The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ogilvie, R. L.
Right arrow Articles by Bohjanen, P. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ogilvie, R. L.
Right arrow Articles by Bohjanen, P. R.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
*Genetics Home Reference
The Journal of Immunology, 2005, 174: 953-961.
Copyright © 2005 by The American Association of Immunologists

Tristetraprolin Down-Regulates IL-2 Gene Expression through AU-Rich Element-Mediated mRNA Decay1

Rachel L. Ogilvie*, Michelle Abelson{dagger}, Heidi H. Hau*, Irina Vlasova{dagger}, Perry J. Blackshear§ and Paul R. Bohjanen2,{dagger},{ddagger}

* Microbiology, Immunology and Cancer Biology Graduate Program, Departments of {dagger} Microbiology and {ddagger} Medicine, University of Minnesota, Minneapolis, MN 55455; and § National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Posttranscriptional regulation of IL-2 gene expression at the level of mRNA decay is mediated by an AU-rich element (ARE) found in the 3'-untranslated region. We hypothesized that the ARE-binding protein tristetraprolin (TTP) regulates T lymphocyte IL-2 mRNA decay by interacting with the IL-2 ARE and targeting the transcript for decay. rTTP protein expressed in HeLa cells bound specifically to the IL-2 ARE with high affinity in a gel shift assay. In primary human T lymphocytes, TTP mRNA and protein expression were induced by TCR and CD28 coreceptor stimulation. Using a gel shift assay, we identified a cytoplasmic RNA-binding activity that was induced by TCR and CD28 coreceptor stimulation and bound specifically to the IL-2 ARE sequence. Using anti-TTP Abs, we showed by supershift that this inducible activity contained TTP. We also showed that insertion of the IL-2 ARE sequence into the 3'-untranslated region of a {beta}-globin reporter construct conferred TTP-dependent mRNA destabilization on the {beta}-globin reporter. To determine whether TTP also regulates IL-2 gene expression in vivo, we examined IL-2 expression in primary cells from wild-type and TTP knockout mice. Compared with their wild-type counterparts, TCR- and CD28-activated splenocytes and T cells from TTP knockout mice overexpressed IL-2 mRNA and protein. Also, IL-2 mRNA was more stable in activated splenocytes from TTP knockout mice compared with wild-type mice. Taken together, these data suggest that TTP functions to down-regulate IL-2 gene expression through ARE-mediated mRNA decay.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The expression of IL-2, an important T cell-derived immunoregulatory cytokine, is regulated precisely at transcriptional and posttranscriptional levels. Following T cell activation, IL-2 serves as an autocrine and paracrine growth factor involved in clonal T cell expansion, influences the magnitude and duration of an immune response, and contributes to the regulation of programmed cell death in T cells (1, 2, 3, 4). The aberrant production of IL-2 can disrupt T cell function by leading to the loss of T cell anergy and induction of autoimmunity (3, 5, 6). Due to the potent effects of IL-2 on T cells and other cells in the immune system, IL-2 mRNA and protein expression are precisely regulated at multiple levels. IL-2 mRNA expression is controlled by a balance between mRNA production through transcription and mRNA degradation through regulated mRNA turnover. The regulation of mRNA turnover is an important mechanism for controlling the duration of mRNA persistence in the cell and overall expression of a gene (7).

In T lymphocytes, integrated signals from the TCR and the CD28 coreceptor activate signal transduction cascades that lead to cooperative binding of several transcription factors that induce the expression of the IL-2 gene at the transcriptional level (1, 8). A less characterized but equally significant mechanism for regulating IL-2 expression occurs at the level of mRNA decay. Costimulation of TCR-activated T cells with an anti-CD28 Ab led to increased steady-state IL-2 mRNA levels in part through CD28-dependent stabilization of IL-2 mRNA (9). IL-2 mRNA decay is regulated by sequence elements found within the 5'-untranslated region (UTR),3 the coding region, and the 3'-UTR of the IL-2 transcript. The JNK-responsive element found in the 5'-UTR of the IL-2 transcript mediates IL-2 mRNA stabilization in response to JNK activation by interacting with the cellular proteins nucleolin and YB-1 (10, 11). Sequences in the IL-2 coding region have been shown to contribute to CD28-dependent regulation of IL-2 mRNA decay (12). The best characterized mRNA sequence element known to regulate IL-2 mRNA decay is the AU-rich element (ARE) found in the 3'-UTR of IL-2 mRNA (13).

AREs were identified as conserved sequences found in the 3'-UTR of a variety of transiently expressed genes including early response genes, protooncogenes, and several growth-regulatory genes (13, 14, 15, 16). AREs function as instability elements that target ARE-containing transcripts for rapid mRNA decay (16). AREs in a number of regulatory genes such as c-fos, c-myc, c-jun, GM-CSF, IL-3, and TNF-{alpha} have been shown to regulate mRNA decay (16, 17, 18, 19, 20, 21, 22, 23, 24, 25). ARE-dependent mRNA turnover is mediated by trans-acting proteins that bind to the ARE; some ARE-binding proteins target the transcript for degradation, whereas others mediate transcript stabilization (13, 26, 27).

ARE-binding proteins, such as HuR, NF90, and tristetraprolin (TTP), are expressed in T cells (28, 29). HuR and NF90 function to stabilize ARE-containing transcripts, whereas TTP functions to mediate their rapid decay (27, 29, 30, 31). The role of TTP in the regulation of ARE-mediated mRNA decay was established in studies of TTP knockout mice. These mice are normal at birth but develop a syndrome of cachexia, dermatitis, and inflammatory arthritis due to overproduction of TNF-{alpha} (27). Macrophages derived from TTP knockout mice exhibited abnormal stabilization of TNF-{alpha} mRNA leading to overproduction of the TNF-{alpha} protein (27). Lai et al. (32) demonstrated that TTP binds to the TNF-{alpha} ARE in vitro, and overexpression of TTP leads to the deadenylation and decay of the TNF-{alpha} transcript, further demonstrating a functional role for TTP in mediating the decay of ARE-containing transcripts. TTP has been shown to regulate the decay of other ARE-containing transcripts such as GM-CSF and IL-3 (33, 34). Thus, TTP is an important regulator of ARE-dependent mRNA decay (27).

Because TTP plays an important role in regulating cytokine expression in macrophages, it is likely that similar mechanisms exist in T cells to regulate the decay of important T cell-derived cytokines such as IL-2. Previously, it has been demonstrated that rTTP facilitates the decay of a transcript that contains the human IL-2 3'-UTR in a cell-free RNA decay assay (35). TTP-mediated mRNA decay may provide a mechanism to rapidly turn off IL-2 expression at the appropriate time following T cell activation to down-modulate an immune response. Because IL-2 expression needs to be tightly controlled for proper T cell function and immune homeostasis, we sought to determine whether TTP regulates IL-2 mRNA turnover in an ARE-dependent manner (33, 34). In this report, experiments were performed to determine whether TTP regulates IL-2 gene expression in T lymphocytes. We found that TTP mRNA and protein were rapidly induced in primary human T lymphocytes following T cell activation and that TTP bound specifically and with high affinity to the IL-2 ARE. Insertion of the IL-2 ARE sequence into the 3'-UTR of a {beta}-globin reporter construct conferred TTP-dependent mRNA destabilization on the {beta}-globin reporter. Splenocytes or purified T cells derived from TTP knockout mice overproduced IL-2, and IL-2 mRNA was more stable in splenocytes derived from TTP knockout mice compared with wild-type mice, suggesting that TTP functions to down-regulate IL-2 gene expression at the level of mRNA decay in vivo. Overall, the data presented in this report indicate that TTP down-regulates IL-2 mRNA expression through ARE-mediated mRNA decay.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Stimulation of primary human T lymphocytes

Human T lymphocytes were purified from buffy coat white blood cell packs obtained from the American Red Cross using T cell enrichment columns (R&D Systems) or RosetteSep reagents (StemCell Technologies) according to the manufacturer’s instructions. The resulting cell population consisted of 90–98% T lymphocytes based on anti-CD3 Ab staining (BD Biosciences) assessed by flow cytometry using a FACSCalibur (BD Biosciences) flow cytometer. These cells were cultured overnight at 37°C in the presence of 5% CO2 in RPMI 1640 medium (Invitrogen Life Technologies) supplemented with 10% FCS, 2 mM L-glutamine, 100 U/ml penicillin G, and 100 µg/ml streptomycin. Purified T cells were stimulated with medium alone or with immobilized anti-CD3 and immobilized anti-CD28 Abs. Ab stimulations were performed by culturing T cells in Falcon 150 x 25 mm tissue culture dishes (BD Biosciences) that had been coated at 4°C overnight with a suspension containing 1 µg/ml mAb directed against human CD3 (R&D Systems) and 1 µg/ml mAb directed against human CD28 (R&D Systems) in PBS.

Stimulation of primary murine splenocytes and T cells

Generation of homozygous TTP knockout mice has been described previously (36). Spleens from wild-type or TTP knockout C57BL/6 x 129 mice were crushed and splenocytes were isolated by centrifugation over a Lympholyte-M (Cedarlane Laboratories) cushion, and RBC were removed by hypotonic lysis (R&D Systems). Murine CD3-positive T cells were purified from the splenocyte population using SpinSep reagents (StemCell Technologies) according to the manufacturer’s instructions. Murine splenocytes and T cells were incubated with CD16/CD32 to block the FcRs and then were stained with the following Abs: anti-CD3{epsilon}, anti-CD4, anti-CD8, anti-CD11b, and anti-CD45R/B220 (BD Biosciences), and analyzed by flow cytometry using a FACSCalibur (BD Biosciences) flow cytometer. Murine splenocytes or T cells were cultured overnight at 37°C in the presence of 5% CO2 in RPMI 1640 medium (Invitrogen Life Technologies) supplemented with 10% FCS, 2 mM L-glutamine, 100 U/ml penicillin G, 100 µg/ml streptomycin, and 50 µM 2-ME. Purified splenocytes or T cells were stimulated with medium alone or immobilized murine anti-CD3 Abs or a combination of immobilized anti-CD3 and anti-CD28 Abs. Ab stimulations were performed by culturing splenocytes or T cells in Falcon 150 x 25-mm tissue culture dishes (BD Biosciences) that had been coated overnight at 4°C with 10 ml of a suspension containing 1 µg/ml mAb directed against murine CD3{epsilon} (R&D Systems) with or without 1 µg/ml mAb directed against murine CD28 (BD Pharmingen). IL-2 concentrations in culture supernatants were measured by ELISA using the Pharmingen OptEIA mouse IL-2 set (BD Pharmingen) according to the manufacturer’s instructions.

RNA probes and competitors

RNA oligonucleotides were purchased commercially (Dharmacon Research, Boulder, CO). The sequence for each RNA oligonucleotide was as follows: IL-2 ARE, UAUUUAUUUAAAUAUUUAAAUUUUAUAUUUAU; GMCSF ARE, AUUUAUUUAUUUAUUUAUUUA; c-myc1, UUACCAUCUUUUUUUUUCUUUA; c-myc2, AAUUUUAAGAUUUACACAAUGU; and mutated GM-CSF ARE sequences M1, UUUUUUUUUUUUUUUUUUUUU, and M8, ACUCACUCACUCACUCACUCA. The IL-2 ARE RNA oligonucleotide was end-labeled with [{gamma}-32P]ATP (6000 Ci/mmol) using T4 polynucleotide kinase to produce a radiolabeled probe with a specific activity of ~4 x 106 cpm/µg.

Gel shift and supershift assays

Cytoplasmic extracts were prepared by lysing cells in a buffer containing 0.2% Nonidet P-40, 40 mM KCl, 10 mM HEPES (pH 7.9), 3 mM MgCl2, 1 mM DTT, 5% glycerol, 8 ng/ml aprotinin, 2 ng/ml leupeptin, and 0.5 mM PMSF. Nuclei were removed by centrifugation at 14,000 rpm for 2 min in an Eppendorf microcentrifuge, and cytoplasmic extracts were immediately frozen on dry ice and stored at –80°C. The protein concentration of the extracts was determined by a colorimetric assay using a commercially available reagent (Bio-Rad) according to the manufacturer’s instructions. Gel shift assays were conducted by incubating cytoplasmic extracts with the 32P-labeled IL-2 ARE RNA probe at room temperature for 20–30 min in a buffer containing 0.2% Nonidet P-40, 40 mM KCl, 10 mM HEPES (pH 7.9), 3 mM MgCl2, 1 mM DTT, and 5% glycerol in the presence of 5 mg/ml heparan sulfate (Sigma-Aldrich). Each reaction contained 8–10 µg of cytoplasmic protein, and 15–35 fmol of radiolabeled IL-2 RNA probe in a total volume of 20–24 µl. For supershift assays, specific Abs or control Abs were added to the reaction mixtures. The anti-TTP (N-18) Ab used was raised against the N terminus of human TTP and an anti-actin (C-11) was used as a control; both were affinity-purified goat polyclonal Abs that were purchased commercially (Santa Cruz Biotechnologies). The anti-hemagglutinin (HA) (Y-11) Ab: and the anti-Akt1/2 (H-136) control Abs were both affinity-purified rabbit polyclonal Abs (Santa Cruz Biotechnologies). The reaction mixtures were incubated for another 20 min at room temperature. Gel shift and supershift assays were separated under nondenaturing conditions on 5% polyacrylamide gels using 0.5% Tris-borate EDTA running buffer. The gels were dried and analyzed on a PhosphorImager (Molecular Dynamics). Where indicated, the binding intensity of the RNA-protein complexes and free RNA were quantified using Image-Quant, version 5.2, software (Molecular Dynamics). GraphPad Prism, version 4.00 for Windows (GraphPad Software), was used to graph binding data and calculate the apparent affinity using a homologous competition with depletion one-site binding model.

For UV cross-linking assays, cytoplasmic extracts (10 µg) were incubated with 15–35 fmol of 32P-labeled IL-2 ARE RNA probe at room temperature for 30 min in a buffer containing 0.2% Nonidet P-40, 40 mM KCl, 10 mM HEPES (pH 7.9), 3 mM MgCl2, 1 mM DTT, and 5% glycerol in the presence of 5 mg/ml heparan sulfate (Sigma-Aldrich) and 0.42 µM unlabeled M1 (poly-U RNA) in a total volume of 24 µl. The reaction mixtures were irradiated with 254-nm UV light using a Stratalinker UV cross-linking apparatus (Stratagene) and were separated on 10% SDS-polyacrylamide gels. The gels were dried and analyzed on a PhosphorImager (Molecular Dynamics).

Real-time PCR

Total cellular RNA was prepared from human T cells, mouse splenocytes, or mouse T cells using TRIzol reagent (Invitrogen Life Technologies) according to the manufacturer’s directions. RNA was additionally purified using the Absolutely RNA RT-PCR Miniprep kit (Stratagene), including DNase treatment, according to the manufacturer’s instructions. cDNA used for real-time PCR analysis was then synthesized from total cellular RNA using StrataScript reverse transcriptase (Stratagene) and oligo(dT) or transcript-specific primers. PCR amplifications were then performed using the QuantiTect SYBR Green PCR kit (Qiagen) according to the manufacturer’s instructions. Transcript-specific oligonucleotide primers used for the PCR amplifications are listed as sense followed by antisense: mouse IL-2, AAAAGCTTTCAATTGGAAGATGCTG, TTGAGGGCTTGTTGAGATGA; and mouse hypoxanthine phosphoribosyltransferase (HPRT), GGTGAAAAGGACCTCTCGAA, AGTCAAGGGCATATCCAACA. All primers were purchased commercially from Integrated DNA Technologies. PCR amplification was performed using a Bio-Rad iCycler thermocycler, and the data were analyzed using iCycler software. Standard curves were generated to determine the level of each amplified transcript, and all data were then normalized to the level of the HPRT transcript.

Expression of TTP in HeLa cells

To overexpress TTP, HeLa cells were grown in monolayers in DMEM (Invitrogen Life Technologies) supplemented with 10% bovine calf serum, 2 mM L-glutamine, 100 U/ml penicillin G, and 100 µg/ml streptomycin. HeLa cells (~1.1 x 107 cells) were transfected in Falcon 150 x 25-mm tissue culture dishes (BD Biosciences) using 162 U of TransIT reagent (Mirus) and 54 µg of pCMV.TTP.Tag plasmid DNA (37), which encodes the full-length human TTP cDNA linked to a HA tag or the pcDNA-3 plasmid (Invitrogen Life Technologies) as a mock control. After 48 h, the cells were harvested, and cytoplasmic extracts were prepared.

mRNA decay assay

293 Tet-Off cells (BD Clontech) were grown in Eagle’s MEM (Invitrogen Life Technologies) with 10% FBS (BD Biosciences), 4 mM L-glutamine, 100 U/ml penicillin G, and 100 µg/ml streptomycin according to the protocol of the manufacturers. 293 Tet-Off cells (4.5 x 105 cells) were transfected with 100 ng of pCMV.TTP.Tag or pcDNA-3 (mock) plasmid, with 1 µg of the pTracer-EF/V5-His/lacZ construct (Invitrogen Life Technologies), which produces GFP to control for transfection efficiency, and with 4 µg of a Tet-responsive reporter construct encoding the rabbit {beta}-globin transcript. The reporter constructs used were pTetBBB (17) containing the rabbit {beta}-globin coding region and the 3'-UTR, pTetBBB/c-jun (17), which is identical with pTetBBB except the 3'-UTR contains an insertion from the c-jun 3'-UTR (17), and pTetBBB/IL-2, which we derived from pTetBBB by inserting the sequence TATTTATTTAAATATTTAAATTTTATATTTAT from the 3'-UTR of the IL-2 transcript into the BglII site located in the {beta}-globin 3'-UTR. Transfections were performed with 3 U of 293 TransIT reagent (Mirus) per microgram of plasmid DNA. After 72 h, 200 ng/ml doxycycline was added to stop transcription from the pTet constructs. Total RNA was isolated at 0, 30, 60, 90, and 150 min following doxycycline treatment using the TRIzol reagent (Invitrogen Life Technologies) according to the manufacturer’s instructions. RNA was further purified, and DNase was treated using the RNeasy Mini kit (Qiagen) according to the manufacturer’s instructions. Total RNA (5 µg of total RNA from each sample) was separated by electrophoresis on 1.2% glyoxal-agarose gels using the NorthernMax-Gly system (Ambion). The RNA was blotted onto Brightstar-Plus membranes (Ambion) and immobilized onto the membrane by irradiation with 254-nm UV light using a Stratalinker cross-linking apparatus (Stratagene). Blots were hybridized for 18 h with radiolabeled rabbit {beta}-globin or GFP DNA probes that were generated by PCR performed in the presence of [{alpha}-32P]dATP. The DNA template for generating the {beta}-globin probe was the pTetBBB plasmid, and the DNA template for generating the GFP probe was the pTracer plasmid. The PCR primers for making these probes are listed as sense followed by antisense: {beta}-globin, GTCTACCCATGGACCCAGAGG, GATCCACGTGCAGC; and GFP, CCATGGCTAGCAAAGGAG, CCATGTGTAATCCCAGCAGCAG. The blots were washed, and signal intensities were quantified using a PhosphorImager (Molecular Dynamics). The hybridization intensity of each transcript was normalized to the hybridization intensity of the GFP transcript, and the normalized values were used to calculate half-lives.

To assay endogenous IL-2 mRNA decay rates, unstimulated or anti-CD3- and anti-CD28-stimulated splenocytes from wild-type or TTP homozygous knockout mice were treated with 10 µg/ml actinomycin D, and total RNA was harvested after 0, 15, 30, or 45 min. IL-2 transcript levels were assayed by real-time RT-PCR and were normalized to HPRT transcript levels at each time point. GraphPad Prism software, version 4.00, was used to calculate transcript half-lives based on a one-phase exponential model of decay.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TTP protein binds specifically to the IL-2 ARE sequence

We hypothesized that TTP regulates IL-2 mRNA decay by binding to the IL-2 ARE sequence and targeting the transcript for decay. Previously, it has been demonstrated that the IL-2 transcript contains an ARE in its 3'-UTR that regulates mRNA decay (10). Our previous finding that TTP binds to the IL-2 ARE suggests that TTP could be a regulator of IL-2 mRNA decay (28). To further characterize the interaction between TTP and the IL-2 ARE, gel shift assays were performed using cytoplasmic extracts from HeLa cells that had been transiently transfected with a control plasmid (mock) or a plasmid that expresses TTP linked to a HA tag (TTP Tx; Fig. 1A). Cytoplasmic extracts from mock-transfected cells express little or no endogenous RNA-binding activity that recognizes the IL-2 ARE (lane 1). In contrast, cytoplasmic extracts from TTP-transfected HeLa cells contained an RNA-binding activity that recognized the IL-2 ARE sequence (lane 2). This binding interaction was specific because it was eliminated by the addition of excess unlabeled IL-2 (lane 3) or GM-CSF (lane 4) ARE sequences but was not abolished by c-myc (lanes 5 and 6), M1 (lane 7), or M8 (lane 8) competitor RNA sequences. To determine whether this RNA-binding activity was attributable to TTP, supershift experiments were conducted (Fig. 1B). A shifted band in cytoplasmic extracts from TTP-transfected HeLa cells (lane 3) was completely supershifted by an anti-TTP Ab (lane 4) or anti-HA Ab (lane 6) but not by control Abs (lanes 5 and 7). These results suggest that the entire RNA-binding activity is attributable to TTP.



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 1. Overexpressed TTP binds specifically to the IL-2 ARE sequence. A, HeLa cells were transiently transfected with the pcDNA-3 plasmid (mock), or the pCMV.TTP.HA-Tag expression plasmid (TTP Tx), and cytoplasmic extracts were prepared 48 h later. RNA protein gel shift assays were performed by mixing cytoplasmic extracts (8 µg of protein) with 15 fmol of a 32P-end-labeled IL-2 ARE RNA probe in the absence (none) or presence of a 100-fold molar excess of IL-2, GM-CSF, c-myc1, c-myc2, M1, or M8 unlabeled competitor RNA (100x competitor RNA). The binding reactions were separated by electrophoresis on a 10% polyacrylamide gel under nondenaturing conditions, and bands were visualized using a PhosphorImager. The position of migration of the free probe is seen in lane 9, and the TTP-containing RNA protein binding complex is indicated by an arrow. B, Cytoplasmic extracts from mock (lane 2) or TTP-transfected HeLa cells (lanes 3–7) were incubated with 35 fmol of a 32P-end-labeled IL-2 ARE RNA probe. Supershifts were performed by adding the following Abs to the binding reactions: anti-TTP (lane 4), a control anti-actin (goat polyclonal) Ab (lane 5), anti-HA (lane 6), or a control anti-AKT1/2 (rabbit polyclonal) Ab (lane 7). The binding reactions were then separated by electrophoresis on a 10% polyacrylamide gel under nondenaturing conditions. The positions of migration of the TTP-containing band and the supershifted band are indicated with arrows.

 
Competitive RNA-binding experiments were conducted to estimate the affinity of TTP for the IL-2 ARE to determine whether this interaction occurs with an affinity that is comparable with other biologically meaningful RNA-protein interactions. Gel shift assays were performed using cytoplasmic extracts from TTP-transfected HeLa cells and the radiolabeled IL-2 ARE probe in the presence of increasing amounts of unlabeled competitor IL-2 ARE RNA (Fig. 2A). The intensity of the binding activity decreased with increasing amounts of unlabeled IL-2 ARE RNA added to the reaction, and the intensities of the bound radiolabeled complex and the free RNA were quantified (Fig. 2B). The amount of bound RNA was plotted against the amount of total RNA, and the apparent binding affinity was calculated to be ~8 nM using a homologous competition with depletion one-site binding model. Because this binding affinity was estimated based on binding in crude extracts, the true affinity would be expected to be higher. In a previous report, a synthetic peptide consisting of the 73-aa TTP tandem zinc finger domain bound to the TNF-{alpha} ARE sequence with an affinity of 10 nM by gel shift and 19 nM by fluorescence anisotropy (38). Our apparent binding affinity of 8 nM is higher than the previously reported binding affinities of the ARE-binding proteins AUF-1 and HuR for the GM-CSF ARE sequence, which were 40 and 50 nM, respectively (39). Thus, the binding of TTP to the IL-2 ARE with high affinity is consistent with the hypothesis that TTP could be a regulator of IL-2 gene expression.



View larger version (48K):
[in this window]
[in a new window]
 
FIGURE 2. TTP interacts with the IL-2 ARE with high affinity. A, Cytoplasmic extracts from TTP-transfected HeLa cells (10 µg of protein) were incubated with 35 fmol of a 32P-end-labeled IL-2 ARE RNA probe in the presence of increasing amounts of unlabeled IL-2 ARE RNA (femtomoles of unlabeled IL-2 competitor). The binding reactions were then separated by electrophoresis on a 10% polyacrylamide gel under nondenaturing conditions. The positions of migration of the free and bound probes are indicated with arrows. B, For four independent experiments performed as described in A, the amount of bound and free radiolabeled IL-2 RNA was quantitated using a PhosphorImager. The amount of bound radiolabeled RNA was plotted against the amount of total RNA in each reaction. Each point represents the mean and SEM from four experiments.

 
TTP in activated T cell extracts binds to the IL-2 ARE

Although TTP is not expressed in resting T cells, we have previously shown that T cell activation leads to induction of TTP mRNA and protein expression (28). Following anti-CD3 and anti-CD28 stimulation of primary human T cells, TTP protein levels as assessed by Western blot were detectable at 1 h, peaked at 3 h, decreased gradually at 6 and 12 h, and returned to baseline at 24 h (data not shown). Given that TTP and IL-2 are expressed in T cells, we next sought to determine whether TTP present in T cell cytoplasmic extracts could bind to the IL-2 ARE sequence. To address this question, cytoplasmic extracts from resting T cells and T cells that had been activated for 6 h with anti-CD3 and anti-CD28 Abs were evaluated using an RNA-protein UV cross-linking assay to identify RNA-binding activities that were specific for the IL-2 ARE (Fig. 3A). There was no binding activity present in cytoplasmic extracts from medium-stimulated cells (lane 1), but an IL-2 ARE-binding activity of ~43 kDa was seen when cytoplasmic extracts from activated T cells was used (lane 2). To determine the specificity of this induced IL-2 ARE-binding activity, T cell cytoplasmic extracts were incubated with the IL-2 ARE probe in the presence of excess competitor RNA. As illustrated in Fig. 3B, excess unlabeled IL-2 (lane 3) and GM-CSF (lane 4) competitor ARE sequences competed for binding with the IL-2 ARE probe, whereas c-myc sequences (lanes 5 and 6) and the M8 sequence (lane 7) did not eliminate the binding activity. Thus, this RNA-binding activity has sequence specificity that is similar to TTP. A portion of this RNA-binding activity was immunoprecipitated by an anti-TTP Ab suggesting that the RNA-binding complex contains TTP (data not shown). Additionally, experiments were performed using a gel shift assay (Fig. 3C) where no IL-2 ARE-binding activity was detected in cytoplasmic extracts from medium-stimulated T cells (lane 1) but cytoplasmic extracts from stimulated T cells displayed an IL-2 ARE-binding activity (lane 2). This binding activity was eliminated upon the addition of excess unlabeled GM-CSF (lane 3) and IL-2 (lane 4) competitor ARE RNA sequences, whereas M1 (lane 5) and M8 (lane 6) RNA could not eliminate the binding activity. In Fig. 3D, supershift experiments showed that the induced binding activity was supershifted with an anti-TTP Ab (lane 4) but not an anti-actin control Ab (lane 5). The ability of the anti-TTP Abs to supershift a major portion of the IL-2 ARE-binding activity provides further evidence that the inducible binding activity contains TTP. Overall, these experiments indicate that TTP is induced upon T cell activation and is capable of binding to the IL-2 ARE in a sequence-specific manner.



View larger version (63K):
[in this window]
[in a new window]
 
FIGURE 3. TTP in cytoplasmic extracts from activated T cells binds to the IL-2 ARE sequence. A, Purified human T cells were treated for 6 h with medium alone (media) or with anti-CD3 and anti-CD28 Abs ({alpha}CD3+CD28) and cytoplasmic extracts were prepared. Cytoplasmic extracts (10 µg of protein) were incubated with 15 fmol of a 32P-end-labeled IL-2 ARE RNA probe in the presence of excess poly U RNA. The reaction mixtures were treated with UV radiation and were separated by electrophoresis on a 10% SDS-polyacrylamide gel. The major induced protein-RNA complex is indicated by an arrow. The positions of migration of molecular mass markers in kilodaltons are shown to the left of the figure. B, Cytoplasmic extracts (10 µg of protein) from purified human T cells that were treated for 6 h with medium alone (media) or with anti-CD3 and anti-CD28 Abs ({alpha}CD3+CD28), were incubated with 30 fmol of a 32P-end-labeled IL-2 ARE RNA probe and excess poly-U RNA in the absence (lane 2) or presence of a 100-fold molar excess unlabeled competitor IL-2, GM-CSF, c-myc1, c-myc2, or M8 RNA. The binding reactions were separated by electrophoresis on a 10% SDS-polyacrylamide gel, and bands were visualized using a PhosphorImager. The induced RNA-binding complex is indicated by an arrow. C, Cytoplasmic extracts (10 µg of protein) from purified human T cells that were treated for 6 h with medium alone (media) or with anti-CD3 and anti-CD28 Abs ({alpha}CD3+CD28) were incubated with 15 fmol of a 32P-end-labeled IL-2 ARE RNA probe in the absence (none) or presence of a 100-fold molar excess of unlabeled GM-CSF, IL-2, M1, or M8 competitor RNA. The binding reactions were separated by electrophoresis on a 10% polyacrylamide gel under nondenaturing conditions, and bands were visualized using a PhosphorImager. The major induced RNA-binding complex is indicated by an arrow. D, Cytoplasmic extracts (10 µg of protein) from purified human T cells were treated for 6 h with medium alone (lane 2) or with anti-CD3 and anti-CD28 ({alpha}CD3+CD28) Abs (lanes 3–5) and were incubated with 15 fmol of a 32P-end-labeled IL-2 ARE RNA probe. Supershifts were performed by adding an anti-TTP Ab ({alpha}TTP) or an isotype-matched anti-Actin Ab ({alpha}-Actin). The binding reactions were separated by electrophoresis on a 10% polyacrylamide gel under nondenaturing conditions, and bands were visualized using a PhosphorImager. The induced RNA-binding complex (induced band) and the TTP supershifted complex (supershifted band) are indicated with arrows.

 
TTP regulates the decay of transcripts containing the IL-2 ARE

The ability of TTP in cytoplasmic extracts from activated T cells to specifically recognize the IL-2 ARE sequence suggests that TTP ‘could be a posttranscriptional regulator of IL-2 gene expression. To directly test the mechanism by which TTP altered IL-2 expression, a transfection system was used to determine whether TTP could regulate the stability of transcripts that contained the IL-2 ARE. In this system, 293 Tet-Off cells were transfected with a tetracycline-repressible plasmid (pTetBBB) that expresses a very stable {beta}-globin reporter transcript or were transfected with plasmids that were identical with pTetBBB except that they contained an additional IL-2 ARE sequence (pTetBBB/IL-2) or a c-jun sequence (pTetBBB/c-jun) in their 3'-UTR (17). These plasmids were cotransfected with a TTP expression plasmid or a control plasmid to determine the effect of TTP on the decay of the reporter transcripts. Transfection efficiency was assessed using a GFP expression construct. The 293 Tet-Off cells were transfected, and doxycycline was added 72 h later to stop transcription from the reporter constructs. Total cellular RNA was harvested after 0, 30, 60, 90, and 150 min. {beta}-globin (BBB) and GFP mRNA expression were assessed by Northern blot, and {beta}-globin mRNA expression was normalized to GFP mRNA expression for each time point (Fig. 4). In the absence of TTP, the BBB, BBB/IL-2, and BBB/c-jun transcripts were all relatively stable. Overexpression of TTP specifically destabilized the BBB/IL-2 ARE transcript but did not alter the half-life of the BBB or BBB/c-jun transcripts, suggesting that TTP had a specific destabilizing effect on transcripts containing the IL-2 ARE. Overall, these data demonstrate that TTP specifically regulates the decay of transcripts that contain the IL-2 ARE and suggest that TTP functions to down-regulate IL-2 gene expression by promoting mRNA decay.



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 4. TTP regulates the decay of mRNA containing the IL-2 ARE sequence. A, 293 Tet-Off cells were transfected with the pTetBBB (BBB), the pTetBBB/IL-2 (BBB/IL-2), or the pTetBBB/c-jun (BBB/c-jun) constructs in the presence of the pCMV.TTP.Tag plasmid (TTP) or a pcDNA3 control plasmid (mock). The pTracer GFP expression construct was cotransfected in each group as a control for transfection efficiency. After 72 h, doxycycline was added to stop transcription from the pTet constructs and total RNA was isolated after 0, 30, 60, 90, or 150 min. Total RNA (5 µg) from each sample was analyzed by Northern blot using a 32P-labeled rabbit {beta}-globin probe and a 32P-labeled GFP probe. B, For quantification, the hybridization intensity values of {beta}-globin mRNA were normalized to GFP mRNA levels and were graphed. For each transfection condition, the normalized value for {beta}-globin expression at time 0 was set to 100%. The graphed data represent three independent experiments. Each point represents the mean and SEM of these independent experiments.

 
TTP regulates IL-2 gene expression in vivo

IL-2 expression was evaluated in splenocytes and T cells from wild-type and TTP knockout mice to determine whether TTP plays a role in regulating IL-2 gene expression in vivo. Purified splenocytes from wild-type and TTP knockout mice were stimulated with medium alone, an immobilized anti-CD3 Ab, or a combination of anti-CD3 and anti-CD28 Abs, and then total RNA and culture supernatants were collected. IL-2 mRNA levels were assessed by real-time PCR, and IL-2 protein expression was measured by ELISA. As seen in Fig. 5A, splenocytes derived from TTP knockout mice that had been stimulated for 12 h with an anti-CD3 Ab or a combination of anti-CD3 and anti-CD28 Abs overexpress IL-2 mRNA compared with splenocytes from wild-type mice. Interestingly, medium-stimulated splenocytes from TTP knockout mice also expressed more IL-2 mRNA than splenocytes from wild-type mice, although the level of IL-2 mRNA expression was low. Splenocytes from TTP knockout mice overproduce IL-2 protein as measured in culture supernatants by ELISA compared with their wild-type counterparts (Fig. 5B). Flow cytometric analysis revealed that the splenocyte population consisted of 44–46% total T cells in wild-type and TTP knockout splenocytes.



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 5. T cells derived from TTP knockout mice overproduce IL-2. A, Purified mouse splenocytes were either unstimulated (media) or stimulated for 12 h with anti-CD3 ({alpha}CD3) or anti-CD3 and anti-CD28 ({alpha}CD3+CD28) Abs. Total cellular RNA was isolated, and IL-2 mRNA expression was measured by real-time PCR and normalized to HPRT mRNA levels. The IL-2 mRNA level in anti-CD3-stimulated splenocytes from wild-type mice was set at 1.0, and all other normalized mRNA levels were graphed relative to that value. Each point represents the mean and SEM of three independent experiments, each of which was performed in triplicate. B, Supernatants were collected from splenocyte cultures described in A, and IL-2 levels were measured by ELISA. Each point represents the mean and SEM of triplicate samples. C, Purified mouse T cells were either unstimulated (media) or stimulated for 6 h with anti-CD3 ({alpha}CD3) or anti-CD3 and anti-CD28 ({alpha}CD3+CD28) Abs. Total cellular RNA was isolated, and IL-2 mRNA expression was measured by real-time PCR and normalized to HPRT mRNA levels. The IL-2 mRNA level in anti-CD3-stimulated T cells from wild-type mice was set at 1.0, and all other normalized mRNA levels were graphed relative to that value. Each point represents the mean and SEM of triplicate samples. D, Supernatants were collected from T cell cultures described in C, and IL-2 levels were measured by ELISA. Each point represents the mean and SEM of triplicate samples.

 
The overproduction of IL-2 mRNA and protein in TTP knockout mice was also observed in purified T cells. Flow cytometric analysis revealed that the T cell populations consisted of 87–90% CD3-positive T cells, which were 46–49% CD4 positive and 35–39% CD8 positive with <5% variation between wild-type and TTP knockout T cell populations. After 6 h of stimulation with an anti-CD3 Ab or a combination of anti-CD3 and anti-CD28 Abs, there was increased IL-2 mRNA expression as measured by real-time PCR and increased IL-2 protein production as assessed by ELISA in T cells derived from TTP knockout mice compared with their wild-type counterparts (Fig. 5, C and D). Therefore, the overexpression of IL-2 mRNA and protein in TTP knockout T cells could not be explained by differences in the number of total T cells nor the percentage of CD4-positive or CD8-positive T cells in wild-type or TTP knockout mice.

The overproduction of IL-2 in splenocytes and T cells derived from TTP knockout mice suggests that TTP could regulate the decay of IL-2 mRNA. To determine whether the overproduction of IL-2 in splenocytes and T cells from TTP knockout mice was due to effects of TTP on the stability of the IL-2 transcript, we measured the half-life of IL-2 mRNA in splenocytes derived from TTP knockout or wild-type mice. Splenocytes were stimulated with anti-CD3 and anti-CD28 Abs, and actinomycin D was added 6 h later to stop transcription. Total cellular RNA was harvested after 0, 15, 30 or 45 min. IL-2 and HPRT mRNA expression were assessed by real-time RT-PCR, and IL-2 mRNA expression was normalized to HPRT mRNA expression for each time point (Fig. 6). In the splenocytes derived from wild-type mice, the IL-2 mRNA half-life was 18 min (95% confidence interval, 16.0–20.1), whereas in splenocytes derived from the TTP knockout mice, the IL-2 mRNA half-life was 33 min (95% confidence interval, 28.0–40.9). This difference was statistically significant with a value of p < 0.0001. Thus, the absence of TTP led to stabilization of IL-2 mRNA, suggesting that TTP specifically destabilizes IL-2 mRNA in vivo. Overall these data demonstrate that IL-2 mRNA and protein levels are elevated in activated splenocytes or T cells derived from TTP knockout mice compared with their wild-type counterparts and suggests that TTP down-regulates IL-2 gene expression at the level of mRNA decay in vivo.



View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 6. TTP regulates the decay of IL-2 mRNA. Purified mouse splenocytes from wild-type (WT) or TTP homozygous knockout (KO) mice were stimulated for 6 h with anti-CD3 and anti-CD28 Abs. After 6 h, actinomycin D (10 µg/ml) was added to stop transcription, and total RNA was isolated after 0 or 30 min in one experiment or after 0, 15, 30, or 45 min in another independent experiment. IL-2 mRNA levels were measured using real-time RT-PCR and were normalized to HPRT mRNA levels. For each experiment, real-time PCR assays were performed three times. The normalized level of IL-2 mRNA at time 0 was set at 100, and all other normalized mRNA levels were graphed relative to that value. The graph combines the data from the two experiments, and each point is represented by the mean and the SEM. The data were fit to a one-phase model of exponential decay to derive the indicated IL-2 mRNA decay curves.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TTP is an important ARE-binding protein that regulates the deadenylation and decay of growth-regulatory transcripts such as GM-CSF and TNF-{alpha} (27, 33). In this study, we investigated the expression and function of TTP in T lymphocytes and determined that TTP down-regulated IL-2 gene expression by destabilizing IL-2 mRNA. We found that TTP protein expression was induced following T cell activation and was expressed during the time period when IL-2 mRNA levels began to fall. The overproduction of IL-2 mRNA and protein in splenocytes and T cells derived from TTP knockout mice indicated that TTP functions to down-regulate IL-2 expression. Overall, our data suggest that the IL-2 overproduction that we observed in TTP knockout mice was due to stabilization of the IL-2 transcript, but we cannot exclude the possibility that TTP may also regulate IL-2 gene expression at other levels. Although TTP is not known to directly influence IL-2 transcription, it is possible that TTP influences IL-2 transcription indirectly by regulating the expression of ARE-containing transcripts that encode transcription factors that in turn regulate IL-2 transcription. Also, we cannot exclude the possibility that TTP regulates IL-2 translation. The increase in IL-2 mRNA levels in anti-CD3-activated splenocytes from TTP knockout mice is greater than the increase seen in purified T cells (Fig. 5, A and C), raising the possibility that costimulatory signals from splenocytes could influence the effect of TTP on IL-2 mRNA expression. Our findings that 1) TTP binds to the IL-2 ARE with high affinity, 2) TTP is capable of mediating the rapid decay of a reporter construct that contains the IL-2 ARE, and 3) IL-2 mRNA is more stable in splenocytes derived from TTP knockout mice than wild-type mice all suggest that TTP down-regulates IL-2 gene expression by mediating IL-2 mRNA decay in an ARE-dependent manner.

Studies in the TTP knockout mouse model suggest that TTP is a physiological regulator of other cytokines such as GM-CSF and TNF-{alpha} (27, 33). The myeloid hyperplasia seen in TTP homozygous knockout mice is due in part to overproduction of GM-CSF through mRNA stabilization (33). Also, the autoimmune phenotype seen in TTP knockout mice is due primarily to overproduction of TNF-{alpha} because administration of anti-TNF-{alpha} Abs to TTP knockout mice at birth prevented the development of cachexia and arthritis (36). The contribution of cytokine production by T cells to the abnormal phenotype of TTP knockout mice has not been previously examined. Our results suggest that most T cells from TTP knockout mice are in a resting state and are not producing large amounts of cytokines such as IL-2. Perhaps the process of T cell differentiation and development in the thymus leads to the removal of autoreactive T cells, and our housing of these mice in a specific pathogen-free environment prevents immune activation from foreign Ags. We found that T cell activation ex vivo led to overproduction of IL-2 by T cells from TTP knockout mice. Perhaps a similar phenomenon would occur in vivo in response to antigenic challenge though immunization or infection.

Based on our current understanding of ARE-mediated mRNA decay, we suggest the following model for transient expression of ARE-containing transcripts. In unstimulated T cells, stabilizing ARE-binding proteins such as HuA (HuR) and NF90 are expressed in the nucleus. Following T cell activation, newly synthesized ARE-containing transcripts are bound by these stabilizing ARE-binding proteins and are transported from the nucleus to the cytoplasm. Once in the cytoplasm, these proteins transiently mediate transcript stabilization by blocking AREs and thereby preventing the recruitment of the mRNA decay machinery to the transcript. TTP mRNA and protein expression are subsequently induced following T cell activation. TTP competes with the stabilizing ARE-binding proteins for the ARE, and binding by TTP to the ARE then targets the transcript for decay. Because TTP physically interacts with the exosome, a multi-subunit protein complex that possesses 3' to 5' exonuclease activity, and TTP mediates the decay of the IL-2 3'-UTR in a cell-free system (35), binding by TTP to the ARE may recruit the exosome to the 3'-end of the IL-2 transcript, facilitating mRNA decay. This model provides a mechanism whereby ARE-containing transcripts may be transiently expressed and then turned off at precise times following T cell activation.

Recently, Stoecklin et al. (40) demonstrated that TTP is phosphorylated at serines 52 and 178 in response to the MAPK-activated protein kinase 2 signaling pathway. According to their studies, phosphorylated TTP is bound by the adaptor protein 14-3-3, which prevents TTP from targeting ARE-containing mRNA for decay. In other cell types, p38 kinase activation leads to phosphorylation of TTP at serines 52 and 178, creating a functional 14-3-3 binding site (40, 41, 42, 43). Similar mechanisms for regulating TTP function may also occur in T cells. In response to T cell activation, CD28 costimulation activates signaling pathways that are independent from TCR signaling and also amplifies signaling pathways downstream from the TCR (44). These signaling pathways could regulate TTP function through phosphorylation by regulating the ability of TTP to target ARE-containing mRNAs for decay. In T cells, it is possible that TTP is phosphorylated by kinases that become active in response to TCR and CD28 coreceptor stimulation. Phosphorylated TTP may be rendered inactive when bound by 14-3-3, allowing specific stabilization of ARE-containing transcripts. Thus, TTP phosphorylation in T cells may provide an additional level of control over the expression of ARE-containing transcripts such as the IL-2 transcript.

In this report, we have shown that TTP binds specifically to the IL-2 ARE sequence, and this binding destabilizes the transcript through an ARE-mediated decay pathway. ARE-mediated decay provides a mechanism for down-regulating IL-2 expression after T cell activation. Because other sequences within the IL-2 transcript also regulate IL-2 mRNA decay (9, 10, 11, 12, 29, 45, 46), it will be important to understand how these distinct regulatory sequences interact with each other to regulate IL-2 mRNA decay. mRNA turnover appears to serve as a general mechanism for regulating the expression of a wide variety of genes in T lymphocytes (47). Thus, understanding the mechanisms controlling mRNA turnover is important for T cell function and the maintenance of normal immune homeostasis.


    Acknowledgments
 
We express our gratitude to Daniel L. Mueller and Marc K. Jenkins for providing comments and suggestions in the preparation of this manuscript. We also thank Ann-Bin Shyu for providing reporter constructs.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by Grants KO2A152170 and 1RO1AI49494 from National Institute of Allergy and Infectious Diseases, National Institutes of Health (Bethesda, MD). Back

2 Address correspondence and reprint requests to Dr. Paul R. Bohjanen, Department of Microbiology, University of Minnesota, Mayo Mail Code 196, 420 Delaware Street S.E., Minneapolis, MN 55455. E-mail address: bohja001{at}tc.umn.edu Back

3 Abbreviations used in this paper: UTR, untranslated region; ARE, AU-rich element; TTP, tristetraprolin; HA, hemagglutinin; HPRT, hypoxanthine phosphoribosyltransferase. Back

Received for publication May 6, 2004. Accepted for publication November 2, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hollander, G. A.. 1999. On the stochastic regulation of interleukin-2 transcription. Semin. Immunol. 11:357.[Medline]
  2. Lenardo, M. J.. 1991. Interleukin-2 programs mouse {alpha}{beta} T lymphocytes for apoptosis. Nature 353:858.[Medline]
  3. Essery, G., M. Feldmann, J. R. Lamb. 1988. Interleukin-2 can prevent and reverse antigen-induced unresponsiveness in cloned human T lymphocytes. Immunology 64:413.[Medline]
  4. Smith, K. A.. 1988. Interleukin-2: inception, impact, and implications. Science 240:1169.[Abstract/Free Full Text]
  5. Horak, I., J. Lohler, A. Ma, K. A. Smith. 1995. Interleukin-2 deficient mice: a new model to study autoimmunity and self-tolerance. Immunol. Rev. 148:35.[Medline]
  6. Andreu-Sanchez, J. L., I. M. Moreno de Alboran, M. A. Marcos, A. Sanchez-Movilla, A. C. Martinez, G. Kroemer. 1991. Interleukin 2 abrogates the nonresponsive state of T cells expressing a forbidden T cell receptor repertoire and induces autoimmune disease in neonatally thymectomized mice. J. Exp. Med. 173:1323.[Abstract/Free Full Text]
  7. Wilusz, C. J., M. Wormington, S. W. Peltz. 2001. The cap-to-tail guide to mRNA turnover. Nat. Rev. Mol. Cell Biol. 2:237.[Medline]
  8. Jain, J., C. Loh, A. Rao. 1995. Transcriptional regulation of the IL-2 gene. Curr. Opin. Immunol. 7:333.[Medline]
  9. Lindsten, T., C. H. June, J. A. Ledbetter, G. Stella, C. B. Thompson. 1989. Regulation of lymphokine messenger RNA stability by a surface-mediated T cell activation pathway. Science 244:339.[Abstract/Free Full Text]
  10. Chen, C. Y., F. Del Gatto-Konczak, Z. Wu, M. Karin. 1998. Stabilization of interleukin-2 mRNA by the c-Jun NH2-terminal kinase pathway. Science 280:1945.[Abstract/Free Full Text]
  11. Chen, C. Y., R. Gherzi, J. S. Andersen, G. Gaietta, K. Jurchott, H. D. Royer, M. Mann, M. Karin. 2000. Nucleolin and YB-1 are required for JNK-mediated interleukin-2 mRNA stabilization during T-cell activation. Genes Dev. 14:1236.[Abstract/Free Full Text]
  12. Ragheb, J. A., M. Deen, R. H. Schwartz. 1999. CD28-mediated regulation of mRNA stability requires sequences within the coding region of the IL-2 mRNA. J. Immunol. 163:120.[Abstract/Free Full Text]
  13. Chen, C. Y., A. B. Shyu. 1995. AU-rich elements: characterization and importance in mRNA degradation. Trends Biochem. Sci. 20:465.[Medline]
  14. Caput, D., B. Beutler, K. Hartog, R. Thayer, S. Brown-Shimer, A. Cerami. 1986. Identification of a common nucleotide sequence in the 3'-untranslated region of mRNA molecules specifying inflammatory mediators. Proc. Natl. Acad. Sci. USA 83:1670.[Abstract/Free Full Text]
  15. Jacobson, A., S. W. Peltz. 1996. Interrelationships of the pathways of mRNA decay and translation in eukaryotic cells. Annu. Rev. Biochem. 65:693.[Medline]
  16. Shaw, G., R. Kamen. 1986. A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell 46:659.[Medline]
  17. Peng, S. S., C. Y. Chen, A. B. Shyu. 1996. Functional characterization of a non-AUUUA AU-rich element from the c-jun proto-oncogene mRNA: evidence for a novel class of AU-rich elements. Mol. Cell. Biol. 16:1490.[Abstract]
  18. Peng, S. S., C. Y. Chen, N. Xu, A. B. Shyu. 1998. RNA stabilization by the AU-rich element binding protein, HuR, an ELAV protein. EMBO J. 17:3461.[Medline]
  19. Stoecklin, G., S. Hahn, C. Moroni. 1994. Functional hierarchy of AUUUA motifs in mediating rapid interleukin-3 mRNA decay. J. Biol. Chem. 269:28591.[Abstract/Free Full Text]
  20. Xu, N., C. Y. Chen, A. B. Shyu. 1997. Modulation of the fate of cytoplasmic mRNA by AU-rich elements: key sequence features controlling mRNA deadenylation and decay. Mol. Cell. Biol. 17:4611.[Abstract]
  21. Voeltz, G. K., J. A. Steitz. 1998. AUUUA sequences direct mRNA deadenylation uncoupled from decay during Xenopus early development. Mol. Cell. Biol. 18:7537.[Abstract/Free Full Text]
  22. Nair, A. P., H. H. Hirsch, M. Colombi, C. Moroni. 1999. Cyclosporin A promotes translational silencing of autocrine interleukin-3 via ribosome-associated deadenylation. Mol. Cell. Biol. 19:889.[Abstract/Free Full Text]
  23. Schiavi, S. C., C. L. Wellington, A. B. Shyu, C. Y. Chen, M. E. Greenberg, J. G. Belasco. 1994. Multiple elements in the c-fos protein-coding region facilitate mRNA deadenylation and decay by a mechanism coupled to translation. J. Biol. Chem. 269:3441.[Abstract/Free Full Text]
  24. Shyu, A. B., J. G. Belasco, M. E. Greenberg. 1991. Two distinct destabilizing elements in the c-fos message trigger deadenylation as a first step in rapid mRNA decay. Genes Dev. 5:221.[Abstract/Free Full Text]
  25. Gillis, P., J. S. Malter. 1991. The adenosine-uridine binding factor recognizes the AU-rich elements of cytokine, lymphokine, and oncogene mRNAs. J. Biol. Chem. 266:3172.[Abstract/Free Full Text]
  26. Brennan, C. M., J. A. Steitz. 2001. HuR and mRNA stability. Cell. Mol. Life Sci. 58:266.[Medline]
  27. Carballo, E., W. S. Lai, P. J. Blackshear. 1998. Feedback inhibition of macrophage tumor necrosis factor-{alpha} production by tristetraprolin. Science 281:1001.[Abstract/Free Full Text]
  28. Raghavan, A., R. L. Robison, J. McNabb, C. R. Miller, D. A. Williams, P. R. Bohjanen. 2001. HuA and tristetraprolin are induced following T cell activation and display distinct but overlapping RNA binding specificities. J. Biol. Chem. 276:47958.[Abstract/Free Full Text]
  29. Shim, J., H. Lim, J. R. Yates, III, M. Karin. 2002. Nuclear export of NF90 is required for interleukin-2 mRNA stabilization. Mol. Cell. 10:1331.[Medline]
  30. Myer, V. E., X. C. Fan, J. A. Steitz. 1997. Identification of HuR as a protein implicated in AUUUA-mediated mRNA decay. EMBO J. 16:2130.[Medline]
  31. Fan, X. C., J. A. Steitz. 1998. Overexpression of HuR, a nuclear-cytoplasmic shuttling protein, increases the in vivo stability of ARE-containing mRNAs. EMBO J. 17:3448.[Medline]
  32. Lai, W. S., E. Carballo, J. R. Strum, E. A. Kennington, R. S. Phillips, P. J. Blackshear. 1999. Evidence that tristetraprolin binds to AU-rich elements and promotes the deadenylation and destabilization of tumor necrosis factor {alpha} mRNA. Mol. Cell. Biol. 19:4311.[Abstract/Free Full Text]
  33. Carballo, E., W. S. Lai, P. J. Blackshear. 2000. Evidence that tristetraprolin is a physiological regulator of granulocyte-macrophage colony-stimulating factor messenger RNA deadenylation and stability. Blood 95:1891.[Abstract/Free Full Text]
  34. Stoecklin, G., X. F. Ming, R. Looser, C. Moroni. 2000. Somatic mRNA turnover mutants implicate tristetraprolin in the interleukin-3 mRNA degradation pathway. Mol. Cell. Biol. 20:3753.[Abstract/Free Full Text]
  35. Chen, C. Y., R. Gherzi, S. E. Ong, E. L. Chan, R. Raijmakers, G. J. Pruijn, G. Stoecklin, C. Moroni, M. Mann, M. Karin. 2001. AU binding proteins recruit the exosome to degrade ARE-containing mRNAs. Cell 107:451.[Medline]
  36. Taylor, G. A., E. Carballo, D. M. Lee, W. S. Lai, M. J. Thompson, D. D. Patel, D. I. Schenkman, G. S. Gilkeson, H. E. Broxmeyer, B. F. Haynes, P. J. Blackshear. 1996. A pathogenetic role for TNF {alpha} in the syndrome of cachexia, arthritis, and autoimmunity resulting from tristetraprolin (TTP) deficiency. Immunity 4:445.[Medline]
  37. Carballo, E., H. Cao, W. S. Lai, E. A. Kennington, D. Campbell, P. J. Blackshear. 2001. Decreased sensitivity of tristetraprolin-deficient cells to p38 inhibitors suggests the involvement of tristetraprolin in the p38 signaling pathway. J. Biol. Chem. 276:42580.[Abstract/Free Full Text]
  38. Blackshear, P. J., W. S. Lai, E. A. Kennington, G. Brewer, G. M. Wilson, X. Guan, P. Zhou. 2003. Characteristics of the interaction of a synthetic human tristetraprolin tandem zinc finger peptide with AU-rich element-containing RNA substrates. J. Biol. Chem. 278:19947.[Abstract/Free Full Text]
  39. Blaxall, B. C., A. Pende, S. C. Wu, J. D. Port. 2002. Correlation between intrinsic mRNA stability and the affinity of AUF1 (hnRNP D) and HuR for A+U-rich mRNAs. Mol. Cell. Biochem. 232:1.[Medline]
  40. Stoecklin, G., T. Stubbs, N. Kedersha, S. Wax, W. F. Rigby, T. K. Blackwell, P. Anderson. 2004. MK2-induced tristetraprolin:14-3-3 complexes prevent stress granule association and ARE-mRNA decay. EMBO J. 23:1313.[Medline]
  41. Johnson, B. A., J. R. Stehn, M. B. Yaffe, T. K. Blackwell. 2002. Cytoplasmic localization of tristetraprolin involves 14-3-3-dependent and -independent mechanisms. J. Biol. Chem. 277:18029.[Abstract/Free Full Text]
  42. Johnson, B. A., M. Yaffe, T. K. Blackwell. 2001. Molecular analysis of ttp, a key regulator of tnf activity. ScientificWorldJournal 1:38.
  43. Chrestensen, C. A., M. J. Schroeder, J. Shabanowitz, D. F. Hunt, J. W. Pelo, M. T. Worthington, T. W. Sturgill. 2004. MAPKAP kinase 2 phosphorylates tristetraprolin on in vivo sites including Ser178, a site required for 14-3-3 binding. J. Biol. Chem. 279:10176.[Abstract/Free Full Text]
  44. Diehn, M., A. A. Alizadeh, O. J. Rando, C. L. Liu, K. Stankunas, D. Botstein, G. R. Crabtree, P. O. Brown. 2002. Genomic expression programs and the integration of the CD28 costimulatory signal in T cell activation. Proc. Natl. Acad. Sci. USA 99:11796.[Abstract/Free Full Text]
  45. June, C. H., K. M. Jackson, J. A. Ledbetter, J. M. Leiden, T. Lindsten, C. B. Thompson. 1989. Two distinct mechanisms of interleukin-2 gene expression in human T lymphocytes. J. Autoimmun. 2:(Suppl.):55.
  46. Seko, Y., H. Azmi, R. Fariss, J. A. Ragheb. 2004. Selective cytoplasmic translocation of HuR and site specific binding to the IL-2 mRNA are not sufficient for CD28-mediated stabilization of the mRNA. J. Biol. Chem. 279:33359.[Abstract/Free Full Text]
  47. Raghavan, A., R. L. Ogilvie, C. Reilly, M. L. Abelson, S. Raghavan, J. Vasdewani, M. Krathwohl, P. R. Bohjanen. 2002. Genome-wide analysis of mRNA decay in resting and activated primary human T lymphocytes. Nucleic Acids Res. 30:5529.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
J. Liang, T. Lei, Y. Song, N. Yanes, Y. Qi, and M. Fu
RNA-destabilizing Factor Tristetraprolin Negatively Regulates NF-{kappa}B Signaling
J. Biol. Chem., October 23, 2009; 284(43): 29383 - 29390.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. J. Stumpo, H. E. Broxmeyer, T. Ward, S. Cooper, G. Hangoc, Y. J. Chung, W. C. Shelley, E. K. Richfield, M. K. Ray, M. C. Yoder, et al.
Targeted disruption of Zfp36l2, encoding a CCCH tandem zinc finger RNA-binding protein, results in defective hematopoiesis
Blood, September 17, 2009; 114(12): 2401 - 2410.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
E. M. King, M. Kaur, W. Gong, C. F. Rider, N. S. Holden, and R. Newton
Regulation of Tristetraprolin Expression by Interleukin-1{beta} and Dexamethasone in Human Pulmonary Epithelial Cells: Roles for Nuclear Factor-{kappa}B and p38 Mitogen-Activated Protein Kinase
J. Pharmacol. Exp. Ther., August 1, 2009; 330(2): 575 - 585.
[Abstract] [Full Text] [PDF]


Home page
Toxicol PatholHome page
J. P. Morrison, T.-V. Ton, J. B. Collins, R. C. Switzer, P. B. Little, D. L. Morgan, and R. C. Sills
Gene Expression Studies Reveal That DNA Damage, Vascular Perturbation, and Inflammation Contribute to the Pathogenesis of Carbonyl Sulfide Neurotoxicity
Toxicol Pathol, June 1, 2009; 37(4): 502 - 511.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. L. Ogilvie, J. R. SternJohn, B. Rattenbacher, I. A. Vlasova, D. A. Williams, H. H. Hau, P. J. Blackshear, and P. R. Bohjanen
Tristetraprolin Mediates Interferon-{gamma} mRNA Decay
J. Biol. Chem., April 24, 2009; 284(17): 11216 - 11223.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
T. J. Horner, W. S. Lai, D. J. Stumpo, and P. J. Blackshear
Stimulation of Polo-Like Kinase 3 mRNA Decay by Tristetraprolin
Mol. Cell. Biol., April 15, 2009; 29(8): 1999 - 2010.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. Duan, N. Cherradi, J.-J. Feige, and C. Jefcoate
cAMP-Dependent Posttranscriptional Regulation of Steroidogenic Acute Regulatory (STAR) Protein by the Zinc Finger Protein ZFP36L1/TIS11b
Mol. Endocrinol., April 1, 2009; 23(4): 497 - 509.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Wang, N. van Panhuys, J. Hu-Li, S. Kim, G. Le Gros, and B. Min
Blimp-1 Induced by IL-4 Plays a Critical Role in Suppressing IL-2 Production in Activated CD4 T Cells
J. Immunol., October 15, 2008; 181(8): 5249 - 5256.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
U. Jalonen, E.-L. Paukkeri, and E. Moilanen
Compounds That Increase or Mimic Cyclic Adenosine Monophosphate Enhance Tristetraprolin Degradation in Lipopolysaccharide-Treated Murine J774 Macrophages
J. Pharmacol. Exp. Ther., August 1, 2008; 326(2): 514 - 522.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. T. Ishmael, X. Fang, M. R. Galdiero, U. Atasoy, W. F. C. Rigby, M. Gorospe, C. Cheadle, and C. Stellato
Role of the RNA-Binding Protein Tristetraprolin in Glucocorticoid-Mediated Gene Regulation
J. Immunol., June 15, 2008; 180(12): 8342 - 8353.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
J. Emmons, W.H. D. Townley-Tilson, K. M. Deleault, S. J. Skinner, R. H. Gross, M. L. Whitfield, and S. A. Brooks
Identification of TTP mRNA targets in human dendritic cells reveals TTP as a critical regulator of dendritic cell maturation
RNA, May 1, 2008; 14(5): 888 - 902.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
K. Kandasamy and A. S. Kraft
Proteasome inhibitor PS-341 (VELCADE) induces stabilization of the TRAIL receptor DR5 mRNA through the 3'-untranslated region
Mol. Cancer Ther., May 1, 2008; 7(5): 1091 - 1100.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Stoecklin, S. A. Tenenbaum, T. Mayo, S. V. Chittur, A. D. George, T. E. Baroni, P. J. Blackshear, and P. Anderson
Genome-wide Analysis Identifies Interleukin-10 mRNA as Target of Tristetraprolin
J. Biol. Chem., April 25, 2008; 283(17): 11689 - 11699.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Datta, R. Biswas, M. Novotny, P. G. Pavicic Jr., T. Herjan, P. Mandal, and T. A. Hamilton
Tristetraprolin Regulates CXCL1 (KC) mRNA Stability
J. Immunol., February 15, 2008; 180(4): 2545 - 2552.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. J. Cuthbertson, Y. Liao, L. Birnbaumer, and P. J. Blackshear
Characterization of zfs1 as an mRNA-binding and -destabilizing Protein in Schizosaccharomyces pombe
J. Biol. Chem., February 1, 2008; 283(5): 2586 - 2594.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
P. S. David, R. Tanveer, and J. D. Port
FRET-detectable interactions between the ARE binding proteins, HuR and p37AUF1
RNA, September 1, 2007; 13(9): 1453 - 1468.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Frasca, A. M. Landin, J. P. Alvarez, P. J. Blackshear, R. L. Riley, and B. B. Blomberg
Tristetraprolin, a Negative Regulator of mRNA Stability, Is Increased in Old B Cells and Is Involved in the Degradation of E47 mRNA
J. Immunol., July 15, 2007; 179(2): 918 - 927.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
K. S. A. Khabar
Rapid transit in the immune cells: the role of mRNA turnover regulation
J. Leukoc. Biol., June 1, 2007; 81(6): 1335 - 1344.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
L. Shi, W. R. Godfrey, J. Lin, G. Zhao, and P. N. Kao
NF90 regulates inducible IL-2 gene expression in T cells
J. Exp. Med., May 14, 2007; 204(5): 971 - 977.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
W. S. Lai, J. S. Parker, S. F. Grissom, D. J. Stumpo, and P. J. Blackshear
Novel mRNA Targets for Tristetraprolin (TTP) Identified by Global Analysis of Stabilized Transcripts in TTP-Deficient Fibroblasts
Mol. Cell. Biol., December 15, 2006; 26(24): 9196 - 9208.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. Smoak and J. A. Cidlowski
Glucocorticoids Regulate Tristetraprolin Synthesis and Posttranscriptionally Regulate Tumor Necrosis Factor Alpha Inflammatory Signaling
Mol. Cell. Biol., December 1, 2006; 26(23): 9126 - 9135.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Sanchez-Lockhart and J. Miller
Engagement of CD28 Outside of the Immunological Synapse Results in Up-Regulation of IL-2 mRNA Stability but Not IL-2 Transcription.
J. Immunol., April 15, 2006; 176(8): 4778 - 4784.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
C. Barreau, L. Paillard, and H. B. Osborne
AU-rich elements and associated factors: are there unifying principles?
Nucleic Acids Res., January 3, 2006; 33(22): 7138 - 7150.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Frasca, E. Van der Put, A. M. Landin, D. Gong, R. L. Riley, and B. B. Blomberg
RNA Stability of the E2A-Encoded Transcription Factor E47 Is Lower in Splenic Activated B Cells from Aged Mice
J. Immunol., November 15, 2005; 175(10): 6633 - 6644.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ogilvie, R. L.
Right arrow Articles by Bohjanen, P. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ogilvie, R. L.
Right arrow Articles by Bohjanen, P. R.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
*Genetics Home Reference


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS