|
|
||||||||


* Trudeau Institute, Inc., Saranac Lake, NY 12983;
Department of Surgery, Division of Transplantation Surgery and Immunology, University of Vermont, Burlington, VT 05405; and
Institute for Biological Sciences, National Research Council of Canada, Ottawa, Ontario, Canada
| Abstract |
|---|
|
|
|---|
14+ T cells, a major population of NKT cells. Involvement of these cells in resistance to T. gondii was investigated using gene-targeted J
18-deficient C57BL/6 mice, which are deficient in V
14+ T cells. These mice did not succumb to acute infection, but experienced greater weight loss and more deaths than B6 mice during chronic infection, indicating that V
14+ cells contribute to resistance to T. gondii. The data identify CD4+ cells as a significant component of the marked susceptibility to T. gondii infection observed in CD1d-deficient C57BL/6mice, and establish T. gondii as a valuable tool for deciphering CD1d-dependent protective mechanisms. | Introduction |
|---|
|
|
|---|
-dependent necrosis of the ileum in the C57BL/6 (B6) mouse strain (33, 34). Thus, acute susceptibility to T. gondii infection can result from a dysregulated type 1 immune response as well as from deficiency in antiparasitic effector activities.
In humans, the CD1 locus contains a family of five genes; however, CD1d is the sole representative of the family in the mouse (35). CD1 polypeptides are structurally related to MHC class I, and like class I, they form heterodimers with
2-microglobulin. CD1d is expressed on leukocytes including potential APCs (36). These features suggest that CD1 may have important immunological functions. Notably, CD1 molecules can bind and present both lipid and nonlipid Ags to T cells (37, 38), and CD1d-restricted T cells respond strongly to
-galactosylceramides (39). Thus, CD1d-restricted cells might respond to infection by recognizing lipid-associated pathogen Ags, as several studies have suggested (40, 41, 42). However, other studies have questioned whether there is a significant role for CD1d-dependent recognition of pathogen-associated lipid Ags (43, 44, 45). Many T cells that recognize CD1d have invariant rearrangements of their TCR
-chains (46). In the mouse, these cells preferentially express a V
14J
18 (formerly J
281) rearrangement, although subpopulations of CD1d-restricted T cells exist that can use other V
gene segments (47). NK cell markers (e.g., NK1.1) are also expressed on many CD1d-reactive cells (denoted NKT cells) (37, 48, 49). NKT cells have been implicated in resistance to various pathogens (41, 50, 51, 52, 53). Pertinent to the present study is a report of NKT cell involvement in resistance to T. gondii (54). That study found that mice deficient in MHC class II expression were protected against an i.p. challenge infection with highly virulent T. gondii after being vaccinated with an attenuated strain of Toxoplasma, but were not protected if CD4+ cells or NK1.1+ cells were depleted during vaccination. The protective cells were postulated to be CD1d restricted (55).
Gene-targeted mice lacking functional CD1d genes or lacking CD1d-restricted cells have been generated for study of CD1d-dependent immune mechanisms (56, 57, 58, 59). CD1d-deficient mice are reported to be more susceptible to some viruses (51, 52, 57, 60), bacteria (53, 61, 62, 63), and protozoa (41, 42, 64, 65). Together, infection studies suggest that CD1d-restricted cells and CD1d-dependent mechanisms play an important protective role during infection. However, the details of such protective mechanisms remain to be deciphered. Although infected CD1d-deficient mice and wild-type (WT)3 controls may differ in various immune responses, e.g., production of IFN-
(60, 63, 64) or IL-12 (57), it is not clear that such differences are the cause of greater susceptibility to infections in CD1d-deficient mice. Thus, the mechanisms underlying impaired resistance of infected CD1d-deficient mice have not been adequately resolved. Although T. gondii has been widely used to identify important protective roles for a broad range of cells and cytokine mediators during infection, there has been, until now, no explicit study of CD1d-dependent mechanisms during T. gondii infection. Relevant to the present study is a model proposed by Brenner and colleagues (35) that outlines potential interactions between CD1d-restricted cells and other cell populations during infection. Those populations include many cells well documented to play important roles in resistance to T. gondii, including polymorphonuclear leukocytes, macrophages, and lymphocytes. In the present study, we have investigated the role of CD1d in resistance to infection, using the highly informative T. gondii infection model. Our results indicate that a CD1d-dependent mechanism influences CD4+ cell responses during acute infection, and potentially regulates pathological effects associated with this population. In addition, our results indicate that V
14+ cells contribute to protection during chronic T. gondii infection.
| Materials and Methods |
|---|
|
|
|---|
Male C57BL/6J (B6) mice and gene-targeted CD1d-deficient mice (B6.C129S-Cd1tm1Gru, denoted CD1d-deficient B6) (56), which were backcrossed to C57BL/6 mice for 10 generations, were bred at Trudeau Institute. C.129S2-Cd1tm1Gru (CD1d-deficient BALB/c) mice were obtained from The Jackson Laboratory. Male mice deficient in V
14+ cells (J
18/ mice; Ref. 59) were bred at the University of Vermont from a stock provided originally by M. Taniguchi (Yokohama Institute, Yokohama City, Japan). Control B6 and BALB/cJ mice were bred at Trudeau Institute or obtained from commercial suppliers. Mice were between 6 and 10 wk old at the start of experiments. Mice were housed on ventilated racks in sterilized cages and were given laboratory chow and acidified water ad libitum. Mice at Trudeau Institute are free of known common viral pathogens of mice as evidenced by periodic screening of sera from sentinel mice, performed by the University of Missouri Research Animal Diagnostic and Investigative Laboratory (Columbia, MO). All experimental protocols were reviewed and approved by Trudeau Institute Animal Care and Use Committee. Trudeau Institute is fully accredited by the Association for Assessment and Accreditation of Laboratory Animal Care.
Parasites and infections
Mice were infected by peroral inoculation of 10 ME49 cysts. Cysts were prepared from brains of chronically infected B6 mice as previously described (66) and diluted to a concentration of 100 per milliliter in HBSS. In each experiment, groups of sham-infected mice were included that received equal volumes of brain suspension from uninfected B6 mice.
ELISA and real-time PCR assays
Levels of IFN-
in sera were assayed by ELISA as previously described (11). Parasites in tissues were quantified by a real-time PCR-based method (67). The assay measures expression of the Sag1 gene (P30), which is limited to tachyzoites (68), the proliferative form of the parasite. Relative amounts of cytokine mRNA in various tissues of mice were estimated using a real-time PCR-based method essentially as described elsewhere (69). Briefly, RNA was isolated from tissues, cDNA prepared, amplified, and quantified using primers and probes listed below. Levels of PCR product were normalized to a housekeeping gene (GAPDH). Cytokine data are presented as the mean log10 fold-increase above levels in uninfected control mice. Primers and probes were as follows: P30, forward, TTTCCGAAGGCAGTGAGACG; P30, reverse, GGATCCGATGCCATAGCG; P30, probe, TTGCCGCGCCCACACTGATG; IFN-
, forward, CATTGAAAGCCTAGAAAGTCTGAATAAC; IFN-
, reverse, TGGCTCTGCAGGATTTTCATG; IFN-
, probe, TCACCATCCTTTTGCCAGTTCCTCCAG; IL-12p40, forward, GGAAGCACGGCAGCAGAATA; IL-12p40, reverse, AACTTGAGGGAGAAGTAGGAATGG; IL-12p40, probe, CATCATCAAACCAGACCCGCCCAA; GAPDH, forward, CTCGTCCCGTAGACAAAATGG; GAPDH, reverse, AATCTCCACTTTGCCACTGCA; GAPDH, probe, CGGATTTGGCCGTATTGGGCG.
Abs and flow cytometry
Mice were depleted of CD4+ cells by treatment with 1 mg of anti-CD4 (clone GK1.5) i.p. on days 0 and 2 relative to inoculation of cysts. Equal amounts of an isotype-matched Ab of irrelevant specificity was given as a control. The surface Ag phenotype of spleen and mesenteric lymph node cells was determined by flow cytometry using the following Abs: anti-CD4 (clone GK1.5), anti-CD8
(clone 53-6.7), anti-CD44 (clone IM7), anti-NK1.1 (clone PK136), anti-Gr1 (clone RB6-8C5). Cells were preincubated with Fc block (clone 2.4G2) before staining.
Histology
Pieces of liver, ileum, lung, spleen, and brain were fixed in 10% neutral-buffered formalin, mounted in paraffin, sectioned (5 µm), and stained with H&E. Slides were evaluated in a masked manner by one of us (W. Chen).
Statistics
Except where noted otherwise, there were five mice per experimental treatment group. Survival of mice in different groups was compared using the log rank test. Other measurements were compared statistically using Students t test. Where appropriate, data were log-transformed to satisfy requirements for use of the t test. Results were confirmed in at least two replicate experiments, unless otherwise stated.
| Results |
|---|
|
|
|---|
To assess whether CD1d deficiency renders mice susceptible to T. gondii infection, groups of CD1d-deficient B6 and BALB/c male mice and WT controls were infected orally with ME49 cysts. BALB/c CD1d-deficient mice were resistant to oral infection with 10 T. gondii cysts (Fig. 1A) or with 100 cysts (data not shown). In contrast, CD1d-deficient B6 mice experienced significantly greater weight loss (p < 0.05) and mortality (p < 0.01) than WT controls when orally infected with 10 T. gondii (Fig. 1, B and C). Parasite burdens in tissues of CD1d-deficient B6 mice and controls on day 8 or 9 of infection were determined in three experiments. Burdens trended moderately higher in ileums of CD1d-deficient B6 mice than in WT B6 mice (Table I) (average fold difference = 4.7) but reached statistical significance (p < 0.05) in only one experiment. In contrast, there were no remarkable differences in parasite burdens in the livers (Table I) or lungs (data not shown). The results demonstrate that CD1d-deficient B6 mice are markedly susceptible to oral infection with T. gondii parasites but harbor only modestly higher parasite burdens in some tissues.
|
|
To assess pathological effects of T. gondii infection, groups of CD1d-deficient B6 mice and WT B6 controls were infected orally with 10 ME49 cysts and killed 8 days later for histological analysis. Sham-infected WT and CD1d-deficient mice showed no significant pathology. The ileums of infected WT B6 mice showed subacute enteritis, but no necrosis, along with occasional sloughing of villous epithelial cells, focal blunting and thickening of intestinal villi, and hypercellularity in the lamina propria. Some crypts were dilated and filled with necrotic cellular debris. There were increased numbers of intraepithelial cells but reduced numbers of Paneth cells. In comparison with infected WT B6 mice, the ileums of infected CD1d-deficient B6 mice were more severely affected, with more extensive infiltration of mononuclear cells in the lamina propria and more pronounced blunting and thickening of intestinal villi and sloughing of epithelial cells. The crypts were severely dilated. There were many bacteria, along with necrotic cellular debris, and many inflammatory cells in the intestinal lumens. These findings are illustrated in Fig. 2.
|
Immune responses of CD1d-deficient mice infected with T. gondii
T. gondii infection evokes strong type 1 inflammatory responses that are required for control of infection (1, 70), but may also promote immunopathology (33, 34). Therefore, in view of the increased susceptibility and enhanced immunopathology observed in infected CD1d-deficient B6 mice, we investigated whether type 1 immune responses were significantly different in infected WT B6 and CD1d-deficient B6 mice. Levels of serum IFN-
, but not IL-12p40, were significantly (p < 0.05) elevated in infected CD1d-deficient mice at 8 days of infection (Fig. 3A). Because the most severe pathology was evident in the ileums of infected CD1d-deficient mice, we also examined the levels of IFN-
and IL-12p40 mRNA in that tissue. IFN-
mRNA was significantly (p < 0.05) elevated in CD1d-deficient mice compared with infected control mice (Fig. 3B). IL-12p40 levels were also moderately elevated (p = 0.09) in the experiment shown, and in a replicate experiment (p < 0.05) (not shown).
|
mediate a lethal intestinal pathology in WT B6 mice infected orally with 100 ME49 cysts (33, 34, 71). Even if infected with only 10 cysts, WT B6 mice developed sublethal intestinal pathology (Fig. 2). We therefore examined whether there were differences between infected CD1d-deficient B6 mice and WT B6 mice in the frequency or numbers of activated CD4+ T cells in lymphoid tissues. A higher frequency of activated (CD44high) CD4+ cells was observed both in spleens and mesenteric lymph nodes of infected CD1-deficient mice at 8 days into infection (Fig. 4A). In addition, significantly more activated CD4+ cells along with NK1.1+ cells (NK cells and some activated T cells; Refs. 72 and 73) and Gr1+ cells (granulocytes and some macrophages) were found in mesenteric lymph nodes of CD1d-deficient mice (Fig. 4B), but not in spleens (data not shown). Thus, cells with the potential to mediate intestinal immunopathology are present in greater numbers in the gut-draining lymph nodes of infected CD1d-deficient B6 mice.
|
We next assessed the contribution of CD4+ T cells to acute death and intestinal immunopathology in orally infected CD1d-deficient B6 mice. Groups of CD1d-deficient B6 mice and WT B6 controls were treated with a mAb that depletes CD4+ cells, or with an isotype-matched control mAb, and infected orally with 10 ME49 cysts. As shown in Fig. 5A, CD4-depleted CD1d-deficient mice lost significantly (p < 0.05) less body weight by day 12. Most importantly, the mice survived significantly longer (p < 0.05) than CD1d-deficient mice treated with a control mAb (Fig. 5B). A significant difference in body weight loss was evident as early as day 9 in a replicate experiment (not shown). These results demonstrate that CD4+ T cells contribute substantially to the acute death and exacerbated weight loss in infected CD1d-deficient mice.
|
|
14-deficient mice are not highly susceptible to acute T. gondii infection
CD1d-deficient mice lack a population of V
14+ T cells having an NK1.1+ phenotype (46). Therefore, to determine whether the increased susceptibility of CD1d-deficient mice during T. gondii infection is a consequence of a deficiency in V
14-expressing cells, we compared the course of infection in V
14-deficient B6 mice and WT B6 controls. No early deaths were observed in either group after oral infection with 10 ME49 cysts. However, V
14-deficient B6 mice were more susceptible than WT B6 mice later in the infection (Fig. 7A), suggesting a role for NKT cells during chronic T. gondii infection. Weight loss was similar in the two groups for
2 wk, after which, V
14-deficient mice displayed somewhat greater weight loss, reaching statistical significance (p < 0.05) by day 20 (Fig. 7B). Loss of body weight was examined in a third experiment in which mice were given 40 cysts instead of 10 (Fig. 7C). V
14-deficient mice again lost more weight than WT controls, and the difference was evident sooner than in mice given only 10 cysts (Fig. 7A). Overall, V
14-deficient B6 mice were as resistant as WT B6 mice during the initial period of T. gondii infection, but showed more weight loss and greater susceptibility as the infection progressed to the chronic phase.
|
| Discussion |
|---|
|
|
|---|
responses. Furthermore, death is delayed and weight loss is less severe if the mice are depleted of CD4+ cells at the time of infection. Thus, there is a link between a CD1d-dependent mechanism of resistance to T. gondii and pathological effects of CD4+ T cells. T. gondii-infected B6 mice are prone to intestinal pathology mediated by CD4+ T cells and type 1 cytokines, whereas BALB/c mice are not (33, 34). Significantly, in this study, CD1d-deficient B6 mice were susceptible to T. gondii infection and CD1d-deficient BALB/c mice were not. We speculate that the well-documented difference between B6 and BALB/c mice in susceptibility to CD4-dependent intestinal pathology may be a major reason for the contrasting outcomes in the two CD1d-deficient strains when infected with T. gondii. However, we recognize that other factors may be involved, because differences between CD1d-deficient B6 and BALB/c background mice have been seen in immune responses to infections that do not involve intestinal pathology (60, 64).
Because CD1d-deficient mice lack a population of V
14-expressing NKT cells, a plausible hypothesis is that this deficiency is a cause of increased susceptibility of CD1d-deficient mice. Indeed, a role for NKT cells in resistance to T. gondii was previously shown in MHC class II-deficient mice using a vaccination/challenge model (54) in which the protective cells were postulated to be CD1d restricted (55). However, our results indicate that, during acute primary infection, a deficiency of V
14+ cells did not lead to greater weight loss or mortality. Nonetheless, a protective role for V
14-expressing cells, presumably NKT cells, was evident during chronic infection (Fig. 7), when acquired immune protective mechanisms come strongly into play (1). Although V
14+ NKT cells are a major population of CD1d-restricted cells, mice possess additional CD1d-restricted populations, denoted nonclassical NKT cells. Nonclassical NKT cells are activated in a mouse model of hepatitis B virus infection (74), and CD1d-restricted human cells not bearing an invariant TCR (V
24) are activated by nonlipidic small molecules (38). These examples reveal that CD1d-dependent resistance mechanisms may involve more than V
14+ NKT cells, as our acute survival data suggest.
How might a CD1d-restricted mechanism mediate resistance to T. gondii? Possibly a CD1d-dependent mechanism down-regulates potentially pathological effects of CD4+ T cells during infection. Consistent with this idea is our observation that CD4+ T cells with an activated phenotype are present in greater numbers in the lymph nodes draining the intestine of orally infected CD1d-deficient B6 mice than in controls (Fig. 4). In addition, levels of serum IFN-
protein and IFN-
mRNA in the ileum were elevated in T. gondii-infected CD1d-deficient B6 mice compared with WT mice (Fig. 3). Notably, a previous study found higher IFN-
, IL-12, and IL-4 responses to viral infection in CD1d-deficient mice than in WT mice, and elevated numbers of IFN-
-producing spleen cells (75). Consistent with that work, our findings suggest that potentially pathological cytokines are dysregulated in CD1d-deficient mice. Prior studies have clearly demonstrated an important role for IL-10 in regulating intestinal immunopathology induced by oral T. gondii infection (71). In this context, it is noteworthy that gene-targeted mice that develop chronic inflammation of the colon generate a population of IL-10-producing B cells in which CD1d is up-regulated (76). Furthermore, expression of CD1d on murine gastrointestinal epithelium has been reported (77), and CD1 ligation can induce IL-10 expression in intestinal epithelium (78). Thus, in the absence of CD1d expression, the ability to regulate intestinal inflammation via IL-10 might be lost. In addition to IL-10, TGF-
has been shown to play a critical role in controlling the ileitis induced by oral T. gondii infection (79). Three experiments were performed to determine whether differences in potential regulatory cytokines, such as IL-10 or TGF-
, could explain the difference in susceptibility between WT and CD1d-deficient mice. TGF-
mRNA levels in ileums did not differ significantly. IL-10 mRNA levels were moderately lower (2-fold) in CD1d-deficient mice in one experiment but not significantly lower in the other two. We conclude that different IL-10 and TGF-
mRNA levels in ileums are unlikely to explain the differential susceptibility of CD1d-deficient mice and WT mice to acute T. gondii infection.
An alternative explanation for the susceptibility of CD1d-deficient mice supposes that CD1d-deficient mice lack an undefined CD1d-dependent mechanism directly able to control parasites. CD1d-restricted cells can be directly cytolytic to some targets via perforin-dependent or granzyme-dependent mechanisms (59, 80) and therefore may possess antiparasite effector functions. The trend toward higher parasite numbers we observed in the ileums of CD1d-infected mice (Table I) is consistent with impaired antiparasite effector functions in CD1d-deficient mice. A compromised ability to control parasites in that vital tissue, combined with the inherent susceptibility of B6 mice to CD4-mediated intestinal pathology, might well be sufficiently harmful to cause death of the mice. Defining which, if any, of these possibilities is the correct explanation for the remarkable susceptibility of CD1d-deficient B6 mice to infection with T. gondii is the subject of ongoing studies.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by National Institute of Allergy and Infectious Diseases Grants AI-46571 and AI-61587 (to L.L.J.) and HL-72937 (to S.T.S.). ![]()
2 Address correspondence and reprint requests to Dr. Lawrence L. Johnson, Trudeau Institute, Inc., 154 Algonquin Avenue, Saranac Lake, NY 12983. E-mail address: ljohnson{at}trudeauinstitute.org ![]()
3 Abbreviation used in this paper: WT, wild type. ![]()
Received for publication December 10, 2004. Accepted for publication March 22, 2005.
| References |
|---|
|
|
|---|
by an intracellular parasite and induces resistance in T-cell-deficient hosts. Proc. Natl. Acad. Sci. USA 90: 6115-6119.
synthesis and resistance during acute infection with Toxoplasma gondii. J. Immunol. 153: 2533-2543.[Abstract]
is required for IL-12 to induce production of IFN-
by NK cells: a role for IL-1
in the T cell-independent mechanism of resistance against intracellular pathogens. J. Immunol. 155: 4347-4354.[Abstract]
-interferon by natural killer cells from Toxoplasma gondii-infected SCID mice: regulation by interleukin-10, interleukin-12, and tumor necrosis factor-
. Infect. Immun. 62: 2818-2824.
-Interferon-dependent temporary resistance to acute Toxoplasma gondii infection independent of CD4+ or CD8+ lymphocytes. Infect. Immun. 61: 5174-5180.
response in natural killer cells that requires both adherent accessory cells and tumor necrosis factor-
. J. Immunol. 150: 3982-3989.[Abstract]
: the major mediator of resistance against Toxoplasma gondii. Science 240: 516-518.
-interferon. Infect. Immun. 58: 3050-3055.
-induced L-arginine-dependent toxoplasmastatic activity in murine peritoneal macrophages is mediated by endogenous tumor necrosis factor-
. J. Immunol. 148: 568-574.[Abstract]
is required for enhanced antimicrobial activity against Toxoplasma gondii and Listeria monocytogenes in recombinant
-interferon-treated mice. Infect. Immun. 60: 5107-5112.
prevents cure of toxoplasmosis mediated by drug therapy in mice. J. Immunol. 149: 3003-3007.[Abstract]
-interferon response and resistance to acute primary Toxoplasma gondii infection in mice. Microbiol. Immunol. 38: 789-796.[Medline]
, TNF-
, and inducible nitric oxide synthase. J. Immunol. 164: 2629-2634.
-mediated necrosis of the small intestine with genetic susceptibility of mice to peroral infection with Toxoplasma gondii. J. Exp. Med. 184: 597-607.
, nitric oxide, and IFN-
are all critical for development of necrosis in the small intestine and early mortality in genetically susceptible mice infected perorally with Toxoplasma gondii. Parasite Immunol. 21: 365-376.[Medline]
14NKT cells by glycosylceramides. Science 278: 1626-1629.
chain is used by a unique subset of major histocompatibility complex class I-specific CD4+ and CD48 T cells in mice and humans. J. Exp. Med. 180: 1097-1106.
14 NKT cells in lungs and their roles in Th1 response and host defense in cryptococcal infection. J. Immunol. 167: 6525-6532.
14-J
281 TCR. J. Immunol. 170: 1430-1434.
14+ natural killer T cells in the innate phase of host protection against Streptococcus pneumoniae infection. Eur. J. Immunol. 33: 3322-3330.[Medline]
14 NKT cells. Proc. Natl. Acad. Sci. USA 95: 5690-5693.
-producing intraepithelial lymphocytes. Gastroenterology 120: 914-924.[Medline]
/
+ thymocytes against a CD4+CD8+ thymocyte population associated with intact Fas expression on the target. J. Exp. Med. 180: 423-432.This article has been cited by other articles:
![]() |
K. N. Couper, P. A. Lanthier, G. Perona-Wright, L. W. Kummer, W. Chen, S. T. Smiley, M. Mohrs, and L. L. Johnson Anti-CD25 Antibody-Mediated Depletion of Effector T Cell Populations Enhances Susceptibility of Mice to Acute but Not Chronic Toxoplasma gondii Infection J. Immunol., April 1, 2009; 182(7): 3985 - 3994. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Wingender and M. Kronenberg Role of NKT cells in the digestive system. IV. The role of canonical natural killer T cells in mucosal immunity and inflammation Am J Physiol Gastrointest Liver Physiol, January 1, 2008; 294(1): G1 - G8. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zeissig, A. Kaser, S. K. Dougan, E. E. S. Nieuwenhuis, and R. S. Blumberg Role of NKT Cells in the Digestive System. III. Role of NKT cells in intestinal immunity Am J Physiol Gastrointest Liver Physiol, December 1, 2007; 293(6): G1101 - G1105. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Goldszmid, A. Bafica, D. Jankovic, C. G. Feng, P. Caspar, R. Winkler-Pickett, G. Trinchieri, and A. Sher TAP-1 indirectly regulates CD4+ T cell priming in Toxoplasma gondii infection by controlling NK cell IFN-{gamma} production J. Exp. Med., October 29, 2007; 204(11): 2591 - 2602. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. B. Au-Yeung and D. J. Fowell A Key Role for Itk in Both IFN{gamma} and IL-4 Production by NKT Cells J. Immunol., July 1, 2007; 179(1): 111 - 119. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Mallevaey, J. Fontaine, L. Breuilh, C. Paget, A. Castro-Keller, C. Vendeville, M. Capron, M. Leite-de-Moraes, F. Trottein, and C. Faveeuw Invariant and Noninvariant Natural Killer T Cells Exert Opposite Regulatory Functions on the Immune Response during Murine Schistosomiasis Infect. Immun., May 1, 2007; 75(5): 2171 - 2180. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Parent, L. B. Wilhelm, L. W. Kummer, F. M. Szaba, I. K. Mullarky, and S. T. Smiley Gamma Interferon, Tumor Necrosis Factor Alpha, and Nitric Oxide Synthase 2, Key Elements of Cellular Immunity, Perform Critical Protective Functions during Humoral Defense against Lethal Pulmonary Yersinia pestis Infection. Infect. Immun., June 1, 2006; 74(6): 3381 - 3386. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |