The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Roos, C.
Right arrow Articles by Walter, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roos, C.
Right arrow Articles by Walter, L.
The Journal of Immunology, 2005, 174: 970-975.
Copyright © 2005 by The American Association of Immunologists

The Rat Expresses Two Complement Factor C4 Proteins, but Only One Isotype Is Expressed in the Liver1

Christian Roos*, Ralf Dressel{dagger}, Bernhard Schmidt{ddagger}, Eberhard Günther2,{dagger} and Lutz Walter3,*,{dagger}

* Forschergruppe Primatengenetik, Deutsches Primatenzentrum, and Abteilung {dagger} Immungenetik and {ddagger} Biochemie II, Universität Göttingen, Göttingen, Germany


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The complement component C4 is well known for its complex genetics in human and mouse where it is part of a tandemly duplicated module. For the rat, no such information had been available until recently. A C4 gene duplication could be identified also in the rat, but the duplicated module maps ~200 kb centromerically from the canonical C4-1 gene. In this study, we present the genomic organization of the two C4 gene-containing modules and the expression of the two C4 genes in the rat (Rattus norvegicus). The duplicated module contains an intact C4 gene as well as Cyp21 and Stk19 pseudogenes. Quantitative mRNA expression analyses revealed that both C4 genes are transcribed in various organs and tissues, but displaying ample differences of C4-1 and C4-2 expression. Most notably, C4-2 is not expressed in the liver. At variance to the mouse, the expression of the rat C4 genes does not exhibit any sex dependency. By using two-dimensional gel electrophoresis and mass spectrometry, products of both C4 genes could be identified in rat serum samples. These two rat C4 isotypes are nearly identical, but differ in a functionally important amino acid residue that is known to influence the functional properties of the C4 isotypes in human.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The complement factor C4 is synthesized as a single chain that is subsequently processed into three chains ({alpha}, {beta}, {gamma}) that are covalently bound to each other and represent the inactive form of C4 in the plasma. Activation of C4 is achieved by proteolytic cleavage of a 76-aa residue peptide from the amino-terminal end of the {alpha}-chain, resulting in the C4a molecule that functions as anaphylatoxin and the C4b molecule that is a subunit of the C3 and C5 convertases. These convertases play an important role in complement activation as they activate C3 and C5 that function as opsonin and initiate the membrane attack complex (1, 2, 3).

In humans and mice, the C4 gene is part of a module designated RCCX that maps to the class III region of the MHC. This module encompasses four consecutive genes coding for the serine/threonine kinase 19 (STK19, or RP), the fourth complement component (C4), the steroid 21-hydroxylase (CYP21), and the tenascin X (TNX), respectively (3, 4). In both species, tandem-like duplications of this module can be observed frequently. In particular, in humans the genetics of this module is complex, displaying various numbers (up to three) of modules per haplotype, variations in the C4 gene length and allelic nucleotide substitutions (4). Interestingly, in the duplicated modules only the C4 copies are intact and expressed, while the copies of the other three genes represent pseudogenes. Thus, complement factor C4 exists in two isotypes in humans, C4A and C4B, that are >99% identical. However, they differ with respect to certain functional properties such as binding to immune complexes and hemolytic activity. C4A and C4B contain an acidic (D) and a basic (H) residue, respectively, at amino acid position 1106, and this position was previously shown to be responsible for the observable functional differences of these two isotypes (1).

In the mouse, the duplicated C4 gene is expressed in males only, because its expression is controlled by a testosterone-responsive retroviral element (5). Therefore, this gene has been designated sex-limited protein gene (Slp).4 Although SLP is abundant in male serum of certain H2 haplotypes and exhibits 95% identity with C4, its contribution to complement C4 function is rather low or even absent (6). Moreover, due to a frameshift deletion, Slp has become a pseudogene in the H2b haplotype (see DDBJ/GenBank/EMBL database accession number AF049850).

Recently, we have reported the genomic structure (7, 8, 9) and complete sequence (10) of the rat MHC, the RT1 complex. The rat C4 gene was found to be duplicated, but not in tandem as in humans or mice. The duplicated C4 gene, C4-2 (also designated C4l), occurs as part of a duplicated module, which could be mapped adjacent to the class II region between the Btnl and Notch4 genes (9). This module further contains a copy of the Cyp21 and Stk19 genes as in human, but no evidence for the presence of a duplicated Tnx gene was obtained. As the duplication of the C4 genes was previously unknown, functional studies in the rat usually assumed the presence of only a single C4 protein. In this paper, we could demonstrate the expression of both rat C4 genes in various tissues with different amounts of C4-1 and C4-2 mRNA, as well as the presence of both rat C4 isotypes in the serum.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals

Serum and organ samples were obtained from adult males and females of inbred rat strain LEW.1N/Gun (RT1n haplotype).

Expression analysis

Total RNA was isolated according to the method described by Chomczynski and Sacchi (11). For Northern blot analysis, 15 µg of total RNA was separated in 1.2% formaldehyde-agarose gels, stained with ethidium bromide, and subsequently blotted onto nitrocellulose membranes (Schleicher und Schüll). Hybridization of the blots was conducted overnight in hybridization solution (6x SSC, 5x Denhardt’s solution, 0.5% SDS, 10% dextrane sulfate) at 60°C and two washing steps were conducted for 15 min in washing buffer (2x SSC, 0.1% SDS) at 65°C. Exposure of the blots was for 3 days at –70°C. The C4 gene probe encompasses 316 bp and is derived from exons 40 and 41 (including the complete 3'utr). The probe was generated by RT-PCR using LEW.1N/Gun liver cDNA and primers GCAACTTTCTGGTCCGGGCC and TGCAGGGCCTGCTTAACAGG. According to the genomic sequence data of both genes, no primer mismatch occurs for C4-1 and C4-2 and, therefore, amplificates of both genes are expected to be present in the PCR product. The respective amplificates are 98% identical, implying a high degree of cross-hybridization and no specific detection of either C4-1 or C4-2. After stripping off the C4-1/C4-2 probe using boiling 0.1% SDS, the blot was rehybridized with a {beta}-actin probe as loading control. Exposure of the {beta}-actin blot was overnight at –70°C.

For quantitative RT-PCR, 2.4 µg of total RNA was reverse transcribed using oligo(dT) primer GACTCGAGTCGACATCGA(T)17 as well as 200 U of Reverse Transcriptase (Promega) and 1.6 ng of first-strand cDNA was used as template. Oligonucleotides C4-TaqMan-5 (CTCAAGGGAGACCCCCAGTAC; positions 5062–5082 in database accession numbers BX883045 and BX883044 for C4-1 CDS and C4-2 CDS, respectively) and C4-TaqMan-3 (AGGCGCTCAGATGGCATCT; positions 5111–5129 in database accession numbers BX883045 and BX883044 for C4-1 CDS and C4-2 CDS, respectively) were used for the amplification of both C4-1- and C4-2-derived transcripts. Separate detection of these amplificates was accomplished by using differently labeled minor groove binder (MGB) probes either specific for C4-1 (6-FAM-ACTCAAATACTTGGATCGA-MGB) or C4-2 (VIC-CTCAAACAGTTTGGATCG-MGB). Real-time PCR was conducted with a TaqMan Universal PCR Master Mix (Applied Biosystems) using a 7500 Real-Time PCR System (Applied Biosystems). The following PCR profile was applied: incubation for 2 min at 50°C, then initial denaturation of 10 min at 95°C, followed by 45 cycles of 15 s at 95°C and 1 min at 60°C. Because the amount of a product is doubled in each cycle of the exponential phase of the PCR, we used the difference in cycle threshold values to compare the mRNA expression of C4-1 and C4-2. The following formula was used to calculate the degree of overexpression (n): n = 2x, where x is the difference in cycle threshold values between the C4-1 and C4-2 transcripts.

Establishment of recombinant C4 protein and polyclonal mouse anti-rat C4 Abs

A part of the rat C4 {alpha}-chain was used for the recombinant expression in bacteria. Primers CCTTGGAGACTTTGGGCTCT and GTGGTTGTTCAGCTGTAGCA were used in RT-PCR with LEW.1N/Gun liver cDNA and amplified a product of 1094 bp. This product was digested with restriction enzymes BamHI and HindIII, resulting in a 715-bp fragment that was subsequently cloned in the bacterial expression vector pQE32 (Qiagen) that carries a His tag sequence. This construct comprises 238 codons representing amino acid positions 1051–1289 of the C4 protein. Recombinant protein was prepared from inclusion bodies according to the method described by Georgiou and Valax (12). Mice (inbred strains C57BL/6, BALB/c, 129/Sv) were immunized with 100 µg of recombinant C4 protein and were boostered in 2-wk intervals with 50 µg of protein. Small serum samples were collected 2 wks after each immunization and were tested for reaction with the recombinant C4 protein by ELISA (data not shown). Two weeks after the third immunization, mice were sacrificed and anti-C4 antisera were obtained.

Two-dimensional gel electrophoresis and immunoblotting

Proteins were precipitated from 10 µl of BN rat serum and washed with ice-cold 80% acetone and dissolved in isoelectric focusing (IEF) lysis buffer (9 M urea, 4% CHAPS, 0.8% Servalyt carrier ampholytes pH 4–7 (Serva Electrophoresis), 0.2% Servalyt carrier ampholytes pH 3–10 (Serva Electrophoresis), 10 mM DTT). IEF was conducted in 15-cm tube gels (diameter of 0.3 cm) containing 5.2% acrylamide, 0.3% bisacrylamide, 5.7% Servalyt carrier ampholytes pH 4–7 (Serva Electrophoresis), 1.4% Servalyt carrier ampholytes pH 3–10 (Serva Electrophoresis), 10.8 M urea, and 3% CHAPS, polymerized with 0.04% ammonium persulfate and 0.2% N,N,N',N'-tetramethylethylenediamine (Serva Electrophoresis). The anode buffer contained 0.01 M HB3POB4, the cathode buffer 0.02 M NaOH. IEF was run for 30 min at 200 V, 18.2 h at 500 V, 1 h at 800 V, and 1 h at 1000 V. After removal from the tube, the gel was successively equilibrated for 20 min in 0.05 M Tris, pH 6.8, 15% glycerol, 4% SDS, and 0.25% DTT, and for 20 min in 0.05 M Tris, pH 6.8, 30% glycerol, 6 M urea, 4% SDS, and 25 mM iodoacetamide, and then used immediately for SDS-PAGE performed according to Laemmli on 15% polyacrylamide gels. The electrophoresis conditions were 10 mA for 45 min, 15 mA for 30 min followed by 30 mA for 3 h. For immunoblotting, proteins were blotted on a nitrocellulose membrane as described previously (13). Blots were cut into four equal pieces and incubated with the specific mouse anti-rat C4 antiserum at a dilution of 1/100 and subsequently with HRP-conjugated goat anti-mouse IgG Ab (The Jackson Laboratory, Dianova) at a dilution of 1/2000. The substrate reaction was carried out with 0.05% 3,3'-diaminobenzidine/0.003% H2O2 in PBS/0.05% Tween 20.

The gel prepared for analysis by MALDI-TOF mass spectrometry was stained with colloidal Coomassie (Roti-Blue; Roth) according to supplier’s instructions.

Mass spectrometry and database search

In the Coomassie-stained two-dimensional gel the two protein spots detected at isoelectric point (pI) 5.6 and 5.8 and the molecular mass of 94 kDa were excised with a 2-mm punch, washed, in-gel reduced, carbamidomethylated, and digested with an excess of trypsin overnight at 37°C (14). After extraction from the gel with 1% trifluoroacetic acid, peptides were desalted on C18 ZipTip (Millipore) and 0.5-µl aliquots of the total digest (10 µl) were spotted on an anchorchip target (Bruker Daltonik) for MALDI-TOF mass spectrometry using dihydrobenzoic acid as matrix. MALDI-TOF mass spectra of peptide mixtures were obtained on a REFLEX III mass spectrometer (Bruker Daltonik). Monoisotopic peptide masses were assigned and the mass lists used for protein identification in the NCBlnr protein database by Mascot search algorithm (Matrix Science).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Genomic organization of the duplicated Stk19-C4-Cyp21 module in the rat MHC

According to our previously published data, the module containing the canonical C4 gene of the rat is found at the expected position between the Crebl1 and Skiv2l genes, whereas the duplicated C4 gene-containing module maps to the centromeric part of the rat MHC class III region between the Btnl gene cluster and Notch4 (9, 10). The genomic organization of both modules is shown schematically in Fig. 1. In the duplicated module, Cyp21a1-ps and Stk19-ps are only partially present and, therefore, represent pseudogenes. The C4-1 and C4-2 genes are organized in 41 exons and encompass 14.3 kb and 14.0 kb, respectively. The coding sequences are 97% identical at the nucleotide (data not shown) and the amino acid level (Fig. 2). The rat complement C4 sequence stored in the database (C.-B. Chen and R. Wallis, unpublished data, GenBank accession number AY149995) corresponds to C4-1.



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 1. Schematic organization of the two C4 gene-containing modules in the rat MHC. Only exons 1 and 2 and exons 4–7 are present in the Cyp21a1-ps and Stk19-ps pseudogenes, respectively. The localization of the rat MHC class I regions (RT1-A, RT1-CE/N/M), the class II (RT1-B/D), and the class III region is shown. The Tnx, Rdbp, and Notch4 genes extend over the displayed genomic interval.

 


View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 2. Comparison of the deduced amino acid sequences of rat C4-1 and C4-2. Amino acid residues are shown in one letter code and identical residues are indicated by a dash. The functional important histidine and glutamine residues are marked by a gray box. The anaphylatoxic peptide is shown in italics and the residues that are involved in the highly reactive thioester bond are in bold. The leader peptide encompasses residues 1–19, and the {beta}-, {alpha}-, and {gamma}-chains include residues 20–673, 678-1439, and 1447–1737, respectively.

 
According to Carroll and colleagues (1), the functional differences between the human C4A and C4B proteins can be attributed to a difference at amino acid position 1106 (position 1125 including the leader sequence), where C4A displays an acidic residue (aspartic acid) and C4B a basic residue (histidine). Interestingly, also the deduced amino acid sequences of rat C4-1 and C4-2 differ at the corresponding position showing a histidine and a glutamine residue, respectively (Figs. 2 and 3). The C4a peptides derived from C4-1 and C4-2 are identical (Fig. 2, positions 679–753), implying identical functional properties of these anaphylatoxins. Similarly, in both rat C4 protein sequences the highly reactive thioester bond is constituted by residues Cys-Ala-Glu-Gln (Fig. 2), where the bond itself is between the cysteine and glutamine residues (15). The same residues are found in the mouse C4 and SLP proteins, whereas Cys-Gly-Glu-Gln is present in human C4A and C4B. With respect to those amino acid residues in the human C4 isotypes that determine the Chido and Rodgers (Ch/Rg) blood group Ags, no differences between the rat C4-1- and C4-2-deduced amino acid sequences can be detected (data not shown).



View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 3. Comparison of the functionally important amino acids (highlighted in gray) in rat, human, and mouse C4 isotypes. Numbering includes the leader sequence.

 
Expression analysis of C4-1 and C4-2 on the mRNA level

The expression of the rat C4-1 and C4-2 genes was first monitored by Northern blot analysis using a probe that is expected to react with transcripts of both genes (see Materials and Methods). Strong hybridization signals could be detected in rat liver, lung, thymus, and spleen, and weak signals in small intestine, kidney, heart, skeletal muscle, brain, and testis, whereas no hybridization was detected in Con A-stimulated lymphoblasts (Fig. 4A). To study the expression of the two rat C4 genes separately, we took advantage of nucleotide substitutions between C4-1 and C4-2 to construct gene-specific TaqMan probes for quantitative RT-PCR analysis (real-time PCR). Transcripts of both genes could be amplified from kidney, small intestine, lung, heart, brain, testis, thymus, lymphoblasts, and spleen (Fig. 4B). Interestingly, in the liver cDNA samples only C4-1 gene-derived amplificates could be detected (Fig. 4, B and C). With respect to the other organs with strong C4 expression (Fig. 4A), C4-1 is ~11 times more expressed in the lung than C4-2, whereas in thymus and spleen the variance in expression of the two C4 genes is not so pronounced (Fig. 4, B and C). Remarkably, in skeletal muscle the general C4 expression is low (Fig. 4A), but C4-2 expression substantially exceeds that of C4-1 (Fig. 4, B and C). A similar pattern of C4-1 and C4-2 mRNA expression was obtained from other inbred and RT1 congenic strains (data not shown). In contrast to the mouse, the rat C4-1 and C4-2 cDNA could be amplified from samples of both sexes (data not shown). This suggests that the retroviral insertion that is responsible for the male-specific expression of the Slp gene was a mouse-specific event.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 4. Expression analysis of C4 genes in various rat organs. A, Northern blot analysis was performed with a probe that detects both C4-1- and C4-2-derived transcripts. For loading control, the blot was rehybridized with a {beta}-actin probe. B, Level of C4-1 and C4-2 mRNA expression according to real-time PCR analysis with TaqMan probes that allow specific detection of either C4-1 or C4-2. A representative of three independent experiments is shown. *, Indicates that C4-2 mRNA could not be measured. C, Real-time PCR amplification curves are shown for liver, spleen, and skeletal muscle cDNA samples.

 
As the liver sample revealed a surprising expression pattern, we analyzed the rat C4-1 and C4-2 promoters for the occurrence of transcription factor binding sites that have been previously described in a region 150 bp distally of the transcriptional start site in the human C4 genes (16, 17). Basal transcription of the two human C4 genes was attributed to the CACCC and E boxes as well as NF-1 and Sp1 transcription factor binding sites (16, 17). Particularly, the NF-1 site and the E box were responsible for basal transcription in hepatic cells. Comparing the rat C4-1 and C4-2 promoters, no differences can be observed in any of these well-characterized regulatory elements (Fig. 5), indicating that the drastic differential expression of C4-1 and C4-2 in the liver might not be due to differences in cis-acting elements. Furthermore, the IFN-{gamma}-responsive element is conserved among the rat and human C4 genes, suggesting that both rat C4 genes might be inducible by IFN-{gamma}.



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 5. Comparison of the complement C4 gene promoter regions in human and rat. Identical nucleotides are indicated by a dash. Gaps are introduced to maximize homology. Known transcription factors binding sites according to Vaishnaw et al. (16 ) and Ulgiati et al. (17 ) are indicated.

 
Expression analysis of C4-1 and C4-2 on the protein level

We next addressed the question whether both C4 genes are also expressed on the protein level in rat serum, in particular the product of the C4-2 gene that does not exhibit mRNA expression in the liver. For this purpose, we produced a recombinant rat C4 protein that encompasses a part of the C4 {alpha}-chain, and immunized mice to obtain polyclonal Abs. In immunoblot analysis, this mouse anti-rat C4 antiserum reacts specifically with the C4 {alpha}-chain from the rat serum sample at the expected length of ~94 kDa (Fig. 6, arrow). C4-1- and C4-2-derived {alpha}-chains cannot be discriminated as the difference in molecular mass between both chains is too low to be resolved by conventional SDS-PAGE. However, these two chains differ in their (theoretical) pI, being 5.77 for C4-1 and 5.61 for C4-2. We made use of this difference by applying two-dimensional gel electrophoresis and subsequent immunoblotting. Indeed, two spots that react with the C4 antiserum can be detected at pI 5.6 and 5.8 and the expected molecular mass of ~94 kDa (Fig. 6, arrowheads), suggesting that both rat C4 genes are expressed on the protein level. Interestingly, the spot at pI 5.8 gave an ~3–4 times stronger signal, indicating that complement C4-1 is more abundant in rat serum than C4-2.



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 6. Immunoblot analysis of rat serum sample after separation by two-dimensional gel electrophoresis. Ten microliters of BN rat serum was separated in first dimension and subsequently in second dimension. As control, 0.5 µl of BN serum was separated only in the second dimension. The mouse anti-C4 antiserum was used at a dilution of 1/100.

 
The occurrence of two spots in the two-dimensional gel is not a formal proof of expression of both C4 proteins, as a single-expressed C4 protein might give rise to more than one spot due to posttranslational modifications that could result in subtle changes of the pI. Therefore, we stained the two-dimensional gel in a parallel experiment with Coomassie blue. We could indeed identify two spots in the area corresponding to the two spots that are detectable by immunoblotting. These two spots were cut out of the gel and digested by trypsin. The samples were subsequently analyzed by MALDI-TOF mass spectrometry to identify C4-1- and C4-2-derived peptides. Indeed, 3 C4-2-specific peptides and 10 peptides that do not discriminate between C4-1 and C4-2 could be identified from the spot isolated at pI 5.6 (representing C4-2). Similarly, three C4-1-specific peptides and seven nondiscriminating C4 peptides were identified from the spot at pI 5.8 (Table I). As expected, all identified peptides are derived from the C4-1 and C4-2{alpha}-chains. Thus, both rat C4 genes are expressed on the protein level and do occur in rat serum.


View this table:
[in this window]
[in a new window]
 
Table I. C4–1- and C4–2-derived peptides identified by MALDI-TOF mass spectrometry

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the classical and mannan-binding lectin pathways of complement activation, component C4 plays an important role in the activation of C3 and, hence, in the opsonization of pathogens. Furthermore, it is involved in the recruitment of phagocytes via release of the chemoattractant C4a anaphylatoxin. In humans and mice, complement C4 genetics is complex due to tandem-like amplifications and contractions of C4 gene-containing modules as well as C4 gene polymorphisms. In the rat, two C4 gene-containing modules are also present (9), however, different from human and mouse, the duplication is not tandem-like and the duplicated module maps to its partner ~200 kb centromerically (9, 10). As a consequence of this different organization, C4 genetics in the rat might not be as complex as in humans or mice and amplifications and contractions of C4 gene-containing modules might be a rare event. Indeed, we could not detect any variations so far in the number of C4 gene-containing modules in inbred rat strains BN/Gun, BUF/Gun, LEW/Gun, R21/Ztm, and RT1 congenic strains LEW.1A/Gun, LEW.1AV1/Ztm, LEW.1C/Ztm, LEW.1F/Ztm, LEW.1K/Ztm, LEW.1W/Gun by PCR (9) and Southern blot analysis (our unpublished results).

After uncovering the C4 gene duplication in the rat, it was of interest to analyze the expression of both C4 genes. In Northern blot experiments, an expression pattern similar to human and mouse C4 was found, with a high expression level in liver, spleen, lung, and thymus, and a low level in small intestine, kidney, heart, skeletal muscle, brain, and testis. Gene-specific TaqMan probes in real-time PCR allowed for the specific detection of either C4-1- or C4-2-derived transcripts. First of all, we could demonstrate that both rat C4 genes are expressed. Interestingly, the level of expression was found to differ considerably between C4-1 and C4-2. To our surprise, in the liver—a major site of complement C4 production—no C4-2-derived mRNA could be detected, whereas in thymus or spleen nearly equal amounts of C4-1 and C4-2 mRNA are present, and in lung and kidney, the proportion of C4-1 in overall C4 expression strongly exceeds that of C4-2. Thus, any C4-2 protein expression is presumably contributed mainly by cells of the spleen and the thymus.

In the mouse, the expression of one of the two C4 genes, the Slp gene, is restricted to males due to the presence of a testosterone-responsive retroviral element (5) that maps 2 kb upstream of Slp in intron 4 of the neighboring Stk19 gene. In the rat (at least in the BN rat that was sequenced) we did not find such a retroviral element in the C4-1 and the C4-2 gene or their genomic neighborhood (10). In accord with this finding, no male-restricted expression of either of the two rat C4 genes could be detected on the mRNA level (data not shown).

We were particularly interested in the detection of both rat C4 gene products. By using a recombinant rat C4 {alpha}-chain, we established mouse polyclonal Abs that react with both rat C4 isotypes in immunoblot. After applying two-dimensional gel electrophoresis of serum samples and subsequent immunoblotting, two distinct spots were detected that correspond to the C4-1- and C4-2-derived {alpha}-chains, which could be confirmed by detection of C4-1- and C4-2-specific peptides in MALDI-TOF mass spectrometry analysis. Thus, both rat C4 isotypes do exist in the serum, the major site of C4 occurrence. Due to the lack of hepatic C4-2 expression, C4-1 is more abundant in the serum than C4-2 and the occurrence of C4-2 in the serum is contributed by nonhepatic tissues, namely spleen and thymus.

In many inbred rat strains, various diseases occur spontaneously or can be induced experimentally (18, 19, 20). Therefore, the rat serves as an important animal model for various human diseases including complement-dependent autoimmune diseases, such as immune complex glomerulonephritis (21). In this respect, the presence of two rat C4 isotypes, which has not been known up to now, is a particularly important information for studies of the many rat disease models involving complement activation and future studies will show whether they differ functionally.


    Acknowledgments
 
The expert technical assistance of Martina Balleininger, Nicole Eiselt, Leslie Elsner, Elisabeth Munk, and Nico Westphal is gratefully acknowledged.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by a grant of the Göttingen Research Fund Medicine, Medical Faculty, University of Göttingen (to R.D.). Back

2 This paper is dedicated to Prof. Eberhard Günther, who died on February 20, 2004. Back

3 Address correspondence and reprint requests to Dr. Lutz Walter, Forschergruppe Primatengenetik, Deutsches Primatenzentrum, 37077 Göttingen, Germany. E-mail address: Tlwalter{at}gwdg.deT Back

4 Abbreviations used in this paper: Slp, sex-limited protein gene; IEF, isoelectric focusing; pI, isoelectric point; MGB, minor groove binder. Back

Received for publication September 16, 2004. Accepted for publication November 2, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Carroll, M. C., D. M. Fathallah, L. Bergamaschini, E. M. Alicot, D. E. Isenman. 1990. Substitution of a single amino acid (aspartic acid for histidine) converts the functional activity of human complement C4B to C4A. Proc. Natl. Acad. Sci. USA 87:6868.[Abstract/Free Full Text]
  2. Colten, H. R., F. S. Rosen. 1992. Complement deficiencies. Annu. Rev. Immunol. 10:809.[Medline]
  3. Blanchong, C. A., E. K. Chung, K. L. Rupert, Y. Yang, Z. Yang, B. Zhou, J. M. Moulds, C. Y. Yu. 2001. Genetic, structural and functional diversities of human complement components C4A and C4B and their mouse homologues, Slp and C4. Int. Immunopharmacol. 1:365.[Medline]
  4. Chung, E. K., Y. Yang, K. L. Rupert, K. N. Jones, R. M. Rennebohm, C. A. Blanchong, C. Y. Yu. 2002. Determining the one, two, three, or four long and short loci of human complement C4 in a major histocompatibility complex haplotype encoding C4A or C4B proteins. Am. J. Hum. Genet. 71:810.[Medline]
  5. Stavenhagen, J. B., D. M. Robins. 1988. An ancient provirus has imposed androgen regulation on the adjacent mouse sex-limited protein gene. Cell 55:247.[Medline]
  6. Beurskens, F. J., M. Tosi, T. Shiroisho, D. M. Robins, M. C. Carroll, H. van Dijk. 2000. Mouse complement components C4 and Slp act synergistically in a homologous hemolytic C4 assay. Eur. J. Immunol. 30:1507.[Medline]
  7. Walter, L., E. Günther. 2000. Physical mapping and evolution of the centromeric class I gene-containing region of the rat MHC. Immunogenetics 51:829.[Medline]
  8. Ioannidu, S., L. Walter, R. Dressel, E. Günther. 2001. Physical map and expression profile of genes of the telomeric class I gene region of the rat MHC. J. Immunol. 166:3957.[Abstract/Free Full Text]
  9. Walter, L., P. Hurt, H. Himmelbauer, R. Sudbrak, E. Günther. 2002. Physical mapping of the major histocompatibility complex class II and class III regions of the rat. Immunogenetics 54:268.[Medline]
  10. Hurt, P., L. Walter, R. Sudbrak, S. Klages, I. Müller, T. Shiina, H. Inoko, H. Lehrach, E. Günther, R. Reinhardt, H. Himmelbauer. 2004. The genomic sequence and comparative analysis of the rat major histocompatibility complex. Genome Res. 14:631.[Abstract/Free Full Text]
  11. Chomczynski, P., N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156.[Medline]
  12. Georgiou, G., P. Valax. 1999. Isolating inclusion bodies from bacteria. Methods Enzymol. 309:48.[Medline]
  13. Dressel, R., C. Grzeszik, M. Kreiss, D. Lindemann, T. Herrmann, L. Walter, E. Günther. 2003. Differential effect of acute and permanent heat shock protein (Hsp) 70 overexpression in tumor cells on lysability by cytotoxic T lymphocytes. Cancer Res. 63:8212.[Abstract/Free Full Text]
  14. Shevchenko, A., M. Wilm, O. Vorm, M. Mann. 1996. Anal. Chem. 68:850.[Medline]
  15. Law, S. K., A. W. Dodds. 1997. The internal thioester and the covalent binding properties of the complement proteins C3 and C4. Protein Sci. 6:263.[Medline]
  16. Vaishnaw, A. K., T. J. Mitchell, S. J. Rose, M. J. Walport, B. J. Morley. 1998. Regulation of transcription of the TATA-less human complement component C4 gene. J. Immunol. 160:4353.[Abstract/Free Full Text]
  17. Ulgiati, D., L. S. Subrata, L. J. Abraham. 2000. The role of Sp family members, basic krupple-like factor, and E box factors in the basal and IFN-{gamma} regulated expression of the human complement C4 promoter. J. Immunol. 164:300.[Abstract/Free Full Text]
  18. Günther, E.. 1999. Rat models of disease. Rat Genome 5:75.
  19. Günther, E., L. Walter. 2001. The major histocompatibility complex of the rat (Rattus norvegicus). Immunogenetics 53:520.[Medline]
  20. Fournie, G. J., B. Cautain, E. Xystrakis, J. Damoiseaux, M. Mas, D. Lagrange, I. Bernard, J. F. Subra, L. Pelletier, P. Druet, A. Saoudi. 2001. Cellular and genetic factors involved in the difference between Brown Norway and Lewis rats to develop respectively type-2 and type-1 immune-mediated diseases. Immunol. Rev. 184:145.[Medline]
  21. Heymann, W., D. B. Hackel, S. Harwood, S. G. Wilson, J. Hunter. 1959. Production of nephrotic syndrome in rats by Freund’s adjuvants and rat kidney suspensions. Proc. Exp. Biol. Med. 100:660.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Roos, C.
Right arrow Articles by Walter, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roos, C.
Right arrow Articles by Walter, L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS