that regulate the activation of immune cells. IFN-
is essential for the development of Th1 type immune response. Cell culture supernatants from TLR3 or TLR4 ligand-stimulated macrophages induced IFN-
gene expression in NK cells only when macrophages were pretreated with IFN-
(Fig. 6). These results suggest that IFN-
may significantly contribute to TLR-induced development of Th1 immune response.
In this report we demonstrated that TLRs involved in the recognition of different viral components differentially activate antiviral response in human monocyte-derived macrophages. In addition, our results demonstrate the crucial role of IFN-
in enhancing the innate immune sensing.
| Acknowledgments |
|---|
| Footnotes |
|---|
1 This work was supported by the Medical Research Council of the Academy of Finland, The Sigrid Juselius foundation, and the Finnish Cancer Foundation. ![]()
2 Address correspondence and reprint requests to Dr. Jukka Sirén, Department of Microbiology, National Public Health Institute, Mannerheimintie 166, FI-00300 Helsinki, Finland. E-mail address: jukka.siren{at}ktl.fi ![]()
3 Abbreviations used in this paper: IRF, IFN regulatory factor; IKK
, I
B kinase-
; RIP, receptor interacting protein; TBK1, TANK-binding kinase-1; TRAM, TRIF-related adaptor molecule; TRIF, TIR domain-containing adaptor inducing IFN-
; TIR, Toll/IL-1 receptor; PRD, positive regulatory domain. ![]()
Received for publication July 15, 2004. Accepted for publication November 8, 2004.
| References |
|---|
|
|
|---|
B by Toll-like receptor 3. Nature 413:732.[Medline]
-induced STAT1
/
-dependent gene expression in macrophages. Nat. Immunol. 3:392.[Medline]
promoter in the Toll-like receptor signaling. J. Immunol. 169:6668.
B involves the Toll adapters TRAM and TRIF. J. Exp. Med. 198:1043.
induction. Nat. Immunol. 4:161.[Medline]
and TBK1 are essential components of the IRF3 signaling pathway. Nat. Immunol. 4:491.[Medline]
B kinase-related kinases in lipopolysaccharide and double stranded RNA signaling and viral infection. J. Exp. Med. 199:1641.
B activation. Nat. Immunol. 5:503.[Medline]
s mediate antiviral protection through a distinct class II cytokine receptor complex. Nat. Immunol. 4:69.[Medline]
, IFN-
, MxA, and IFN regulatory factor 1 genes in influenza A virus-infected human peripheral blood mononuclear cells. J. Immunol. 154:2764.[Abstract]
/
, MxA, 2',5'-oligoadenylate synthetase, and HLA gene expression in influenza A-infected human lung epithelial cells. J. Immunol. 158:2363.[Abstract]
. Biochem. J. 303:831.
/
interferon genes by interferon regulatory factors 3 and 7. Mol. Cell Biol. 20:6342.
interferon promoter: modulation of transcription by NF-
B/rel proteins and interferon regulatory factors. J. Virol. 68:4707.
in uninduced human leukocyte suspensions. J. Interferon Res. 11:231.[Medline]
and IL-18 production in human macrophages by a caspase-1-dependent pathway. J. Immunol. 162:7322.
/
and IL-18 synergistically enhance IFN-
gene expression in human T cells. J. Immunol. 160:6032.
and IL-18 synergistically enhance IFN-
production in human NK cells: differential regulation of Stat4 activation and IFN-
gene expression by IFN-
and IL-12. Eur. J. Immunol. 31:2236.[Medline]
interferons in human plasmacytoid and monocyte-derived dendritic cells. Eur. J. Immunol. 34:796.[Medline]
/
signaling to the maturation of dendritic cells induced by double-stranded RNA or viral infection. Proc. Natl. Acad. Sci. USA 100:10872.
genes by positive feedback through interferon regulatory factor-7. EMBO J. 17:6660.[Medline]
/
gene induction. Immunity 13:539.[Medline]
and interleukin-12 are induced differentially by Toll-like receptor 7 ligands in human blood dendritic cell subsets. J. Exp. Med. 195:1507.This article has been cited by other articles:
![]() |
M. M. Petzke, A. Brooks, M. A. Krupna, D. Mordue, and I. Schwartz Recognition of Borrelia burgdorferi, the Lyme Disease Spirochete, by TLR7 and TLR9 Induces a Type I IFN Response by Human Immune Cells J. Immunol., October 15, 2009; 183(8): 5279 - 5292. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Li, X. Liu, Y. Zhou, and S. B. Su Interferon-{lambda}s: the modulators of antivirus, antitumor, and immune responses J. Leukoc. Biol., July 1, 2009; 86(1): 23 - 32. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Romieu-Mourez, M. Francois, M.-N. Boivin, M. Bouchentouf, D. E. Spaner, and J. Galipeau Cytokine Modulation of TLR Expression and Activation in Mesenchymal Stromal Cells Leads to a Proinflammatory Phenotype J. Immunol., June 15, 2009; 182(12): 7963 - 7973. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Richez, K. Yasuda, A. A. Watkins, S. Akira, R. Lafyatis, J. M. van Seventer, and I. R. Rifkin TLR4 Ligands Induce IFN-{alpha} Production by Mouse Conventional Dendritic Cells and Human Monocytes after IFN-{beta} Priming J. Immunol., January 15, 2009; 182(2): 820 - 828. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Y. Lee, Y. Kumagai, Y. Li, O. Takeuchi, H. Yoshida, J. Weinstein, E. S. Kellner, D. Nacionales, T. Barker, K. Kelly-Scumpia, et al. TLR7-dependent and Fc{gamma}R-independent production of type I interferon in experimental mouse lupus J. Exp. Med., December 22, 2008; 205(13): 2995 - 3006. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. N. Henning, A. K. Azad, K. V. L. Parsa, J. E. Crowther, S. Tridandapani, and L. S. Schlesinger Pulmonary Surfactant Protein A Regulates TLR Expression and Activity in Human Macrophages J. Immunol., June 15, 2008; 180(12): 7847 - 7858. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Wolk, K. Witte, E. Witte, S. Proesch, G. Schulze-Tanzil, K. Nasilowska, J. Thilo, K. Asadullah, W. Sterry, H.-D. Volk, et al. Maturing dendritic cells are an important source of IL-29 and IL-20 that may cooperatively increase the innate immunity of keratinocytes J. Leukoc. Biol., May 1, 2008; 83(5): 1181 - 1193. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ank, M. B. Iversen, C. Bartholdy, P. Staeheli, R. Hartmann, U. B. Jensen, F. Dagnaes-Hansen, A. R. Thomsen, Z. Chen, H. Haugen, et al. An Important Role for Type III Interferon (IFN-{lambda}/IL-28) in TLR-Induced Antiviral Activity J. Immunol., February 15, 2008; 180(4): 2474 - 2485. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sillanpaa, P. Kaukinen, K. Melen, and I. Julkunen Hepatitis C virus proteins interfere with the activation of chemokine gene promoters and downregulate chemokine gene expression J. Gen. Virol., February 1, 2008; 89(2): 432 - 443. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pirhonen, J. Siren, I. Julkunen, and S. Matikainen IFN-{alpha} regulates Toll-like receptor-mediated IL-27 gene expression in human macrophages J. Leukoc. Biol., November 1, 2007; 82(5): 1185 - 1192. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Niessner, M. S. Shin, O. Pryshchep, J. J. Goronzy, E. L. Chaikof, and C. M. Weyand Synergistic Proinflammatory Effects of the Antiviral Cytokine Interferon-{alpha} and Toll-Like Receptor 4 Ligands in the Atherosclerotic Plaque Circulation, October 30, 2007; 116(18): 2043 - 2052. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. I. Osterlund, T. E. Pietila, V. Veckman, S. V. Kotenko, and I. Julkunen IFN Regulatory Factor Family Members Differentially Regulate the Expression of Type III IFN (IFN-{lambda}) Genes J. Immunol., September 15, 2007; 179(6): 3434 - 3442. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Bell, P. A. Svingen, M. K. Rahman, Y. Xiong, and W. A. Faubion Jr. Forkhead Box P3 Regulates TLR10 Expression in Human T Regulatory Cells J. Immunol., August 1, 2007; 179(3): 1893 - 1900. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Severa, M. E. Remoli, E. Giacomini, V. Annibali, V. Gafa, R. Lande, M. Tomai, M. Salvetti, and E. M. Coccia Sensitization to TLR7 Agonist in IFN-beta-Preactivated Dendritic Cells J. Immunol., May 15, 2007; 178(10): 6208 - 6216. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Weighardt, S. Kaiser-Moore, S. Schlautkotter, T. Rossmann-Bloeck, U. Schleicher, C. Bogdan, and B. Holzmann Type I IFN Modulates Host Defense and Late Hyperinflammation in Septic Peritonitis J. Immunol., October 15, 2006; 177(8): 5623 - 5630. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. N. Sharif, D. Sosic, C. V. Rothlin, E. Kelly, G. Lemke, E. N. Olson, and L. B. Ivashkiv Twist mediates suppression of inflammation by type I IFNs and Axl J. Exp. Med., August 7, 2006; 203(8): 1891 - 1901. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sato, M. Ohtsuki, M. Hata, E. Kobayashi, and T. Murakami Antitumor Activity of IFN-{lambda} in Murine Tumor Models. J. Immunol., June 15, 2006; 176(12): 7686 - 7694. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Cermelli, V. Cenacchi, F. Beretti, F. Pezzini, D. D. Luca, and E. Blasi Human herpesvirus-6 dysregulates monocyte-mediated anticryptococcal defences J. Med. Microbiol., June 1, 2006; 55(6): 695 - 702. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Strengell, A. Lehtonen, S. Matikainen, and I. Julkunen IL-21 enhances SOCS gene expression and inhibits LPS-induced cytokine production in human monocyte-derived dendritic cells J. Leukoc. Biol., June 1, 2006; 79(6): 1279 - 1285. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Eriksson, S. K. Meadows, S. Basu, T. F. Mselle, C. R. Wira, and C. L. Sentman TLRs Mediate IFN-{gamma} Production by Human Uterine NK Cells in Endometrium J. Immunol., May 15, 2006; 176(10): 6219 - 6224. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ank, H. West, C. Bartholdy, K. Eriksson, A. R. Thomsen, and S. R. Paludan Lambda Interferon (IFN-{lambda}), a Type III IFN, Is Induced by Viruses and IFNs and Displays Potent Antiviral Activity against Select Virus Infections In Vivo J. Virol., May 1, 2006; 80(9): 4501 - 4509. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Melchjorsen, J. Siren, I. Julkunen, S. R. Paludan, and S. Matikainen Induction of cytokine expression by herpes simplex virus in human monocyte-derived macrophages and dendritic cells is dependent on virus replication and is counteracted by ICP27 targeting NF-{kappa}B and IRF-3. J. Gen. Virol., May 1, 2006; 87(Pt 5): 1099 - 1108. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Matikainen, J. Siren, J. Tissari, V. Veckman, J. Pirhonen, M. Severa, Q. Sun, R. Lin, S. Meri, G. Uze, et al. Tumor Necrosis Factor Alpha Enhances Influenza A Virus-Induced Expression of Antiviral Cytokines by Activating RIG-I Gene Expression. J. Virol., April 1, 2006; 80(7): 3515 - 3522. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ziegler, S. Matikainen, E. Ronkko, P. Osterlund, M. Sillanpaa, J. Siren, R. Fagerlund, M. Immonen, K. Melen, and I. Julkunen Severe Acute Respiratory Syndrome Coronavirus Fails To Activate Cytokine-Mediated Innate Immune Responses in Cultured Human Monocyte-Derived Dendritic Cells J. Virol., November 1, 2005; 79(21): 13800 - 13805. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Melchjorsen, S. B. Jensen, L. Malmgaard, S. B. Rasmussen, F. Weber, A. G. Bowie, S. Matikainen, and S. R. Paludan Activation of Innate Defense against a Paramyxovirus Is Mediated by RIG-I and TLR7 and TLR8 in a Cell-Type-Specific Manner J. Virol., October 15, 2005; 79(20): 12944 - 12951. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Osterlund, V. Veckman, J. Siren, K. M. Klucher, J. Hiscott, S. Matikainen, and I. Julkunen Gene Expression and Antiviral Activity of Alpha/Beta Interferons and Interleukin-29 in Virus-Infected Human Myeloid Dendritic Cells J. Virol., August 1, 2005; 79(15): 9608 - 9617. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |