The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cataisson, C.
Right arrow Articles by Yuspa, S. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cataisson, C.
Right arrow Articles by Yuspa, S. H.
The Journal of Immunology, 2005, 174: 1686-1692.
Copyright © 2005 by The American Association of Immunologists

Protein Kinase C{alpha}-Mediated Chemotaxis of Neutrophils Requires NF-{kappa}B Activity but Is Independent of TNF{alpha} Signaling in Mouse Skin In Vivo1

Christophe Cataisson*, Andrea J. Pearson*, Sara Torgerson*, Sergei A. Nedospasov{dagger} and Stuart H. Yuspa2,*

* Laboratory of Cellular Carcinogenesis and Tumor Promotion, Center for Cancer Research, National Cancer Institute, Bethesda, MD 20892; and {dagger} Basic Research Program, SAIC-Frederick and Laboratory of Molecular Immunoregulation, Center for Cancer Research, National Cancer Institute, Frederick, MD 21702


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Protein kinase C (PKC) isoforms are major regulators of cutaneous homeostasis and mediate inflammation in response to 12-O-tetradecanoylphorbol-13-acetate (TPA). We have previously reported that transgenic mice overexpressing PKC{alpha} in the skin exhibit severe intraepidermal neutrophilic inflammation and keratinocyte apoptosis when treated topically with TPA. Activation of PKC{alpha} increases the production of TNF{alpha} and the transcription of chemotactic factors (MIP-2, KC, S100A8/A9), vascular endothelial growth factor, and GM-CSF in K5-PKC{alpha} keratinocytes. In response to PKC{alpha} activation, NF-{kappa}B translocates to the nucleus and this is associated with I{kappa}B phosphorylation and degradation. Preventing I{kappa}B degradation reduces both the expression of inflammation-associated genes and chemoattractant release. To determine whether TNF{alpha} mediated NF-{kappa}B translocation and subsequent expression of proinflammatory factors, K5-PKC{alpha} mice were treated systemically with a dimeric soluble form of p75 TNFR (etanercept) or crossed with mice deficient for both TNFR isoforms, and keratinocytes were cultured in the presence of TNF{alpha}-neutralizing Abs. The in vivo treatment and TNFR deficiency did not prevent inflammation, and the in vitro treatment did not prevent NF-{kappa}B nuclear translocation after TPA. Together these results implicate PKC{alpha} as a regulator of a subset of cutaneous cytokines and chemokines responsible for intraepidermal inflammation independent of TNF{alpha}. PKC{alpha} inhibition may have therapeutic benefit in some human inflammatory skin disorders.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Many of the common skin diseases have an inflammatory basis. Such conditions includes psoriasis, allergic contact dermatitis, and atopic dermatitis (1). Although rarely life-threatening, psoriasis and atopic dermatitis have significant morbidity including profound effects on the quality of life. Overall, inflammatory skin diseases have a significant socioeconomic impact (2).

Skin represents the body’s largest immune organ; the role of skin’s dendritic cells, infiltrating T cells, and granulocytes on immune surveillance is well established (3, 4). Interestingly, keratinocytes are also major contributors to local and systemic cytokines (reviewed in Ref5) but have received less attention in the field of classical immunology.

We have previously demonstrated that transgenic mice that overexpress protein kinase C{alpha} (PKC{alpha})3 in basal keratinocytes exhibit an acute inflammatory response when mice were painted with the PKC activator 12-O-tetradecanoyl-phorbol-13-acetate (TPA) (6). The cutaneous inflammation was characterized by intraepidermal neutrophilic microabcesses that became confluent and trapped beneath the statum corneum; this particular inflammation has not been described for transgenic mice with other PKC isoforms targeted to the epidermis (7, 8, 9). We have also reported that the intraepidermal inflammatory response in skin-targeted PKC{alpha} mice is independent of the AP-1 transcription factor pathway, although that pathway is a known target of PKC activation (6).

NF-{kappa}B transcriptional response plays an important part in cutaneous inflammation and is a crucial element of innate immunity (3). NF-{kappa}B is composed of hetero- or homodimers of five related members in mammals: Rel (c-Rel), RelA (p65), RelB, NF-{kappa}B1 (p50 and its precursor p105), NF-{kappa}B2 (p52 and its precursor p100) (10). In resting cells, most NF-{kappa}B dimers are bound to I{kappa}Bs and retained in the cytoplasm. The I{kappa}Bs are also members of a gene family of which the most common are I{kappa}B{alpha}, I{kappa}B{beta}, and I{kappa}B{epsilon}. In response to stimuli, such as TNF{alpha}, IL-1, or LPS, the I{kappa}B kinase (IKK) complex (IKK{alpha}, IKK{beta}, IKK{gamma}/NF-{kappa}B essential modulator) is activated and phosphorylates I{kappa}B, leading to its polyubiquitination and degradation. The NF-{kappa}B dimer is now free to enter the nucleus and regulate transcription (11). Involvement of the NF-{kappa}B transcription factors in skin physiology has been defined using gain or loss of functions studies in mice. Transgenic models have demonstrated a critical role for NF-{kappa}B on the control of keratinocyte proliferation and viability (12, 13). Heterozygous IKK{gamma}-deficient mice exhibit a transient dermatosis characterized by granulocytic infiltration and increased keratinocyte apoptosis (14, 15). Skin-targeted deletion of IKK{beta} leads to a severe inflammatory skin disease mediated by TNF{alpha} (16). Sustained NF-{kappa}B activity leads to severe dermatitis in mouse models (17, 18) while inhibiting cutaneous NF-{kappa}B activity is associated with the development of squamous cell carcinomas (12, 19). Furthermore, the phenotype of K5-I{kappa}B{alpha} mice is also characterized by an intense neutrophilic cutaneous inflammation (20). Overall, theses studies suggest a critical role of NF-{kappa}B signaling in the maintenance of skin homeostasis.

We have previously reported that PKC{alpha} activation up-regulates the transcription of IL-1 and TNF{alpha}. TNF{alpha} is among the best-characterized inducers of NF-{kappa}B activity. Two structurally related but functionally distinct receptors (TNFR1/p55 kDa and TNFR2/p75 kDa) mediate the biological activities of TNF. The majority of inflammatory responses classically attributed to TNF{alpha} occur through TNFR1. In contrast, TNF{alpha}-induced thymocyte proliferation and apoptosis of activated T cells are mediated by TNFR2 (21, 22, 23). Mouse keratinocytes express both TNFR1 and TNFR2 (24). The current study was designed to test whether TNF{alpha} or NF-{kappa}B signaling contributes to the intraepidermal inflammation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

The construction and characterization of K5-PKC{alpha} mice were previously described (6). These mice express a full-length murine PKC{alpha} cDNA under the control of the bovine keratin 5 promoter (6) that targets the transgene to the basal layer of the epidermis and the outer root sheath of the hair follicle. For the studies reported here, an FVB/N strain expressing a 10-fold excess of PKC{alpha} over the endogenous level in the target sites was used (6).

K5-PKC{alpha} mice were crossed to homozygous mice deficient in TNFR1 and TNFR2 (TNFR1–/–TNFR2–/–). F1 mice K5-PKC{alpha} TNFR1–/+TNFR2–/+ were backcrossed to TNFR1–/–TNFR2–/– to generate K5-PKC{alpha} mice deficient for either TNFR1, TNFR2, or doubly deficient. At weaning, tail samples were collected and screened by separate PCR for each of the alleles. K5-PKC{alpha} allele was identified by PCR using primers TGCATATAAATTCTGGCTGGCG and GCATGAACATGGTTAGCAGAGGG that span a 166-nt sequence of the {beta}-globin intron (6). TNFR alleles were detected using the following primers: allele detected: R1 wt; forward primer, AGAAATGTCCCAGGTGGAGATCTC; reverse primer, GGCTGCAGTCCAAGCACTGG; allele detected: R1 KO; forward primer, TGCTGATGGGGATCCATC; reverse primer, CCGGTGGATGTGGAATGTGTG; allele detected: R2 wt; forward primer, CCTCTCATGCTGTCCCGGAAT; reverse primer, AGCTCCAGGCACAAGGGCGGG; and allele detected: R2 KO; CGGTTCTTTTTGTCAAGAC; reverse primer, ATCCTCGCCGTCGGGCAT.

To neutralize TNF{alpha} pharmacologically in K5-PKC{alpha} mice, a first dose of etanercept (100 µg) was administrated i.p. and 12 h later a second identical treatment was performed before TPA painting (2 µg). Etanercept is a dimeric fusion protein consisting of the extracellular ligand-binding portion of the human 75-kDa TNFR linked to the Fc portion of human IgG1 and is produced in genetically engineered Chinese hamster ovary cells (25). Etanercept was previously shown to neutralize mouse TNF{alpha} by the i.p. route (26). Etanercept was reconstituted at a concentration of 25 mg/ml in sterile water as suggested by the manufacturer (Immunex) and was further diluted in PBS to a final concentration of 500 µg/ml.

Reagents

For in vivo application, TPA (LC Laboratories) was dissolved in acetone and the indicated concentrations were applied topically in 200 µl. TNF{alpha} was purchased from Calbiochem, anti-mouse TNF{alpha} Ab from R&D Systems, LPS (Escherichia coli serotype 0111:B4) from Sigma-Aldrich, and etanercept was purchased through the Division of Veterinary Resources (National Institutes of Health, Bethesda, MD). The I{kappa}B{alpha}SR adenovirus was a generous gift from D. C. Guttridge from the University of North Carolina (Chapel Hill, NC).

Myeloperoxidase assay

Back whole skin samples were used for myeloperoxidase assay following the method of Bradley et al. (27). In brief, samples were homogenized in potassium phosphate buffer (pH 6.0) containing 0.5% hexadecyltrimethylammonium bromide, sonicated, and freeze-thawed three times, after which sonication was repeated. The suspension was centrifuged at 40,000 x g for 15 min, and 10 µl of supernatant was added to 290 µl of potassium phosphate buffer (pH 6.0) containing 0.167 mg/ml o-dianisidine dihydrochloride (Sigma-Aldrich) and 0.0005% hydrogen peroxide. Changes in OD were monitored at 460 nm at 25°C over a 4-min period. Isolated mouse neutrophils obtained from thioglycolate-induced peritonitis were processed in the same manner and used to generate a calibration curve for neutrophils, which were enumerated by light microscopy.

Cell culture

Primary mouse keratinocytes and hair follicle buds were isolated from newborn transgenic and wild-type (WT) littermate epidermis as described elsewhere (28). Primary keratinocytes were seeded at a density of 5 x 106 cells per 60-mm dish (or equivalent concentrations) in Ca2+- and Mg2+-free MEM (Invitrogen Life Technologies) supplemented with 8% Chelex (Bio-Rad Laboratories)-treated FBS (Gemini Bioproducts) and 0.2 mM Ca2+. After 24 h, cultures were switched to the same medium with 0.05 mM Ca2+ to select for basal cells. TPA was reconstituted in DMSO, and primary keratinocytes were treated with 5 ng/ml TPA for various times as indicated in individual experiments. This dose of TPA was shown previously to selectively activate PKC{alpha} in K5-PKC{alpha} keratinocytes (6).

Transfection and luciferase reporter assay

The NF-{kappa}B-luciferase plasmid DNA was a gift from Dr. Z.-G. Liu (National Cancer Institute, National Institutes of Health). Primary keratinocytes were transfected using Lipofectamine 2000 according to the manufacturer’s protocol (Invitrogen Life Technologies). Transient transfection was conducted for 48 h before treatment with TPA. After treatment, cells were rinsed twice in PBS and harvested in reporter lysis buffer (BD Clontech). Luciferase activity was measured by using the luciferase reporter assay kit (BD Biosciences Clontech) according to the manufacturer’s protocol. Results were normalized to the total protein content.

Immunofluorescence

Primary keratinocytes were fixed in 4% paraformaldehyde for 10 min at room temperature, rinsed with PBS five times, and permeabilized in prechilled MeOH for 10 min. After blocking with 100 mM glycine for 30 min, the cells were permeabilized with 0.2% Triton X-100 for 10 min. After washing the cells three times in PBS, they were blocked again for 30 min in 0.5% BSA and then incubated overnight with mouse mAb to p65 (Santa Cruz Biotechnology) diluted 1/100 in BSA or rabbit polyclonal Ab to PKC{alpha} (Sigma-Aldrich) diluted 1/10,000 in BSA. After being washed with PBS, cells were incubated for 1 h with goat anti-mouse or goat anti-rabbit Ab conjugated with FITC diluted 1/200 in BSA. Nuclei were stained using 4',6'-diamidino-2-phenylindole (Roche Diagnostics) diluted 1/5000 in PBS for 3 min. After additional washes, coverslips were mounted (Vector Laboratories) and slides were stored at 4°C in the dark until examined by confocal microscopy.

RT-PCR analysis

RNA was isolated from cultured keratinocytes with TRIzol per the manufacturer’s protocol (Invitrogen Life Technologies). For cDNA synthesis, 2 µg of total RNA was reverse-transcribed using Superscript II Reverse Transcriptase (Invitrogen Life Technologies). PCR amplifications were performed in a volume of 20 µl using Platinum PCR SuperMix (Invitrogen Life Technologies). The primers used for this analysis are as follows: gene: actin; forward primer, CAGATCATGTTTGAACCTTC; reverse primer, ACTTCATGATGGAATTGAATG; gene: GM-CSF: forward primer, GCCATCAAAGAAGCCCTGAA; reverse primer, GCGGGTCTGCACACATGTTA; gene, KC: forward primer, GCTTGTTCAGTTTAAAGATGGTAGGC; reverse primer, CGTGTTGACCATACAATATGAAAGACG; gene, IL-1{alpha}: forward primer, CAAACTGATGAAGCTCGTCA; reverse primer, TCTCCTTGAGCGCTCACGAA; gene, IL-6: forward primer, TTGCCTTCTTGGGACTGATG; reverse primer, CTGAAGGACTCTGGCTTTGT; gene, MIP-2: forward primer, CTGCCGCTCCTCAGTGCTGCACTG; reverse primer, GCCTTGCCTTTGTTCAGTATCTTTTGG; gene, MIP-3{alpha}: forward primer, AGCCAGGCAGAAGCAAGCAATAC; reverse primer, CTGTGTCCAATTCCATCCCAAAAA; gene, S100A8: GGAAATCACCATGCCCTCTA; reverse primer, GCTGTCTTTGTGAGATGCCA; gene, S100A9: forward primer, TCATCGACCCTTCCATCAA; reverse primer, GATCAACTTTGCCATCAGCA; gene, secretory leukocyte proteinase inhibitor (SLPI): forward primer, GATGCTATCAAAATCGGAGC; reverse primer, CACAGCACTTGTATTTGCCG; gene, TNF{alpha}: forward primer, ATGAGCACAGAAAGCATGATCCG; reverse primer, GCAATGACTCCAAAGTAGACCTGCCC; and gene, vascular endothelial growth factor (VEGF): CCCTCCGAAACCATGAACTT; reverse primer, GGCTTTGGTGAGGTTTGATCC.

To avoid saturation or the plateau effect of amplification, PCR was limited to a total of 20 cycles for actin and MIP3-{alpha}; 25 cycles for IL-1{alpha}, S100A9, SLP1, and TNF; 28 cycles for MIP-2, KC, and IL-6; 30 cycles for S100A8 and VEGF; and 32 cycles for GM-CSF. Each reaction was performed from at least three independent experiments.

Chemotaxis assays

Chemotaxis assays were performed using 48-well chemotaxis chambers (NeuroProbe) as described previously (29). Twenty-six to 28 µl of conditioned medium collected 6 h after TPA treatment of cultured keratinocytes was placed in the wells of the lower compartment of the chamber and 50 µl of peritoneal lavage containing 1.5 x 105 neutrophils was placed in the wells of the upper compartment. A polyvinylpyrolidone-free polycarbonate membrane (3-µm pore size; NeuroProbe) separates the upper and lower compartments. The pore size was chosen to allow the migration of neutrophils but not monocytes. After incubation at 37°C for 1 h, the filters were removed, washed on the upper side, fixed, and stained with Diff-Quik. Cells migrating across the filters were counted under light microscopy after coding the samples. The results were expressed as chemotaxis index, which represents the fold increase in the number of migrated cells in six high-powered fields in response to TPA-stimulated supernatants over the spontaneous cell migration in response to control medium.

Adenovirus transduction

The I{kappa}B{alpha}SR or PKC{alpha} adenoviruses were introduced into primary keratinocytes using an adenoviral construct driven by a CMV promoter (30) and empty adenovirus was used as control. The cells were infected for 30 min in serum-free medium with a multiplicity of infection of 5 viral particles/cell and 2.5 µg/ml Polybrene (Sigma-Aldrich) to enhance uptake. Serum-containing medium was added to the cells for the next 48 h after the infection.

Immunoblotting

Cultured cells were lysed in buffer containing 20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1.5 mM MgCl2, 10% glycerol, 1% Triton X-100, 5 mM EDTA, 1 mM PMSF, 2 µg/ml aprotinin, 20 µM leupeptin, 200 µM NaVO3, and 10 mM NaF. Proteins were quantified by the Bradford method (Bio-Rad) and separated by 7.5% SDS-PAGE followed by immunoblotting. Phospho-I{kappa}B{alpha} (Ser32) and I{kappa}B{alpha} Abs were used at 1/1000 (Cell Signaling) and {beta}-actin Ab was used at 1/1000 (Chemicon). An ECL SuperSignal (Pierce) detection system was used.

TNF{alpha} ELISA

TNF{alpha} levels in plasma and culture supernatants were measured by ELISA according to the manufacturer’s protocol (BD Biosciences).

Statistical methods

Data were analyzed by PRISM software and significance values were assigned through Student’s t test. A value of p < 0.05 was considered to be significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PKC{alpha} activates NF-{kappa}B signaling in keratinocytes

The dimeric NF-{kappa}B complex is present in an inactive state bound to inhibitory I{kappa}B protein in the cytosol. Phosphorylation of I{kappa}B leads to its degradation and allows NF-{kappa}B subunits to translocate to the nucleus. To test whether PKC{alpha} activation would cause NF-{kappa}B translocation to the nucleus, primary keratinocytes from K5-PKC{alpha} mice and their WT littermates were treated with 5 ng/ml TPA, and p65 cellular localization was monitored by confocal microscopy. Within 30 min, p65 was detected in the nucleus of virtually all transgenic cells while it remained mostly cytoplasmic in WT cells (Fig. 1). To determine whether NF-{kappa}B translocation triggered by TPA correlated with I{kappa}B hyperphosphorylation, K5-PKC{alpha} keratinocyte lysates were separated by SDS-PAGE and immunoblotted for phospho-I{kappa}B{alpha} and total I{kappa}B{alpha} using specific Abs. PKC{alpha} activation increases phosphorylation within 20 min and this activity results in a decrease of total I{kappa}B{alpha}, presumably associated with enhanced protein degradation as previously reported (31) (Fig. 2). The functional relevance of these observations was evaluated in WT and K5-PKC{alpha} primary keratinocytes that were transfected with a NF-{kappa}B reporter construct and stimulated with TPA. As shown in Fig. 3, TPA treatment substantially increased NF-{kappa}B transcriptional activity in transgenic cells while only a marginal induction was detected in their WT counterpart. These results suggest that selective PKC{alpha} activation leads to NF-{kappa}B nuclear translocation and transcriptional response. The limited response detected in WT keratinocytes along with the transient induction of NF-{kappa}B-responsive genes reported in TPA-treated WT keratinocytes previously (6), probably reflects the activation of endogenous PKC{alpha} in these cells.



View larger version (183K):
[in this window]
[in a new window]
 
FIGURE 1. NF-{kappa}B subunit p65 translocates to the nucleus of K5-PKC{alpha} primary keratinocytes in response to TPA. Newborn mouse primary keratinocytes from WT or K5-PKC{alpha} littermates (transgenic (TG)) were treated with TPA for either 15 or 30 min and fixed with paraformaldehyde, immunostained with p65-specific Abs, and analyzed by confocal microscopy. TG, Transgenic.

 


View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 2. PKC{alpha} activation results in I{kappa}B{alpha} phosphorylation and decreased total I{kappa}B{alpha} levels. K5-PKC{alpha} primary keratinocytes were treated for the indicated periods of time and cell lysates were analyzed by Western blots.

 


View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 3. PKC{alpha} activation increases NF-{kappa}B reporter activity in K5-PKC{alpha} keratinocytes. WT and K5-PKC{alpha} primary keratinocytes were transiently transfected with a NF-{kappa}B reporter activity plasmid construct and after 48 h were treated with DMSO (–) or TPA (+) for 6 h. Cells were harvested and assayed for luciferase activity. Bars represent mean ± SEM of quadruplicate determinations. Values are expressed as relative light units (RLU) per 100 µg total protein as determined according to the method of Bradford et al. Results are representative of three independent experiments. *, p < 0.05 compared with respective DMSO control.

 
Blocking NF-{kappa}B activation reduces inflammatory gene expression and chemoattractant release in primary keratinocytes

To test a functional role for NF-{kappa}B downstream of PKC{alpha}, primary keratinocytes were transduced with an adenoviral I{kappa}B{alpha} mutant construct (referred to as I{kappa}B{alpha} superrepressor, or I{kappa}B{alpha}SR). I{kappa}B{alpha}SR harbors mutations on Ser32 and Ser36 that renders the mutant protein resistant to phosphorylation and subsequent proteasome degradation (30). The inhibitory activity of I{kappa}B{alpha}SR was demonstrated by its ability to inhibit TPA-induced NF-{kappa}B reporter activity in K5-PKC{alpha} primary keratinocytes (Fig. 4A). In addition to the up-regulation of TNF{alpha}, MIP-2, cyclooxygenase 2, and MIP-3{alpha} that we have previously reported (6), we now report that cytokine-induced neutrophils chemoattractant (KC), S100A8 (calgranulin A, MRP-8), S100A9 (calgranulin B, MRP-9), IL-1{alpha}, IL-6, GM-CSF, secretory leukocyte proteinase inhibitor (SLPI), ICAM-1, and VEGF transcripts are up-regulated in response to PKC{alpha} activation in the first 3 h after TPA treatment (Fig. 4B, cf lanes 1 and 2). PKC{alpha} activation also up-regulates the expression of G-CSF transcripts 30 min after TPA treatment (data not shown). Consistent with the abrogation of the NF-{kappa}B reporter activity, the PKC{alpha} mediated increased expression of MIP-2, MIP-3{alpha}, TNF-{alpha}, GM-CSF, and IL-6 transcripts was completely blocked by I{kappa}B{alpha}SR (Fig. 4B). NF-{kappa}B transcriptional activity contributes only partially to the PKC{alpha}-mediated regulation of the KC, IL-1{alpha}, S100A8, and VEGF genes. We have previously demonstrated that culture supernatant from TPA-treated K5-PKC{alpha} keratinocytes contains chemotactic activity, confirming that functional chemokines are released from keratinocytes after activation of PKC{alpha} (6). To determine whether NF-{kappa}B-induced chemokines mediate the chemotactic activity of these supernatants, TPA-treated I{kappa}B{alpha}SR-transduced K5-PKC{alpha} primary keratinocyte supernatants were prepared. Figure 4C indicates that blockade of NF-{kappa}B transcriptional activity reduced the chemotactic activity by 40% compared with supernatants from K5-PKC{alpha} keratinocytes transduced with a control adenovirus. This result suggested that the NF-{kappa}B signaling pathway is a major but not exclusive contributor to the production of chemotactic molecules by keratinocytes, which leads to the migration of neutrophils.



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 4. Blocking NF-{kappa}B transcriptional activity reduces inflammatory gene expression and chemoattractant release in response to PKC{alpha} activation. A, K5-PKC{alpha} primary keratinocytes were transiently transfected with the NF-{kappa}B reporter activity plasmid construct and 24 h later cells were transduced with an adenovirus encoding a degradation-resistant I{kappa}B{alpha} (I{kappa}B{alpha}SR) or a control adenovirus (A-CMV). After an additional 24 h, cells were treated with DMSO (–) or TPA (+) for 6 h. Values are expressed as relative light units (RLU) per 100 µg total protein as determined by Bradford. Results are representative of three independent experiments. *, p < 0.001 compared with respective DMSO control. B, Agarose gel stained with ethidium bromide showing RT-PCR product for MIP-2 (281 bp), MIP-3{alpha} (260 bp), S100A9 (227 bp), S100A8 (189 bp), TNF{alpha} (700 bp), GM-CSF (113 bp), SLPI (273 bp), VEGF (352 bp), and actin (472 bp). RNA was extracted from A-CMV (control) or degradation-resistant I{kappa}B{alpha} (I{kappa}B{alpha}SR) adenovirus-transduced primary keratinocytes treated with DMSO (–) or TPA (+) for 3 h. C, Chemotactic activity of culture supernatant collected from K5-PKC{alpha} keratinocytes transduced with A-CMV (control) or degradation-resistant I{kappa}B{alpha} (I{kappa}B{alpha}SR) adenovirus after a 6-h TPA treatment. Fold increase (chemotaxis index) of neutrophil migration in response to TPA was compared with supernatant collected after DMSO treatment. *, p < 0.05 compared with A-CMV control. Bars represent the mean ± SEM of two triplicate determinations.

 
NF-{kappa}B nuclear translocation is independent of TNF signaling

To test whether PKC{alpha} activation would cause TNF{alpha} release in culture supernatants, keratinocytes isolated from K5-PKC{alpha} newborn pups and their WT littermates were plated in duplicate in six-well plates. The cells were treated with either the vehicle DMSO or 5 ng/ml TPA for 3 h. The TNF{alpha} released was normalized to the number of cells at the collection time. The results indicate that keratinocytes from K5-PKC{alpha} mice released TNF{alpha} into the medium in response to PKC{alpha} activation (Table I). To determine whether the observed activation of NF-{kappa}B was a direct effect of PKC{alpha} activation and not due to the secondary induction of TNF{alpha}, we examined NF-{kappa}B translocation in the presence of neutralizing anti-TNF{alpha} Abs in cultured keratinocytes. The specificity of the neutralizing anti-TNF{alpha} Abs was confirmed by using IgG isotype Abs. Pretreatment of K5-PKC{alpha} primary keratinocytes with such anti-TNF{alpha} Abs abrogates the translocation of NF-{kappa}B by rTNF{alpha} (Fig. 5A) but has no effect on PKC{alpha}-mediated NF-{kappa}B translocation (Fig. 5B). TNF{alpha} associated with the cell surface is biologically active (32) and could be active even in the presence of neutralizing Ab. To confirm the independence of NF-{kappa}B activation from TNF{alpha} induction, primary keratinocytes from newborn mice homozygous with targeted disruption of the two known TNF{alpha} cell surface receptors, TNFR1 (p55) and TNFR2 (p75) were transduced with a PKC{alpha} adenoviral construct and treated with TPA. Nuclear translocation of NF-{kappa}B is not abrogated in the double knockout cells, confirming that PKC{alpha} causes NF-{kappa}B activation independently of TNFR expression (Fig. 5C). The PKC{alpha} expression level in adenovirus-transduced TNFR-deficient keratinocytes was similar to that of primary K5-PKC{alpha} cells (data not shown).


View this table:
[in this window]
[in a new window]
 
Table I. TNF{alpha} levels released from cultured keratinocytes

 


View larger version (104K):
[in this window]
[in a new window]
 
FIGURE 5. NF-{kappa}B nuclear translocation is independent of TNF{alpha} signaling. A, K5-PKC{alpha} primary keratinocytes were treated with TNF{alpha} alone for 15 min (TNF) or pretreated with control IgG for 1 h followed by a 15-min treatment with TNF{alpha} (TNF + IgG) or pretreated with TNF{alpha}-neutralizing Ab for 1 h followed by a 15-min treatment with TNF{alpha} (TNF + TNFAb). B, K5-PKC{alpha} primary keratinocytes were treated with TPA alone for 15 or 30 min (TPA) or pretreated with control IgG for 1 h followed by a 15- or 30-min treatment with TPA (TPA + IgG) or pretreated with TNF{alpha}-neutralizing Ab for 1 h followed by a 15- or 30-min treatment with TPA (TPA + TNFAb). C, TNFR1R2 double knockout keratinocytes transduced with A-CMV (control) or PKC{alpha} adenovirus were treated with DMSO or TPA for 30 min. Cells were fixed with paraformaldehyde, immunostained with p65-specific Abs, and analyzed by confocal microscopy.

 
Neutrophil infiltration in the epidermis is TNF{alpha} independent

To determine whether TNF{alpha} activity is required for leukocyte recruitment to the epidermis, we analyzed neutrophil migration into the skin of mice that were pretreated systemically with a dimeric soluble form of p75 human TNF{alpha} receptor (etanercept). This molecule has been proven to be efficient at blocking TNF{alpha} activity in various murine models of inflammation (25, 26). As shown in Fig. 6A, etanercept given i.p. at 200 µg was ineffective at blocking the formation of microabscesses in response to PKC{alpha} activation. In addition, neither a higher dose (400 µg) nor a s.c. injection blocked neutrophil infiltration. To confirm the dispensable function of TNF{alpha} on PKC{alpha}-mediated skin inflammation, K5-PKC{alpha} mice were crossed with mice homozygous for targeted disruption of both TNFR1 and TNFR2 (TNFR1–/– TNFR2–/–). None of the three K5-PKC{alpha} TNFR-deficient strains displayed any gross phenotypic or reproductive anomalies as reported for individual strains (6, 33). It has also been reported that genetic deletion of TNFR1 or TNFR2 individually does not affect expression of the remaining TNF{alpha} receptor subtype in the skin (34). As shown in Fig. 6B, the migration of neutrophils to the epidermis and the inflammatory response were indistinguishable in mice lacking TNFR1, TNFR2, or both isoforms from that of K5-PKC{alpha} expressing both TNFR. The neutrophil content was further evaluated by measurement of the myeloperoxidase activity in skin, confirming that migration of neutrophils in the skin of K5-PKC{alpha} was independent of TNF{alpha} (Fig. 6C).



View larger version (91K):
[in this window]
[in a new window]
 
FIGURE 6. Neutrophil infiltration in the epidermis is TNF{alpha} independent. A, A single dose of TPA (2 µg) in acetone was applied to the shaved backs of K5-PKC{alpha} mice that had been injected 12 h earlier with PBS (control) or the TNF inhibitor (etanercept treated, 200 µg i.p.). Skin was collected 12 h later and stained with H&E. B, K5-PKC{alpha} mice expressing both TNFRs (K5-PKC{alpha}/TNFR1+/–R2+/–), K5-PKC{alpha} mice deficient for TNFR1 (K5-PKC{alpha}/TNFR1–/–R2+/–), K5-PKC{alpha} mice deficient for TNFR2 (K5-PKC{alpha}/TNFR1+/–R2–/–), and K5-PKC{alpha} mice deficient for both TNFRs (K5-PKC{alpha}/TNFR1–/–R2–/–) were TPA painted, skin was collected 24 h later, and sections were stained with H&E. Original magnification, x200). C, Neutrophil infiltration in the epidermis of the mouse used in B was quantified using leukocyte myeloperoxidase activity (MPO). Bars represent the mean ± SEM of four independent animals and results are representative of at least five independent experiments. Right panel, A calibration curve for myeloperoxidase activity vs neutrophil number (see Materials and Methods). The differences among the treated groups are not significantly different. PMN, Polymorphonuclear leukocytes.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the cutaneous lesions of TPA-painted K5-PKC{alpha} mice, inflammatory changes are associated with neutrophil infiltration and intraepidermal microabscess formation. In the present study, we have demonstrated that PKC{alpha} activation promotes NF-{kappa}B transcriptional activity in keratinocytes. Blocking NF-{kappa}B activity in primary keratinocytes partially abolishes the chemotaxis of neutrophils. Although TNF{alpha} is a potent inducer of inflammatory mediators through NF-{kappa}B, our results show that PKC{alpha} mediates infiltration of neutrophils in the epidermis independently of TNF{alpha} signaling. These data suggest that K5-PKC{alpha} mice are a valuable inducible (through TPA painting) model to study the critical mediators of neutrophilic inflammatory lesions.

We had previously shown that activation of PKC{alpha} in the FVB/N strain produces keratinocyte growth arrest and apoptosis that is dependent on intact AP-1 transcriptional activation but AP-1 activity is not required for the inflammatory infiltrate (6). Together it would appear that PKC{alpha} controls two distinct responses in keratinocytes, one related to growth and viability that is AP-1 dependent and the other related to chemotaxis and inflammation that involves NF-{kappa}B. Our results suggest that PKC{alpha} is an important regulator of NF-{kappa}B activation in the skin. Interestingly, NF-{kappa}B activation in the suprabasal layer of the epidermis causes growth arrest, a condition necessary for the proper differentiation of keratinocytes (12) and a response that is also regulated by PKCs (35). For most known stimuli, the degradation of I{kappa}B is an essential step for releasing NF-{kappa}B and its subsequent activation (11). Our results provide evidence that PKC{alpha} activation leads to phosphorylation of amino-terminal serine residues of I{kappa}B{alpha}, presumably through IKK activation. Although the signaling cascade emanating from PKC{alpha} causing IKK activation in K5-PKC{alpha} keratinocytes deserves further attention, it has been demonstrated that PKC{alpha} can activate IKK{beta} through PKC{theta} in T lymphocytes (35, 36). Peripheral T cells of PKC{theta}–/– mice cannot be activated in response to Ag due to a striking deficiency in NF-{kappa}B activation (37, 38). However PKC{theta} is not a direct IKK activator and the signaling components that connect PKC{theta} and IKK{beta} have not been fully defined.

NF-{kappa}B is one of the pivotal regulators of proinflammatory gene expression in K5-PKC{alpha} primary keratinocytes. As a consequence, NF-{kappa}B blockade causes a significant reduction of the keratinocyte-derived chemotactic activity. Recent studies using transgenic models have demonstrated a critical role for NF-{kappa}B for the control of keratinocyte proliferation and viability (12, 13). However, blockade of NF-{kappa}B function in the skin of K5-I{kappa}B{alpha} mice leads to neutrophils-mediated inflammation of the skin (39), a condition also seen in IKK{gamma}-deficient mice (14, 15). Characteristic neutrophil accumulation under the stratum corneum can be observed in highly inflamed areas of human psoriatic lesions where neutrophils are chemotactically attracted by synergistic activity of IL-8 and growth-related oncogene {alpha} chemokines produced by keratinocytes (40). In the mouse, the local recruitment of polymorphonuclear leukocytes can be mediated by cytokine-induced neutrophil chemoattractant (KC) (41), the homologue of the human GRO, and MIP-2, considered as the functional analogue of human IL-8. We have previously excluded MIP-1{alpha} as a possible mediator of PKC{alpha}-induced intraepidermal inflammation since CCR1 deficiency did not prevent neutrophilic infiltration in K5-PKC{alpha} mouse epidermis. Our results demonstrate that both KC and MIP-2 are PKC{alpha} regulated through NF-{kappa}B activation. Interestingly, although blocking NF-{kappa}B activation completely abrogates the induction of MIP-2 by PKC{alpha}, KC mRNA induction was not completely prevented. This might reflect an alternative regulatory mechanism for that gene and could contribute to the residual chemotactic activity upon NF-{kappa}B blockade in this model. Constitutive expression of KC in the epidermis of transgenic mice causes infiltration of neutrophils in the skin, but the inflammatory reaction was very moderate (41). Inducible expression of KC in transgenic grafts causes a greater inflammatory response by circumventing CXCR2 (KC’s receptor) desensitization caused by high-level constitutive expression of KC that prevents a more marked inflammatory response (42). In that regard, the K5-PKC{alpha} mice may prove to be an inducible model well suited for the analysis of the contribution of CXCR2 ligands role on neutrophil migration in the skin. In addition, it appears that PKC{alpha} up-regulates the transcription of the S100A8 and S100A9 genes. S100A8 and S100A9 are calcium binding and regulated proteins for which an increasing body of information suggests a prominent role during inflammation (43). The presence of the S100A8/A9 complex in sera of patients with various inflammatory conditions, including cystic fibrosis and rheumatoid arthritis, suggests an extracellular role. S100A8 and S100A9 are up-regulated in psoriatic lesional skin (44), and dimers are constitutively secreted by human Hacat keratinocytes (45) and released through a PKC-dependent mechanism in human monocytes (46). Interestingly, recent reports suggest chemotactic properties for S100A8 and S100A9 on the local recruitment of neutrophils in response to LPS in a mouse air pouch model (47, 48). Our results indicate that S100A8 and S100A9 transcription is up-regulated independently of NF-{kappa}B downstream of PKC{alpha}; this could in turn also contribute to the residual chemotactic activity observed upon NF-{kappa}B blockade. Overall, our results confirm the potential for keratinocyte-derived chemotactic factors to promote neutrophil infiltration in the epidermis. Interestingly, the up-regulation of both G-CSF/GM-CSF and IL-6 gene expression suggests that PKC{alpha} activation in keratinocytes could also increase the central production of neutrophils, a response that would contribute to systemic neutrophilia.

Our observation that K5-PKC{alpha} mice lacking both TNFR1 and TNFR2 still develop neutrophilic microabscesses in the epidermis strongly indicates that in this model neutrophil emigration is TNF{alpha} independent even though TNF{alpha} is up-regulated and released. Transgenic mice overexpressing high levels of TNF{alpha} under the K14 promoter develop only a moderate dermal inflammatory response (49). In contrast, recruitment of inflammatory cells during UVB exposure, chemical irritation, s.c. TNF{alpha} injection, and wound healing requires TNFR1 expression (50, 51, 52). TNFR1 signaling pathways also contribute to cutaneous permeability barrier repair (53). Mice having a defect in NF-{kappa}B signaling through skin-targeted deletion of ikk{beta} or keratin 5-driven expression of the I{kappa}B{alpha} repressor mutant develop a strong epidermal inflammation that can be prevented by TNFR1 deficiency (16, 39). The K5- I{kappa}B{alpha} repressor mice display a mixed inflammatory infiltrate dominated by neutrophils and concomitant up-regulation of TNF{alpha} (20). Collectively, these reports support a critical role for TNF{alpha}/TNFR1 on the initiation of inflammation and recruitment of inflammatory cells in the skin. However, neutrophil emigration in the lung in response to LPS does not require TNFR expression (33). Similarly, careful analysis of RelA–/–tnfr1–/– mice revealed a defect in neutrophil emigration in the lung not due to TNFR1-defective signaling but rather defective induction of KC and MIP-2 because of RelA deficiency (54). Therefore, clearly a precedent exists where the recruitment of neutrophils at the inflammation site is TNF independent, and TPA-mediated inflammation through PKC{alpha} appears to be one of them.

Clinical trials with several different TNF antagonists have established that this cytokine has an important pathogenic contribution to cutaneous inflammation (55). However, our results suggest that in the skin there are situations where TNF-independent pathways exist for the chemotaxis of neutrophils. These situations would challenge the clinical efficacy of TNF antagonists. PKC{alpha}-specific inhibitors could have potential to provide therapeutic benefit in skin inflammatory disorders presenting neutrophilic granulocyte accumulation in which TNF antagonists are ineffective.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part with U.S. federal funds from the National Cancer Institute, National Institutes of Health, under Contract N01-CO-12400. Back

2 Address correspondence and reprint requests to Dr. Stuart Yuspa, Laboratory of Cellular Carcinogenesis and Tumor Promotion, Center for Cancer Research, National Cancer Institute, 37 Convent Drive, MSC-4255, Building 37, Room 4068, Bethesda, MD 20892-4255. E-mail address: yuspas{at}mail.nih.gov Back

3 Abbreviations used in this paper: PKC, protein kinase C; TPA, 12-O-tetradecanoyl-phorbol-13-acetate; IKK, I{kappa}B kinase; WT, wild type; VEGF, vascular endothelial growth factor; SLPI, secretory leukocyte proteinase inhibitor. Back

Received for publication September 13, 2004. Accepted for publication November 2, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Blauvelt, A., S. T. Hwang, M. C. Udey. 2003. 11. Allergic and immunologic diseases of the skin. J. Allergy Clin. Immunol. 111:S560.[Medline]
  2. Ellis, C. N., L. A. Drake, M. M. Prendergast, W. Abramovits, M. Boguniewicz, C. R. Daniel, M. Lebwohl, S. R. Stevens, D. L. Whitaker-Worth, J. W. Cheng, K. B. Tong. 2002. Cost of atopic dermatitis and eczema in the United States. J. Am. Acad. Dermatol. 46:361.[Medline]
  3. Robert, C., T. S. Kupper. 1999. Inflammatory skin diseases, T cells, and immune surveillance. N. Engl. J. Med. 341:1817.[Free Full Text]
  4. Debenedictis, C., S. Joubeh, G. Zhang, M. Barria, R. F. Ghohestani. 2001. Immune functions of the skin. Clin. Dermatol. 19:573.[Medline]
  5. Grone, A.. 2002. Keratinocytes and cytokines. Vet. Immunol. Immunopathol. 88:1.[Medline]
  6. Cataisson, C., E. Joseloff, R. Murillas, A. Wang, C. Atwell, S. Torgerson, M. Gerdes, J. Subleski, J. L. Gao, P. M. Murphy, et al 2003. Activation of cutaneous protein kinase C{alpha} induces keratinocyte apoptosis and intraepidermal inflammation by independent signaling pathways. J. Immunol. 171:2703.[Abstract/Free Full Text]
  7. Reddig, P. J., N. E. Dreckschmidt, H. Ahrens, R. Simsiman, C. P. Tseng, J. Zou, T. D. Oberley, A. K. Verma. 1999. Transgenic mice overexpressing protein kinase C{delta} in the epidermis are resistant to skin tumor promotion by 12-O-tetradecanoylphorbol-13-acetate. Cancer Res. 59:5710.[Abstract/Free Full Text]
  8. Reddig, P. J., N. E. Dreckschmidt, J. Zou, S. E. Bourguignon, T. D. Oberley, A. K. Verma. 2000. Transgenic mice overexpressing protein kinase C{epsilon} in their epidermis exhibit reduced papilloma burden but enhanced carcinoma formation after tumor promotion. Cancer Res. 60:595.[Abstract/Free Full Text]
  9. Jansen, A. P., N. E. Dreckschmidt, E. G. Verwiebe, D. L. Wheeler, T. D. Oberley, A. K. Verma. 2001. Relation of the induction of epidermal ornithine decarboxylase and hyperplasia to the different skin tumor-promotion susceptibilities of protein kinase C {alpha}, -{delta} and -{epsilon} transgenic mice. Int. J. Cancer 93:635.[Medline]
  10. Ghosh, S., M. Karin. 2002. Missing pieces in the NF-{kappa}B puzzle. Cell 109:(Suppl.):S81.
  11. Karin, M., Y. Ben Neriah. 2000. Phosphorylation meets ubiquitination: the control of NF-{kappa}B activity. Annu. Rev. Immunol. 18:621.[Medline]
  12. Seitz, C. S., Q. Lin, H. Deng, P. A. Khavari. 1998. Alterations in NF-{kappa}B function in transgenic epithelial tissue demonstrate a growth inhibitory role for NF-{kappa}B. Proc. Natl. Acad. Sci. USA 95:2307.[Abstract/Free Full Text]
  13. Seitz, C. S., R. A. Freiberg, K. Hinata, P. A. Khavari. 2000. NF-{kappa}B determines localization and features of cell death in epidermis. J. Clin. Invest. 105:253.[Medline]
  14. Makris, C., V. L. Godfrey, G. Krahn-Senftleben, T. Takahashi, J. L. Roberts, T. Schwarz, L. Feng, R. S. Johnson, M. Karin. 2000. Female mice heterozygous for IKK{gamma}/NEMO deficiencies develop a dermatopathy similar to the human X-linked disorder incontinentia pigmenti. Mol. Cell. 5:969.[Medline]
  15. Schmidt-Supprian, M., W. Bloch, G. Courtois, K. Addicks, A. Israel, K. Rajewsky, M. Pasparakis. 2000. NEMO/IKK{gamma}-deficient mice model incontinentia pigmenti. Mol. Cell. 5:981.[Medline]
  16. Pasparakis, M., G. Courtois, M. Hafner, M. Schmidt-Supprian, A. Nenci, A. Toksoy, M. Krampert, M. Goebeler, R. Gillitzer, A. Israel, et al 2002. TNF-mediated inflammatory skin disease in mice with epidermis-specific deletion of IKK2. Nature 417:861.[Medline]
  17. Beg, A. A., W. C. Sha, R. T. Bronson, D. Baltimore. 1995. Constitutive NF-{kappa}B activation, enhanced granulopoiesis, and neonatal lethality in I{kappa}B{alpha}-deficient mice. Genes Dev. 9:2736.[Abstract/Free Full Text]
  18. Klement, J. F., N. R. Rice, B. D. Car, S. J. Abbondanzo, G. D. Powers, P. H. Bhatt, C. H. Chen, C. A. Rosen, C. L. Stewart. 1996. I{kappa}B{alpha} deficiency results in a sustained NF-{kappa}B response and severe widespread dermatitis in mice. Mol. Cell Biol. 16:2341.[Abstract]
  19. van Hogerlinden, M., B. L. Rozell, L. Ahrlund-Richter, R. Toftgard. 1999. Squamous cell carcinomas and increased apoptosis in skin with inhibited Rel/nuclear factor-{kappa}B signaling. Cancer Res. 59:3299.[Abstract/Free Full Text]
  20. van Hogerlinden, M., B. L. Rozell, R. Toftgard, J. P. Sundberg. 2004. Characterization of the progressive skin disease and inflammatory cell infiltrate in mice with inhibited NF-{kappa}B signaling. J. Invest Dermatol. 123:101.[Medline]
  21. Tartaglia, L. A., D. V. Goeddel, C. Reynolds, I. S. Figari, R. F. Weber, B. M. Fendly, M. A. Palladino, Jr. 1993. Stimulation of human T-cell proliferation by specific activation of the 75-kDa tumor necrosis factor receptor. J. Immunol. 151:4637.[Abstract]
  22. Sheehan, K. C., J. K. Pinckard, C. D. Arthur, L. P. Dehner, D. V. Goeddel, R. D. Schreiber. 1995. Monoclonal antibodies specific for murine p55 and p75 tumor necrosis factor receptors: identification of a novel in vivo role for p75. J. Exp. Med. 181:607.[Abstract/Free Full Text]
  23. Zheng, L., G. Fisher, R. E. Miller, J. Peschon, D. H. Lynch, M. J. Lenardo. 1995. Induction of apoptosis in mature T cells by tumour necrosis factor. Nature 377:348.[Medline]
  24. Zhuang, L., B. Wang, G. A. Shinder, G. M. Shivji, T. W. Mak, D. N. Sauder. 1999. TNF receptor p55 plays a pivotal role in murine keratinocyte apoptosis induced by ultraviolet B irradiation. J. Immunol. 162:1440.[Abstract/Free Full Text]
  25. Mohler, K. M., D. S. Torrance, C. A. Smith, R. G. Goodwin, K. E. Stremler, V. P. Fung, H. Madani, M. B. Widmer. 1993. Soluble tumor necrosis factor (TNF) receptors are effective therapeutic agents in lethal endotoxemia and function simultaneously as both TNF carriers and TNF antagonists. J. Immunol. 151:1548.[Abstract]
  26. Wooley, P. H., J. Dutcher, M. B. Widmer, S. Gillis. 1993. Influence of a recombinant human soluble tumor necrosis factor receptor FC fusion protein on type II collagen-induced arthritis in mice. J. Immunol. 151:6602.[Abstract]
  27. Bradley, P. P., D. A. Priebat, R. D. Christensen, G. Rothstein. 1982. Measurement of cutaneous inflammation: estimation of neutrophil content with an enzyme marker. J. Invest. Dermatol. 78:206.[Medline]
  28. Dlugosz, A. A., A. B. Glick, T. Tennenbaum, W. C. Weinberg, S. H. Yuspa. 1995. Isolation and utilization of epidermal keratinocytes for oncogene research. P. K. Vogt, Jr, and I. M. Verma, Jr, eds. In Methods in Enzymology Vol. 254:3.-20. Academic, New York.
  29. Gao, J. L., T. A. Wynn, Y. Chang, E. J. Lee, H. E. Broxmeyer, S. Cooper, H. L. Tiffany, H. Westphal, J. Kwon-Chung, P. M. Murphy. 1997. Impaired host defense, hematopoiesis, granulomatous inflammation and type 1-type 2 cytokine balance in mice lacking CC chemokine receptor 1. J. Exp. Med. 185:1959.[Abstract/Free Full Text]
  30. Guttridge, D. C., C. Albanese, J. Y. Reuther, R. G. Pestell, A. S. Baldwin, Jr. 1999. NF-{kappa}B controls cell growth and differentiation through transcriptional regulation of cyclin D1. Mol. Cell Biol. 19:5785.[Abstract/Free Full Text]
  31. Palombella, V. J., O. J. Rando, A. L. Goldberg, T. Maniatis. 1994. The ubiquitin-proteasome pathway is required for processing the NF-{kappa}B1 precursor protein and the activation of NF-{kappa}B. Cell 78:773.[Medline]
  32. Kriegler, M., C. Perez, K. DeFay, I. Albert, S. D. Lu. 1988. A novel form of TNF/cachectin is a cell surface cytotoxic transmembrane protein: ramifications for the complex physiology of TNF. Cell 53:45.[Medline]
  33. Peschon, J. J., D. S. Torrance, K. L. Stocking, M. B. Glaccum, C. Otten, C. R. Willis, K. Charrier, P. J. Morrissey, C. B. Ware, K. M. Mohler. 1998. TNF receptor-deficient mice reveal divergent roles for p55 and p75 in several models of inflammation. J. Immunol. 160:943.[Abstract/Free Full Text]
  34. Arnott, C. H., K. A. Scott, R. J. Moore, S. C. Robinson, R. G. Thompson, F. R. Balkwill. 2004. Expression of both TNF-{alpha} receptor subtypes is essential for optimal skin tumour development. Oncogene 23:1902.[Medline]
  35. Lee, Y. S., A. A. Dlugosz, R. McKay, N. M. Dean, S. H. Yuspa. 1997. Definition by specific antisense oligonucleotides of a role for protein kinase C{alpha} in expression of differentiation markers in normal and neoplastic mouse epidermal keratinocytes. Mol. Carcinog. 18:44.[Medline]
  36. Trushin, S. A., K. N. Pennington, A. Algeciras-Schimnich, C. V. Paya. 1999. Protein kinase C and calcineurin synergize to activate I{kappa}B kinase and NF-{kappa}B in T lymphocytes. J. Biol. Chem. 274:22923.[Abstract/Free Full Text]
  37. Trushin, S. A., K. N. Pennington, E. M. Carmona, S. Asin, D. N. Savoy, D. D. Billadeau, C. V. Paya. 2003. Protein kinase C{alpha} (PKC{alpha}) acts upstream of PKC{theta} to activate I{kappa}B kinase and NF-{kappa}B in T lymphocytes. Mol. Cell Biol. 23:7068.[Abstract/Free Full Text]
  38. Sun, Z., C. W. Arendt, W. Ellmeier, E. M. Schaeffer, M. J. Sunshine, L. Gandhi, J. Annes, D. Petrzilka, A. Kupfer, P. L. Schwartzberg, D. R. Littman. 2000. PKC-{theta} is required for TCR-induced NF-{kappa}B activation in mature but not immature T lymphocytes. Nature 404:402.[Medline]
  39. Lind, M. H., B. Rozell, R. P. Wallin, M. van Hogerlinden, H. G. Ljunggren, R. Toftgard, I. Sur. 2004. Tumor necrosis factor receptor 1-mediated signaling is required for skin cancer development induced by NF-{kappa}B inhibition. Proc. Natl. Acad. Sci. USA 101:4972.[Abstract/Free Full Text]
  40. Gillitzer, R., U. Ritter, U. Spandau, M. Goebeler, E. B. Brocker. 1996. Differential expression of GRO-{alpha} and IL-8 mRNA in psoriasis: a model for neutrophil migration and accumulation in vivo. J. Invest. Dermatol. 107:778.[Medline]
  41. Lira, S. A., P. Zalamea, J. N. Heinrich, M. E. Fuentes, D. Carrasco, A. C. Lewin, D. S. Barton, S. Durham, R. Bravo. 1994. Expression of the chemokine N51/KC in the thymus and epidermis of transgenic mice results in marked infiltration of a single class of inflammatory cells. J. Exp. Med. 180:2039.[Abstract/Free Full Text]
  42. Wiekowski, M. T., S. C. Chen, P. Zalamea, B. P. Wilburn, D. J. Kinsley, W. W. Sharif, K. K. Jensen, J. A. Hedrick, D. Manfra, S. A. Lira. 2001. Disruption of neutrophil migration in a conditional transgenic model: evidence for CXCR2 desensitization in vivo. J. Immunol. 167:7102.[Abstract/Free Full Text]
  43. Nacken, W., J. Roth, C. Sorg, C. Kerkhoff. 2003. S100A9/S100A8: myeloid representatives of the S100 protein family as prominent players in innate immunity. Microsc. Res. Tech. 60:569.[Medline]
  44. Broome, A. M., D. Ryan, R. L. Eckert. 2003. S100 protein subcellular localization during epidermal differentiation and psoriasis. J. Histochem. Cytochem. 51:675.[Abstract/Free Full Text]
  45. Thorey, I. S., J. Roth, J. Regenbogen, J. P. Halle, M. Bittner, T. Vogl, S. Kaesler, P. Bugnon, B. Reitmaier, S. Durka, et al 2001. The Ca2+-binding proteins S100A8 and S100A9 are encoded by novel injury-regulated genes. J. Biol. Chem. 276:35818.[Abstract/Free Full Text]
  46. Rammes, A., J. Roth, M. Goebeler, M. Klempt, M. Hartmann, C. Sorg. 1997. Myeloid-related protein (MRP) 8 and MRP14, calcium-binding proteins of the S100 family, are secreted by activated monocytes via a novel, tubulin-dependent pathway. J. Biol. Chem. 272:9496.[Abstract/Free Full Text]
  47. Vandal, K., P. Rouleau, A. Boivin, C. Ryckman, M. Talbot, P. A. Tessier. 2003. Blockade of S100A8 and S100A9 suppresses neutrophil migration in response to lipopolysaccharide. J. Immunol. 171:2602.[Abstract/Free Full Text]
  48. Ryckman, C., K. Vandal, P. Rouleau, M. Talbot, P. A. Tessier. 2003. Proinflammatory activities of S100: proteins S100A8, S100A9, and S100A8/A9 induce neutrophil chemotaxis and adhesion. J. Immunol. 170:3233.[Abstract/Free Full Text]
  49. Cheng, J., K. Turksen, Q. C. Yu, H. Schreiber, M. Teng, E. Fuchs. 1992. Cachexia and graft-vs.-host-disease-type skin changes in keratin promoter-driven TNF{alpha} transgenic mice. Genes Dev. 6:1444.[Abstract/Free Full Text]
  50. Starcher, B.. 2000. Role for tumour necrosis factor-{alpha} receptors in ultraviolet-induced skin tumours. Br. J. Dermatol. 142:1140.[Medline]
  51. Kondo, S., D. N. Sauder. 1997. Tumor necrosis factor (TNF) receptor type 1 (p55) is a main mediator for TNF-{alpha}-induced skin inflammation. Eur. J. Immunol. 27:1713.[Medline]
  52. Mori, R., T. Kondo, T. Ohshima, Y. Ishida, N. Mukaida. 2002. Accelerated wound healing in tumor necrosis factor receptor p55-deficient mice with reduced leukocyte infiltration. FASEB J. 16:963.[Abstract/Free Full Text]
  53. Jensen, J. M., S. Schutze, M. Forl, M. Kronke, E. Proksch. 1999. Roles for tumor necrosis factor receptor p55 and sphingomyelinase in repairing the cutaneous permeability barrier. J. Clin. Invest. 104:1761.[Medline]
  54. Alcamo, E., J. P. Mizgerd, B. H. Horwitz, R. Bronson, A. A. Beg, M. Scott, C. M. Doerschuk, R. O. Hynes, D. Baltimore. 2001. Targeted mutation of TNF receptor I rescues the RelA-deficient mouse and reveals a critical role for NF-{kappa}B in leukocyte recruitment. J. Immunol. 167:1592.[Abstract/Free Full Text]
  55. Lebwohl, M.. 2003. Psoriasis. Lancet 361:1197.[Medline]



This article has been cited by other articles:


Home page
Cancer Res.Home page
E. E.W. Cohen, H. Zhu, M. W. Lingen, L. E. Martin, W.-L. Kuo, E. A. Choi, M. Kocherginsky, J. S. Parker, C. H. Chung, and M. R. Rosner
A Feed-Forward Loop Involving Protein Kinase C{alpha} and MicroRNAs Regulates Tumor Cell Cycle
Cancer Res., January 1, 2009; 69(1): 65 - 74.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Cataisson, R. Ohman, G. Patel, A. Pearson, M. Tsien, S. Jay, L. Wright, H. Hennings, and S. H. Yuspa
Inducible Cutaneous Inflammation Reveals a Protumorigenic Role for Keratinocyte CXCR2 in Skin Carcinogenesis
Cancer Res., January 1, 2009; 69(1): 319 - 328.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
O. H. Mortensen, K. Andersen, C. Fischer, A. R. Nielsen, S. Nielsen, T. Akerstrom, M.-b. Aastrom, R. Borup, and B. K. Pedersen
Calprotectin is released from human skeletal muscle tissue during exercise
J. Physiol., July 15, 2008; 586(14): 3551 - 3562.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Scortegagna, C. Cataisson, R. J. Martin, D. J. Hicklin, R. D. Schreiber, S. H. Yuspa, and J. M. Arbeit
HIF-1{alpha} regulates epithelial inflammation by cell autonomous NF{kappa}B activation and paracrine stromal remodeling
Blood, April 1, 2008; 111(7): 3343 - 3354.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
S. Teske, A. A. Bohn, J. P. Hogaboam, and B. P. Lawrence
Aryl Hydrocarbon Receptor Targets Pathways Extrinsic to Bone Marrow Cells to Enhance Neutrophil Recruitment during Influenza Virus Infection
Toxicol. Sci., March 1, 2008; 102(1): 89 - 99.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. Gundewar, J. W. Calvert, J. W. Elrod, and D. J. Lefer
Cytoprotective effects of N,N,N-trimethylsphingosine during ischemia- reperfusion injury are lost in the setting of obesity and diabetes
Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2462 - H2471.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. Kawakami, M. Aikawa, N. Nitta, M. Yoshida, P. Libby, and F. M. Sacks
Apolipoprotein CIII-Induced THP-1 Cell Adhesion to Endothelial Cells Involves Pertussis Toxin-Sensitive G Protein- and Protein Kinase C{alpha}-Mediated Nuclear Factor-{kappa}B Activation
Arterioscler Thromb Vasc Biol, January 1, 2007; 27(1): 219 - 225.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. M. Challacombe, A. Suhrbier, P. G. Parsons, B. Jones, P. Hampson, D. Kavanagh, G. E. Rainger, M. Morris, J. M. Lord, T. T. T. Le, et al.
Neutrophils Are a Key Component of the Antitumor Efficacy of Topical Chemotherapy with Ingenol-3-Angelate
J. Immunol., December 1, 2006; 177(11): 8123 - 8132.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
H. Lu, W. Ouyang, and C. Huang
Inflammation, a Key Event in Cancer Development
Mol. Cancer Res., April 1, 2006; 4(4): 221 - 233.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
W. G. Tharp, R. Yadav, D. Irimia, A. Upadhyaya, A. Samadani, O. Hurtado, S-Y. Liu, S. Munisamy, D. M. Brainard, M. J. Mahon, et al.
Neutrophil chemorepulsion in defined interleukin-8 gradients in vitro and in vivo
J. Leukoc. Biol., March 1, 2006; 79(3): 539 - 554.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. A. Lokuta and A. Huttenlocher
TNF-{alpha} promotes a stop signal that inhibits neutrophil polarization and migration via a p38 MAPK pathway
J. Leukoc. Biol., July 1, 2005; 78(1): 210 - 219.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cataisson, C.
Right arrow Articles by Yuspa, S. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cataisson, C.
Right arrow Articles by Yuspa, S. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS