The JI Acurri Cytometers
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ossendorp, F.
Right arrow Articles by Melief, C. J. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ossendorp, F.
Right arrow Articles by Melief, C. J. M.
The Journal of Immunology, 2005, 174: 7815-7822.
Copyright © 2005 by The American Association of Immunologists

Differential Expression Regulation of the {alpha} and {beta} Subunits of the PA28 Proteasome Activator in Mature Dendritic Cells1

Ferry Ossendorp2,3,*, Nathalie Fu2,*, Marcel Camps*, Francesca Granucci||, Sam J. P. Gobin*, Peter J. van den Elsen*, Danita Schuurhuis*, Gosse J. Adema{dagger}, Grayson B. Lipford{ddagger}, Tomoki Chiba§, Alice Sijts, Peter-M. Kloetzel, Paola Ricciardi-Castagnoli|| and Cornelis J. M. Melief*

Departments of* Immunohematology and Blood Transfusion, Leiden University Medical Center, Leiden, The Netherlands; {dagger} Department of Tumor Immunology, Nij-megen Centre for Molecular Life Sciences, University Medical Center, Nijmegen, The Netherlands; {ddagger} Institute for Medical Microbiology and Immunology, Technical University of Munich, Munich, Germany; § Department of Molecular Oncology, Tokyo Metropolitan Institute of Medical Science, Tokyo, Japan; Institute of Biochemistry, Charité, Humboldt University Berlin, Berlin, Germany; and || Department of Biotechnology and Bioscience, University of Milano-Bicocca, Milan, Italy


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Activation of dendritic cells (DC) by Th-dependent (CD40) or -independent (LPS, CpG, or immune complexes) agonistic stimuli strongly enhances the expression of the proteasome activator PA28{alpha}{beta} complex. Upon activation of DC, increased MHC class I presentation occurred of the melanocyte-associated epitope tyrosinase-related protein 2180-188 in a PA28{alpha}{beta}-dependent manner. In contrast to other cell types, regulation of PA28{alpha}{beta} expression in DC after maturation was found to be IFN-{gamma} independent. In the present study, we show that expression of PA28{alpha} and {beta} subunits was differentially regulated. Firstly, PA28{alpha} expression is high in both immature and mature DC. In contrast, PA28{beta} expression is low in immature DC and strongly increased in mature DC. Secondly, we show the presence of a functional NF-{kappa}B site in the PA28{beta} promoter, which is absent in the PA28{alpha} promoter, indicating regulation of PA28{beta} expression by transcription factors of the NF-{kappa}B family. In addition, glycerol gradient analysis of DC lysates revealed elevated PA28{alpha}{beta} complex formation upon maturation. Thus, induction of PA28{beta} expression allows proper PA28{alpha}{beta} complex formation, thereby enhancing proteasome activity in activated DC. Therefore, maturation of DC not only improves costimulation but also MHC class I processing. This mechanism enhances the CD8+ CTL (cross)-priming capacity of mature DC.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosures
 References
 
Dendritic cells (DC)4 are specialized APC that are able to present antigenic peptides in both MHC class II and I molecules for optimal priming of Ag-specific T lymphocytes. Efficient uptake of antigenic protein followed by processing to peptide fragments suited for presentation in MHC molecules are crucial functions of these cells. DC can efficiently present Ags in MHC class II molecules using the exogenous route of Ag uptake and degradation in the endosomal/lysosomal pathway (reviewed in Ref. 1). In contrast, the MHC class I presentation route in DC is less well understood but is in general dependent on proteasome activity, requiring antigenic proteins to enter the cytosol after exogenous uptake.

After Ag presentation in MHC class II molecules, specific Th cells can interact with DC to deliver signals that lead to an activated state of DC. This is an essential step for efficient priming of MHC class I-restricted CTL, which requires cognate interactions between CD40L (CD154) on Th cells and CD40 on DC (2, 3, 4). Th-independent (innate) signals such as bacterial LPS or CpG, triggering specific TLR, can also induce the DC maturation required for CTL priming (5, 6, 7, 8). This mature state is characterized by up-regulated expression of several cell surface molecules, including the costimulatory molecules CD80 and CD86 and MHC class II and class I. A recent report shows that triggering of TLR on bone marrow-derived DC (BMDC) can improve cross-presentation of protein-derived antigenic peptides in MHC class I (9). Delamarre et al. (10) showed that presentation of exogenous Ags on MHC class I and class II molecules is differentially regulated during DC maturation, although a molecular explanation for this was not provided.

The immunomodulatory cytokine IFN-{gamma}, produced during an immune response by activated Th 1 lymphocytes, CD8+ CTL, and NK cells, enhances Ag presentation by up-regulation of MHC and TAP gene products, as well as proteasome subunits and regulators (11). IFN-{gamma} alters proteasome activity qualitatively by induction of three newly synthesized proteasome {beta} subunits LMP2, LMP7, and MECL-1, which replace the three constitutive {beta}1 ({delta}), {beta}2 (MB1), and {beta}5 (Z) subunits, respectively, in the core 20S proteasome. Several groups reported that these so-called immunosubunits are incorporated interdependently (12, 13, 14, 15). Taken together with the reported differences in fine specificity (16, 17, 18), these findings imply that two types of proteasomes exist: "constitutive" proteasomes, which are expressed in all somatic cells, and "immunoproteasomes," which are expressed under influence of immunomodulatory cytokines such as IFN-{gamma}. However, immunoproteasomes can be constitutively expressed in some cells, in particular, lymphoid cells and DC (19, 20). In vitro studies showed that proteasomes equipped with LMP2, LMP7, and MECL-1 are more efficient in the generation of several antigenic viral peptides (21). Mice that were made deficient for LMP2 (22) or LMP7 (23) can be regarded as immunoproteasome-deficient mice. These mice showed impairment in the presentation of some Ags, indicating that immunoproteasomes are indeed involved in generation of immunologically relevant antigenic peptides in vivo. Recently, LMP2-deficient mice have revealed that immunoproteasomes can also affect shaping of the CTL repertoire (24).

In addition to proteasome immunosubunits, IFN-{gamma} also regulates the expression of the proteasome-associated complex PA28 (REG or the 11S regulator). PA28 was identified as a proteasome activator that strongly increases the maximal velocity of the hydrolytic reaction and decreases the concentration of substrate required for cleavage by purified 20S proteasomes (25, 26). Isolated PA28 does not display enzymatic activity by itself. Three homologous PA28 subunits have been cloned thus far, of which, only the {alpha} and {beta} subunits are strongly induced by IFN-{gamma} (27). Protein chemical analyses have revealed that the {alpha} and {beta} subunits form a tightly connected heterohexameric or heteroheptameric complex, composed of comparable amounts of both subunits (28). The PA28{alpha}{beta} heteromultimer is able to bind to the {alpha} rings of the 20S core proteasome, creating bell-shaped cap structures on both ends (11) or on one end, combined with the PA700 (or 19S) cap (the ubiquitin-dependent targeting/unfolding ATPase complex) on the other end (29, 30), to form the so-called "hybrid proteasome." The mechanism of PA28-mediated enhancement of intrinsic proteasome activity is not fully clear, although the cocrystalization structure of PA26 (the trypanosome homologue of PA28) with the 20S catalytic core shows a conformational change in the {alpha} subunits that leads to an opening of the exit gate of the proteasome (31).

Both in vitro and in vivo studies have provided evidence that PA28{alpha}{beta} was implicated in MHC class I Ag processing. In vitro digestion studies with long peptides comprising dominant CTL epitopes showed that purified PA28{alpha}{beta} can enhance cleavage by the 20S proteasome, leading to augmented epitope liberation (32). Furthermore, expression of PA28{alpha} in mouse fibroblasts increased the sensitivity for lysis by virus-specific CTL (33). We have shown that upon controlled expression of PA28{alpha}{beta} in a tetracycline-dependent system, functional presentation of some Moloney leukemia virus CTL epitopes was increased significantly (34). The absence of PA28{alpha}{beta} in vivo reduces epitope processing and CTL recognition of some Ags, as shown in PA28{alpha}{beta}-deficient mice (35). Furthermore, PA28{alpha}{beta} expression in melanoma cells could rescue processing and presentation of a CTL epitope from the tyrosinase-related protein 2 (TRP-2) Ag that was normally not presented in these tumor cells (36).

Macagno et al. (19, 20) have shown in human DC that PA28{alpha} and {beta} expression was elevated after DC maturation. These reports show that PA28 expression is independent of assembly of constitutive and immunoproteasomes. However, the expression regulation of these PA28 subunits in maturing DC was not addressed.

So far, IFN-{gamma} appears to be the main regulator of the processing and presentation pathway. We have now investigated the role of DC activation via Th-dependent (CD40) and Th-independent signals (LPS) on the MHC class I-processing pathway. For this study, we have used the well-characterized mouse DC cell line D1 (37). This cell line is a growth factor-dependent spleen-derived DC cell line that, upon appropriate culture, maintains a fully immature state associated with efficient Ag uptake capacity. When activated, it matures both phenotypically and functionally (5). We have observed that such activation is required for efficient MHC class I presentation of a viral CTL epitope or for presentation of the SIINFEKL epitope from the OVA protein as delivered to DC via Ab-Ag immune complexes (IC) (38). This way of cross-presentation in MHC class I is FcR and proteasome dependent (39). DC that have been pulsed with protein Ag via IC very efficiently cross-prime CD8+ CTL responses in vivo (38). Interestingly, Pierre and coworkers (40, 41) have shown the presence of ubiquitin aggregates (so-called DALIS) in mature DC, suggesting a role of proteasome activity in direct MHC class I presentation.

Our detailed analysis of the changes in the molecular machinery of MHC class I Ag processing during maturation of DC shows enhanced expression of the PA28{beta}-chain of the PA28{alpha}{beta} heteromeric, proteasome-associated complex. Both LPS- and CD40-mediated stimulation strongly induced RNA and protein expression of PA28{beta}, independently of IFN-{gamma}. The induced PA28{alpha}{beta} complexes were functionally active in mature D1 DC. In immature cells, the assembly of PA28{alpha}{beta} complexes appeared to be limited by the low expression of PA28{beta}, whereas PA28{alpha} expression was already high. This study indicates differentially regulated gene expression of these two molecules.

These findings are compatible with the "license to kill model" in which maturation of DC is a crucial step for initiation of effective CTL immune responses. Our data show that maturation of DC not only improves "signal two" but also enhances "signal one."


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosures
 References
 
Dendritic cells

The D1 DC line, a long-term, growth factor-dependent, immature splenic DC cell line derived from C57BL/6 (H-2b) mice, was cultured as described previously (37). Freshly isolated DC were cultured from bone marrow cells of C57BL/6, PA28KO, and IFN-{gamma}RKO (purchased from The Jackson Laboratory) as described previously (38).

DC were matured as previously described (5) by incubation with either 10 µg/ml LPS (Sigma-Aldrich) or 40 µg/ml of the CD40-specific agonistic mAb FGK45, 20 IU/ml murine IFN-{gamma} (PeproTech), 1 µg/ml CpG-oligodeoxynucleotide 1826, sequence TCCATGACGTTCCTGACGTT, fully phosphorothiotated (kindly provided by the Coley Pharmaceutical Group), and OVA-anti-OVA IC as previously described (38) or left untreated. Cells were detached by 2 mM EDTA in PBS, collected, and used for experiments.

CTL assays

Freshly isolated primary DC cultures were generated from the bone marrow of either C57BL/6 mice or PA28{alpha}{beta}-deficient mice (35). These cells were either left immature or matured with 15 µg/ml LPS. After 48 h, the cells were incubated with either the TRP-2180-188 minimal peptide SVYDFFVWL (100 ng/ml) or a 14-mer C-terminally extended peptide TRP-2180-193 SVYDFFVWLHYYSV (1 µg/ml). After 1 h at 37°C, the cells were extensively washed and plated in different densities. After overnight incubation, 5000 cells of the TRP-2180-188-specific CTL clone LP9 (42) were added. Supernatants were harvested after 8 h. Specific recognition was determined by IFN-{gamma} release by the CTL clone using a sandwich ELISA method described previously (43).

Cell surface immunofluorescence

FITC-conjugated mAbs against CD86/B7.2 and MHC class II I-Ab (M5/114) were purchased from BD Pharmingen. MHC class I Kb (B8–24-3)- and Db (28.14.8S)-specific Abs were purified and FITC labeled. D1 cells were stained with these Abs as previously described (5) and analyzed by FACScan.

Western blot analysis

Polyclonal rabbit Abs against murine PA28{alpha}, PA28{beta}, LMP-2, LMP-7, and MECL-1 were used for Western blot analysis as described previously (34). In short, the protein content of 0.1% Triton X-100 total lysates of immature or matured D1 cells was determined by measuring the OD at 280 nm, and 10 µg protein/slot was separated by SDS-PAGE, blotted to nitrocellulose filters, incubated with the Abs, and detected by HRP-conjugated anti-rabbit IgG followed by chemiluminescence.

Analysis of PA28{alpha}{beta} complexes

PA28 complexes were analyzed as described before (34). In short, 5 mg of protein of 0.1% Triton X-100 total cell lysates derived from ~30 x 106 nonstimulated or stimulated D1 cells were loaded on preformed 10–40% glycerol continuous gradients. Gradient fractions with a volume of 600 µl were collected and tested for the presence of PA28 by Western blot analyses using PA28{alpha}- and PA28{beta}-specific polyclonal rabbit antisera as described above. To determine PA28 activity, 20 µl of the glycerol gradient fractions and 80 µl of assay buffer (50 mM Tris-HCl (pH 7.5), 25 mM KCl, 10 mM NaCl, 1 mM DTT, and 0.1 mM EDTA) containing 100 µM Suc-LLVY-AMC were incubated in 96-well plates. To each well, 30 ng of purified 20S proteasomes of mouse embryo cells (MEC) were added, and the reactions were incubated for 1 h at 37°C. Fluorescence emission was measured at 460 nm (excitation 360 nm) with a Fluorostar reader.

Quantitative RNA analysis

Total RNA was extracted from 106 nonstimulated and stimulated D1 cells using the TRIzol reagent according to the recommended procedure (Invitrogen Life Technologies). Single-strand cDNA was synthesized using Superscript Reverse Transcriptase (Invitrogen Life Technologies). mRNA quantitation was performed using the ABI Prism 7700 Sequence Detection System (44).

Five microliters of cDNA (equivalent to 0.05 µl total RNA) were used per amplification. For all PCRs, the following conditions were used: after activation of the polymerase (10 min at 95°C), 50 cycles of 15 s at 95°C, 30 s at 63°C, and data collection at an additional 30 s at 63°C were performed. Probes, containing the reporter dye TET and quencher TAMRA, were used at a concentration of 160 nM. Quantitative real-time PCR was performed on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems) using the qPCR Core kit (Eurogentec) and analyzed using the SDS v1.7 software package (Applied Biosystems).

Primers and probes used in this study were selected with Primer Express v1.5 software (Applied Biosystems). As internal control GAPDH was used, oligonucleotides used for the amplification were as follows: GAPDH sense, 5'-TCACTGGCATGGCCTTCC-3'; GAPDH anti-sense, 5'-GGCGGCACGTCAGATCC; PA28{alpha} sense, 5'-GGCCACACTGAGGGTCCAT-3'; PA28{alpha} anti-sense, 5'-CACAGGTCTTCACGGAACACA-3'; PA28{beta} sense, 5'-GATTCCCTCAATGTGGCCG-3'; and PA28{beta} anti-sense, 5'-GATCTGGGATAGGGATGTCCAG-3'.

Oligonucleotide probes had the fluorescent TET modification at the 5' end and the TAMRA quencher in 3' end. They were as follows: GAPDH; TET-TTCCTACCCCCAATGTGTCCGTCG-TAMRA; PA28{alpha}; TET-CCGAAGCCCAAGCCAAGGTGG-TAMRA; and PA28{beta}; TET-CCTCTCCTCCCTCCGGGCTCC-TAMRA.

EMSA

Nuclear extracts of 10 x 106 nonstimulated and stimulated D1 cells were prepared as described previously (45). The total amount of protein was determined using the BCA Protein Assay kit (Pierce), according to the manufacturer’s instructions.

EMSA was performed by incubating nuclear extracts (5 µg of protein) in DNA protein-binding buffer (10 mM HEPES (pH 7.9), 60 mM KCl, 10% v/v glycerol, 1 mM DTT, 1 mM EDTA, 3 mM MgCl2, and 10 mM NaPi), with 200 ng of poly(dI:dC), 200 ng of sonicated single-stranded herring sperm DNA, and 1 ng of 32P-labeled probe for 30 min at 4°C. The samples were run on a 6% nondenaturing gel in 0.25x Tris-borate EDTA buffer at 200 V for 2 h. The gels were fixed with a 10% methanol, 10% acetic acid solution, dried onto Whatmann 3M paper, and exposed to a x-ray film. The ds-oligonucleotide encompassing the potential NF-{kappa}B site within the promoter sequence of the murine PA28{beta} gene (5'-TCCCCGGCGGGGAAGTCCCACCTTATC-3') was used as a probe for the EMSA (46). A known NF-{kappa}B-binding sequence from HLA class I (45) was used as competitor probe.

For supershift assays, 1 µg of each Ab directed against members of the NF-{kappa}B/Rel family of transcription factors was added to the nuclear extract and probe mixture and incubated for 1 h at 4°C. The Abs used were RelB (sc-226x), RelA (sc-109x), and p50 (sc-114x; Santa Cruz Biotechnology).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosures
 References
 
DC maturation enhances CTL recognition in a PA28-dependent fashion

The involvement of PA28 in CTL epitope processing in maturing DC was tested by measuring the presentation of the PA28-dependent CTL epitope 180-188 of the melanoma Ag TRP-2. We prepared BMDC cultures from PA28{alpha}{beta}-deficient mice (PA28KO) (35) and wild-type C57BL/6 (B6) mice. These DC were either left immature or treated with LPS for 48 h to induce maturation as indicated by elevated expression of CD86, CD40, and MHC class II and class I (data not shown). After 48 h, the cells were incubated with a processing-dependent synthetic peptide 180-193 harboring the TRP-2 epitope and a 5-aa C-terminal extension. CTL epitope presentation was monitored with a TRP-2-specific CTL clone (Fig. 1A). The data show that both B6 and PA28KO immature DC are very inefficient in processing and presentation of the TRP-2 epitope, whereas LPS-matured B6 DC showed very efficient presentation. In contrast, PA28KO DC showed strongly reduced capacity of CTL epitope presentation, indicating the direct involvement of PA28{alpha}{beta} in the efficiency of processing of this epitope. The same cells were incubated with the processing-independent, minimal 9-mer peptide, which was equally well presented to the CTL by all types of DC (Fig. 1B).



View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 1. Maturation of DC improves MHC class I-mediated Ag presentation in a PA28{alpha}{beta}-dependent fashion. A, Recognition of the TRP-2180-188 epitope by CTL clone LP9. Freshly cultured DC were derived from the bone marrow of PA28{alpha}{beta}-deficient mice (PA28KO) and C57BL/6 wild-type mice. DC were treated for 48 h with LPS or were left untreated and incubated for 1 h with a processing-dependent 14-mer peptide SVYDFFVWLHYYSV containing the minimal epitope flanked with the natural sequence of 5 aa at the C terminus. After overnight incubation, CTL recognition was measured by IFN-{gamma} production using specific ELISA. B, A similar experiment as described above, but DC were incubated with the processing-independent minimal 9-mer peptide-TRP-2 CTL epitope SVYDFFVWL.

 
On the basis of these results, we performed an in depth molecular analysis of the PA28-proteasome-dependent Ag MHC class I-processing pathway in DC.

Constitutive high immunoproteasome expression in immature and mature DC

The well-defined murine DC line D1 develops functional maturation upon stimulation with bacterial LPS or CD40 ligation by agonistic mAb as evidenced by increased CD86, MHC class II and class I cell surface expression, and IL-12 production (5). Because of its homogeneity, this cell line is an excellent tool for biochemical studies. The expression of the proteasome immunosubunits LMP2, LMP7, and MECL-1 was determined in total cell lysates by Western blot analysis. LMP7 was already strongly expressed by immature D1 cells and was not detectably up-regulated by IFN-{gamma}, LPS, or anti-CD40 treatment (Fig. 2A, upper panel). LMP2 and MECL-1 analysis showed similar results (data not shown). Also, the lymphoid cell lines RMA (T cell lymphoma) and 771 (B cell lymphoma; data not shown) expressed high basal levels of LMP7. In contrast, fibroblast-type MEC did not show detectable expression of LMP7 (Fig. 2A). In MEC, LMP7 was up-regulated by IFN-{gamma} treatment but failed to be induced by LPS.



View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 2. Maturation of D1 DC enhances PA28 protein expression. A, Western blot analysis of total cell lysates of the D1 cell line, the T cell lymphoma cell line RMA, and the fibroblast-type B6 MEC line that were treated with IFN-{gamma}, LPS, or CD40 agonistic Ab for 48 h. Blots were probed with specific rabbit Abs against the immunoproteasome subunit LMP7, PA28{alpha}, and PA28{beta}. B, Western blot analysis of expression kinetics of PA28{alpha} and PA28{beta} in LPS- and CD40-stimulated D1 cells. C, Western blot analysis of expression kinetics of PA28{alpha} and PA28{beta} in LPS- and CpG-treated, freshly isolated B6 BMDC. D, Western blot analysis of expression kinetics of PA28{alpha} and PA28{beta} in IC-treated DC (D1, B6 and PA28KO). E, Western blot analysis of expression kinetics of PA28{alpha} and PA28{beta} in LPS-treated, freshly isolated BMDC from IFN-{gamma}R-deficient mice.

 
These results indicate that immature DC already possess high constitutive expression levels of immunoproteasomes that are only marginally enhanced upon DC activation.

PA28 expression is significantly increased after DC maturation

In the same Western blot experiments, we observed that the expression levels of PA28{alpha} and PA28{beta} were markedly enhanced upon IFN-{gamma} treatment but also following LPS and CD40 stimulation of D1 cells (Fig. 2A, lower panels). PA28{alpha} is already expressed at relatively high levels in resting DC and is only marginally increased after the different treatments. In contrast to this, PA28{beta} expression is very low in immature DC and strongly enhanced after DC maturation. Next, we analyzed the expression kinetics of PA28{alpha} and PA28{beta} after LPS or CD40 stimulation (Fig. 2B). This experiment shows that PA28{beta} expression is already detectably increased after 24 h of LPS or anti-CD40 treatment and reaches strongly elevated levels after 72 h of activation. In contrast, PA28{alpha} expression level is constitutively high in nonstimulated cells and is only moderately increased upon stimulation. These results suggest a differential regulation of PA28{alpha} and {beta} gene expression in DC. Similar results were obtained with freshly isolated BMDC cultures that were matured with LPS or the TLR9 ligand CpG (Fig. 2C). The kinetics and differential up-regulation of protein expression of PA28{alpha} and {beta} in these primary DC is similar to that of D1 cells, showing that D1 is a representative DC line.

Previously, we have shown that FcR-mediated activation and FcR-facilitated Ag uptake strongly improved MHC class I presentation and CTL cross-priming (38). In the present study, we have analyzed the ability of Ab-Ag IC to induce PA28 expression in DC. Fig. 2D shows strong induction of PA28{beta} in both D1 cell line and freshly isolated BMDC. As a control, PA28 expression was absent in PA28{alpha}{beta}-deficient BMDC.

In comparison to DC, the expression levels of PA28{alpha} are intermediate in the lymphoid cell line RMA and low in MEC (Fig. 2A). The expression level of PA28{beta} was low in RMA and almost undetectable in MEC. LPS or CD40 stimulation did not significantly influence PA28{alpha} or {beta} expression in these (non-DC) cell lines. However, IFN-{gamma} could induce expression of both PA28 molecules in MEC fibroblast cells.

These data suggest that TLR- or CD40-induced expression of the (classically IFN-{gamma}-inducible) PA28 molecules in DC is independent of IFN-{gamma}. This is supported by the fact that D1 DC do not produce detectable amounts of IFN-{gamma}, not even after activation by LPS or via CD40 (determined by specific ELISA; data not shown). To exclude the possibility of a role of secreted IFN-{gamma} by D1 cells, LPS or CD40 stimulation was also performed in the presence of neutralizing anti-IFN-{gamma} Abs. This Ab could block the expression of PA28{alpha} and {beta} as induced by exogenously added IFN-{gamma} but not the induction of expression of PA28{alpha} and {beta} by LPS or CD40 stimulation (data not shown). Importantly, BMDC of IFN-{gamma}R-deficient mice were analyzed for PA28{alpha} and {beta} expression after maturation with LPS. Fig. 2E shows similarly strong induction of the proteasome activator subunits, indicating IFN-{gamma} independence.

PA28{alpha} and {beta} molecules in mature DC are complexed and functional

PA28{alpha} and {beta} molecules are highly expressed in mature DC. To test whether these molecules are present in functional PA28{alpha}{beta} complexes, total lysates were subjected to glycerol gradient analysis. Under these conditions, PA28{alpha}{beta} complexes remain intact and functional. Fig. 3A shows the result of a Western blot analysis of the individual fractions of the glycerol gradients of immature D1 cells and CD40-matured D1 cells. Early fractions 3–5 contain the monomeric PA28 molecules, and fractions 7–10 contain the complexed PA28 molecules. The presence of PA28{alpha} is shown in Fig. 3A, left panel. This analysis shows that the total level of PA28{alpha} does not increase significantly upon DC activation by anti-CD40 Ab, but rather shifts from the monomeric form to the complexed form. In contrast, PA28{beta} expression (Fig. 3A, right panel) strongly increases following DC activation, and virtually all of the expressed PA28{beta} is then present in the complexed form (fractions 7–10). Fig. 3B shows a similar experiment with LPS-stimulated D1 cells. Although the shift of monomeric to complexed PA28{alpha} is less striking, the increased expression of PA28{beta} is apparent. The increased PA28{alpha}{beta} complex formation is similar to that seen following CD40 stimulation of D1 and again appears to be limited by PA28{beta} expression.



View larger version (41K):
[in this window]
[in a new window]
  		FIGURE 3. PA28{alpha}-PA28{beta} complexes are increased in D1 DC upon maturation. D1 cells were stimulated with CD40 Ab (A) and LPS (B) for 48 h. Total cell lysates were separated on 10–40% glycerol gradients, leaving PA28{alpha}{beta} complexes intact. Intact {alpha}{beta} complexes migrate in the middle fractions (7–10) of these gradients. Fifteen-microliter samples of fractions 3–12 were subjected to SDS-PAGE followed by Western blotting using specific Abs.

 
These complexes were tested for their functional activity by incubation of the individual glycerol gradient fractions with purified 20S proteasomes, allowing evaluation of the enhancing effect of the PA28 proteasome activator. The cleavage of a fluorigenic synthetic peptide substrate was measured as shown in Fig. 4A. This figure shows a strong increase in proteolytic activity in fractions 7–10 of both the lysates of CD40- and LPS-matured D1 cells in comparison to the same fractions of immature D1 cells. The basal activity of these fractions, in the absence of added purified 20S proteasomes, is low (Fig. 4B). Only in the later fractions (13, 14, 15, 16, 17) endogenous proteolytic activity can be measured. The early glycerol fractions 3–5, containing monomeric PA28{alpha} and {beta} subunits, do not exhibit strong functional activity.



View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 4. The elevated levels of PA28{alpha}-PA28{beta} complexes in matured D1 DC are functionally active. The glycerol gradient fractions described in Fig. 3 were tested for PA28 functionality. PA28{alpha}{beta} complexes can augment 20S proteasome activity upon coincubation. Twenty-microliter samples of the fractions were incubated in the presence (A) or the absence (B) of 30 ng of purified 20S proteasomes together with fluorescent peptide substrate Suc-LLVY-AMC to determine proteolytic activity. PA28{alpha}{beta} complexes migrate in the fractions 7–10 of the glycerol gradients. Higher molecular weight complexes such as 20S and 26S proteasomes migrate in later fractions, explaining the basal proteolytic activity in fractions 14–18 in the absence of added 20S proteasomes (B).

 
These data indicate that PA28{alpha} is already expressed at high, saturated levels in immature D1 cells and that functional PA28{alpha}{beta} complex formation is limited by PA28{beta} expression. Therefore, upon maturation of DC, the levels of PA28{beta} are strongly elevated, enabling formation of functional PA28{alpha}{beta} complexes.

Gene expression of PA28{alpha} and {beta} is differentially regulated

Our experiments indicate that PA28 up-regulation by LPS or CD40 stimulation occurs in an IFN-{gamma}-independent fashion. We investigated transcriptional activity of both genes after LPS and CD40 stimulation and IFN-{gamma} treatment of D1 cells. Fig. 5C shows that the levels of PA28{alpha} and {beta} transcripts are increased equally after IFN-{gamma} treatment during 6 and 18 h. This is in line with the presence of an IFN-stimulated response element in the promoters of both PA28{alpha} and {beta} (46). In contrast, LPS and CD40 treatment strongly increase transcriptional activity of the PA28{beta} gene already after 6 h (Fig. 5, A and B), whereas the level of PA28{alpha} transcripts was increased only marginally after 18 h. These data indicate that the transcription of both genes is regulated differentially. Therefore, we examined the published sequences of the promoter regions of both genes (46). It struck us that an important difference between the regulatory sequences of both genes was the presence of a NF-{kappa}B binding site in the PA28{beta} promoter sequence that was absent from the PA28{alpha} promoter sequence. As already shown before, LPS activation of D1 cells leads to increased levels of NF-{kappa}B (47). We have confirmed this by band shift analysis of a known HLA class I oligonucleotide NF-{kappa}B-binding sequence with nuclear extracts of LPS- and CD40-activated D1 cells in comparison with extracts of immature D1 (data not shown). To investigate the binding of NF-{kappa}B to this putative NF-{kappa}B site in the murine PA28{beta} promoter sequence, we synthesized an oligonucleotide probe of this sequence and performed a band shift assay using nuclear extracts of immature and matured D1 cells (Fig. 6). This experiment shows that the PA28{beta} {kappa}B sequence binds protein complexes present in these extracts. Significantly more protein is bound in extracts from LPS- and CD40-stimulated D1 cells. The observed bands can be supershifted by addition of RelA-, RelB-, and p50-specific Abs, showing that the sequence indeed is a NF-{kappa}B binding site. These data indicate that expression of the PA28{beta} and PA28{alpha} genes is regulated differentially via the NF-{kappa}B-signaling cascade and thus that PA28{beta} gene transcription can be enhanced independently by LPS- or CD40-mediated maturation of D1 DC.



View larger version (13K):
[in this window]
[in a new window]
  		FIGURE 5. Differential transcription activity of PA28{alpha} and PA28{beta} upon maturation of D1 DC. mRNA levels of PA28{alpha} and PA28{beta} were determined by quantitative PCR analysis. D1 cells were stimulated by LPS (A), anti-CD40 Ab (B), or IFN-{gamma} (C) for 3, 6, and 18 h. Transcription levels are depicted as the fold increase relative to GAPDH levels.

 


View larger version (102K):
[in this window]
[in a new window]
  		FIGURE 6. Increased binding of NF-{kappa}B complexes to the {kappa}B site in the PA28{beta} promoter upon LPS and CD40 stimulation. EMSA and supershift analysis of nuclear extracts from D1 DC were stimulated with LPS or CD40 Ab and incubated with radiolabeled {kappa}B probe of PA28{beta}. Arrows indicated enhanced complex formation upon DC stimulation. As a competitor probe, a cold consensus {kappa}B probe was used. Complexes were supershifted with specific Abs against RelB, RelA, and p50; supershifted complexes are indicated by an asterisk.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosures
 References
 
In the present study, we show that maturation of DC can influence the processing of CTL epitopes by elevated expression of the proteasome activator. This is achieved independently of the action of the classical immunomodulatory cytokine IFN-{gamma}. DC maturation, either in a Th cell-dependent fashion mimicked by the CD40 agonistic Ab or in an innate-type fashion via TLR triggers, results in increased functional expression of PA28{alpha}{beta} complexes. This indicates that mature DC acquire the capacity to increase their peptide quantities, as generated by the proteasome, for presentation in MHC class I molecules. Thus far, the function of the PA28{alpha}{beta} complex is thought to involve an increase in the activity of the 20S proteasome rather than a qualitative change in the function or fine specificity of the catalytic proteasome core. Although it cannot be fully excluded that interaction of the PA28{alpha}{beta} cap with the 20S core could also affect the individual activity of the proteolytic sites (a qualitative change in the proteolytic activity), the quantitative effect of PA28{alpha}{beta} on cleavage activity has been well described previously (26, 33, 48). The recent cocrystalization structure of PA26 (the trypanosome homologue of PA28) with the 20S catalytic core shows a conformational change in the {alpha} subunits that leads to an opening of the exit gate of the proteasome (31). This structure appears to support a role of PA28{alpha}{beta} in facilitating the release of peptide products and thereby a quantitative increase in the generation of relevant peptide lengths. Therefore, we interpret our findings in DC as mainly a quantitative effect on the availability of MHC class I-presented peptides. This is an important physiological event in APC acquiring the capacity for efficient priming of CTL by improving the expression of TCR ligands, namely MHC class I molecules presenting the appropriate peptide epitopes. Several reports (2, 4), including our own (3, 5), have shown that Th-dependent and Th-independent DC maturation signals are essential for acquisition of effective CTL priming capacity. So far, this is mainly explained by the elevated expression of MHC molecules, as well as relevant costimulatory molecules and crucial cytokines. In the present study, we show that DC maturation is not only associated with improved costimulation and MHC expression but also with improved MHC class I processing via up-regulation of functional PA28{alpha}{beta} regulator complexes.

Our findings show that PA28{alpha}{beta} complex formation in mature DC is limited by the low expression of the PA28{beta} molecule. This conclusion is based on several lines of evidence. First, Western blot analysis of total D1 cell lysates shows significantly more induction of PA28{beta} than of PA28{alpha}, upon DC maturation. Although this method is only a qualitative approach and has limitations caused by potential differences in affinity of the Abs used, it is clear from the glycerol gradient analysis that relatively more functional PA28{alpha}{beta} complexes are generated as a result of the presence of the PA28{beta} subunit. In addition to the protein data, independent quantitative analysis of mRNA transcripts of both molecules indicates that PA28{beta} is indeed more strongly up-regulated than PA28{alpha} upon maturation of DC. These findings are in agreement with the proteasome composition analysis in human monocyte-derived DC; higher levels of PA28{beta} transcripts than of PA28{alpha} can be observed in the data shown (20). In contrast, classical IFN-{gamma}-induced transcription of both genes does not differ with respect to the level of up-regulation. Triggering of the CD40 molecule, as a member of the TNFR family, as well as LPS activation, mediated via TLR4 (49) or CpG via TLR9 (50) are known to signal via an NF-{kappa}B-mediated cascade. The presence of a NF-{kappa}B binding site in the PA28{beta} promoter sequence and its absence in the corresponding PA28{alpha} sequence strongly suggests a differential mechanism of expression of both genes. In this study, we show the functionality of the PA28{beta} promoter NF-{kappa}B-binding sequence for its binding capacity to NF-{kappa}B protein complexes present in nuclear extracts of LPS- and CD40-matured DC. Taken together, these data strongly indicate a PA28{beta}-mediated mechanism for controlled elevation of the PA28{alpha}{beta} complex in maturing DC. This quantitative rather than qualitative mode of MHC class I-binding ligand regulation is further emphasized by the lack of change in the {beta} subunits of the 20S proteasome upon maturation. Immature DC already express the immunosubunits LMP-2, LMP-7, and MECL-1 at high constitutive levels. Therefore, a qualitative change in the fine specificity of the proteasome upon DC maturation, although reported for human monocyte-derived DC (19), is not supported by our findings.

Recent analysis of Ag presentation in PA28-deficient mice show that hsp90 could compensate for enhancing presentation of the OVA epitope (51). This suggests that other processing pathways could also play a role for certain Ags. The role of hsp90 in DC will be important to study.

The sequence of events in DC following Ag uptake, allowing cognate interactions with specific lymphocytes to occur, is apparently tightly regulated both at a cellular level and in time. It appears that MHC class II presentation occurs relatively rapidly after DC activation. Within a few hours, pre-existing intracellular MHC compartments fuse with the cell membrane, leading to a strong increase of MHC class II cell surface expression (37, 52, 53, 54). This allows specific Th-DC interactions to occur. The resulting Th-dependent signals will further mature the DC by expression of costimulatory molecules, and the MHC class I-processing machinery will be optimally engaged in the ensuing time period. In agreement with this model, we have observed recently sequential waves of Ag-specific CD4+ and CD8+ T cells in the regression of retrovirus-induced sarcoma (55). In conclusion, DC use a series of mechanisms for optimal priming of peptide-specific CTL. The peptide-epitopes are generated by a well-controlled processing system allowing efficient MHC class I presentation and thereby induction of specific CTL-mediated immunity.


   Acknowledgments
 
We thank Dr. S. Khan for carefully reading the manuscript, Dr. N. Beekman for technical assistance, and R. van Soest and Frank J. Magielsen for their technical support concerning the quantitative RNA analysis.


   Disclosures
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
References
 
The authors have no financial conflict of interest.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by Netherlands Cancer Foundation Grant UL 2002-2724 and European Community Grants QLRT 1999-00064, QLK2-CT-2000-00470, and QLK3-CT-2001-00093. Back

2 F.O. and N.F. contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Ferry Ossendorp, Department of Immunohematology and Blood Transfusion, Leiden University Medical Center, Leiden, The Netherlands. E-mail address: f.a.ossendorp{at}lumc.nl Back

4 Abbreviations used in this paper: DC, dendritic cell; BMDC, bone-marrow-derived DC; IC, immune complex; TRP-2, tyrosinase-related protein 2; MEC, mouse embryo cell. Back

Received for publication July 15, 2004. Accepted for publication April 12, 2005.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosures
 References
 

  1. van Bergen, J., F. Ossendorp, R. Jordens, A. M. Mommaas, J. W. Drijfhout, F. Koning. 1999. Get into the groove! Targeting antigens to MHC class II. Immunol. Rev. 172: 87-96.[Medline]
  2. Bennett, S. R., F. R. Carbone, F. Karamalis, R. A. Flavell, J. F. A. P. Miller, W. R. Heath. 1998. Help for cytotoxic-T cell responses is mediated by CD40 signaling. Nature 393: 478-480.[Medline]
  3. Schoenberger, S. P., R. E. Toes, E. I. van der Voort, R. Offringa, C. J. Melief. 1998. T cell help for cytotoxic T-lymphocytes is mediated by CD40-CD40L interactions. Nature 393: 480-483.[Medline]
  4. Ridge, J. P., F. Di Rosa, P. Matzinger. 1998. A conditioned dendritic cell can be a temporal bridge between a CD4+ T-helper and a T-killer cell. Nature 393: 474-478.[Medline]
  5. Schuurhuis, D. H., S. Laban, R. E. Toes, P. Ricciardi-Castagnoli, M. J. Kleijmeer, E. I. van der Voort, D. Rea, R. Offringa, H. J. Geuze, C. J. Melief, F. Ossendorp. 2000. Immature dendritic cells acquire CD8+ cytotoxic T lymphocyte priming capacity upon activation by T helper cell-independent or -dependent stimuli. J. Exp. Med. 192: 145-150.[Abstract/Free Full Text]
  6. Kaisho, T., O. Takeuchi, T. Kawai, K. Hoshino, S. Akira. 2001. Endotoxin-induced maturation of myd88-deficient dendritic cells. J. Immunol. 166: 5688-5694.[Abstract/Free Full Text]
  7. Sparwasser, T., E. S. Koch, R. M. Vabulas, K. Heeg, G. B. Lipford, J. W. Ellwart, H. Wagner. 1998. Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells. Eur. J. Immunol. 28: 2045-2054.[Medline]
  8. Sparwasser, T., R. M. Vabulas, B. Villmow, G. B. Lipford, H. Wagner. 2000. Bacterial CpG-DNA activates dendritic cells in vivo: T helper cell-independent cytotoxic T cell responses to soluble proteins. Eur. J. Immunol. 30: 3591-3597.[Medline]
  9. Datta, S. K., V. Redecke, K. R. Prilliman, K. Takabayashi, M. Corr, T. Tallant, J. DiDonato, R. Dziarski, S. Akira, S. P. Schoenberger, E. Raz. 2003. A subset of Toll-like receptor ligands induces cross-presentation by bone marrow-derived dendritic cells. J. Immunol. 170: 4102-4110.[Abstract/Free Full Text]
  10. Delamarre, L., H. Holcombe, I. Mellman. 2003. Presentation of exogenous antigens on major histocompatibility complex (MHC) class I and MHC class II molecules is differentially regulated during dendritic cell maturation. J. Exp. Med. 198: 111-122.[Abstract/Free Full Text]
  11. Tanaka, K., M. Kasahara. 1998. The MHC class I ligand-generating system: roles of immunoproteasomes and the interferon {gamma}-inducible proteasome activator PA28. Immunol. Rev. 163: 161-176.[Medline]
  12. Groettrup, M., R. Kraft, S. Kostka, S. Standera, R. Stohwasser, P.-M. Kloetzel. 1996. A third interferon {gamma}-induced subunit exchange in the 20S proteasome. Eur. J. Immunol. 26: 863-869.[Medline]
  13. Nandi, D., H. Jiang, J. J. Monaco. 1996. Identification of MECL-1 (LMP-10) as the third IFN-{gamma}-inducible proteasome subunit. J. Immunol. 156: 2361-2364.[Abstract]
  14. Hisamatsu, H., N. Shimbara, Y. Saito, P. Kristensen, K. B. Hendil, T. Fujiwara, E. Takahashi, N. Tanahashi, T. Tamura, A. Ichihara, K. Tanaka. 1996. Newly identified pair of proteasomal subunits regulated reciprocally by interferon {gamma}. J. Exp. Med. 183: 1807-1816.[Abstract/Free Full Text]
  15. Griffin, T. A., D. Nandi, M. Cruz, H. J. Fehling, L. V. Kaer, J. J. Monaco, R. A. Colbert. 1998. Immunoproteasome assembly: cooperative incorporation of interferon {gamma} (IFN-{gamma})-inducible subunits. J. Exp. Med. 187: 97-104.[Abstract/Free Full Text]
  16. Gaczynska, M., K. L. Rock, A. L. Goldberg. 1993. {gamma}-Interferon and expression of MHC genes regulate peptide hydrolysis by proteasomes. [Published erratum appears in 1995 Nature 374: 290.]. Nature 365: 264-267.[Medline]
  17. Boes, B., H. Hengel, T. Ruppert, G. Multhaup, U. H. Koszinowski, P.-M. Kloetzel. 1994. Interferon stimulation modulates the proteolytic activity and cleavage site preference of 20S mouse proteasomes. J. Exp. Med. 179: 901-909.[Abstract/Free Full Text]
  18. Kuckelkorn, U., S. Frentzel, R. Kraft, S. Kostka, M. Groettrup, P.-M. Kloetzel. 1995. Incorporation of major histocompatability complex-encoded subunits LMP2 and LMP7 changes the quality of the 20S proteasome polypeptide processing products independent of interferon {gamma}. Eur. J. Immunol. 25: 2605-2611.[Medline]
  19. Macagno, A., M. Gilliet, F. Sallusto, A. Lanzavecchia, F. O. Nestle, M. Groettrup. 1999. Dendritic cells up-regulate immunoproteasomes and the proteasome regulator PA28 during maturation. Eur. J. Immunol. 29: 4037-4042.[Medline]
  20. Macagno, A., L. Kuehn, R. de Giuli, M. Groettrup. 2001. Pronounced up-regulation of the PA28{alpha}/{beta} proteasome regulator but little increase in the steady-state content of immunoproteasome during dendritic cell maturation. Eur. J. Immunol. 31: 3271-3280.[Medline]
  21. Cerundolo, V., A. Kelly, T. Elliott, J. Trowsdale, A. Townsend. 1995. Genes encoded in the major histocompatibility complex affecting the generation of peptides for TAP transport. [Published erratum appears in 1995 Eur. J. Immunol. 25: 1485.]. Eur. J. Immunol. 25: 554-562.[Medline]
  22. Van Kaer, L., P. G. Ashton-Rickardt, M. Eichelberger, M. Gaczynska, K. Nagashima, K. L. Rock, A. L. Goldberg, P. C. Doherty, S. Tonegawa. 1994. Altered peptidase and viral-specific T cell response in LMP2 mutant mice. Immunity 1: 533-541.[Medline]
  23. Fehling, H. J., W. Swat, C. Laplace, R. Kühn, K. Rajewski, U. Müller, H. Von Boehmer. 1994. MHC class I expression in mice lacking the proteasome subunit LMP-7. Science 265: 1234-1237.[Abstract/Free Full Text]
  24. Chen, W., C. C. Norbury, Y. Cho, J. W. Yewdell, J. R. Bennink. 2001. Immunoproteasomes shape immunodominance hierarchies of antiviral CD8+ T cells at the levels of T cell repertoire and presentation of viral antigens. J. Exp. Med. 193: 1319-1326.[Abstract/Free Full Text]
  25. Ma, C. P., C. A. Slaughter, G. N. DeMartino. 1992. Identification, purification and characterization of a protein activator (PA28) of the 20S proteasome (macropain). J. Biol. Chem. 267: 10515-10523.[Abstract/Free Full Text]
  26. Dubiel, W., G. Pratt, K. Ferrell, M. Rechsteiner. 1992. Purification of an 11S regulator of the multicatalytic protease. J. Biol. Chem. 267: 22369-22377.[Abstract/Free Full Text]
  27. Jiang, H., J. J. Monaco. 1997. Sequence and expression of mouse proteasome activator PA28 and the related autoantigen Ki. Immunogenetics 46: 93-98.[Medline]
  28. Song, X., J. D. Mott, J. von Kampen, B. Pramanik, K. Tanaka, C. A. Slaughter, G. N. DeMartino. 1996. A model for the quaternary structure of the proteasome activator PA28. J. Biol. Chem. 271: 26410-26417.[Abstract/Free Full Text]
  29. Hendil, K., S. Khan, K. Tanaka. 1998. Simultaneous binding of PA28 and PA700 activators to 20S proteasomes. Biochem. J. 332:(Pt. 3): 749-754.
  30. Tanahashi, N., Y. Murakami, Y. Minami, N. Shimbara, K. Hendil, K. Tanaka. 2000. Hybrid proteasomes: induction by interferon {gamma} and contribution to ATP-dependent proteolysis. J. Biol. Chem. 275: 14336-14345.[Abstract/Free Full Text]
  31. Whitby, F. G., E. I. Masters, L. Kramer, J. R. Knowlton, Y. Yao, C. C. Wang, C. P. Hill. 2000. Structural basis for the activation of 20S proteasomes by 11S regulators. Nature 408: 115-120.[Medline]
  32. Dick, T. P., T. Ruppert, M. Groettrup, P. M. Kloetzel, L. Kuehn, U. H. Koszinowski, S. Stevanovic, H. Schild, H. G. Rammensee. 1996. Coordinated dual cleavages induced by the proteasome regulator PA28 lead to dominant MHC ligands. Cell 86: 253-262.[Medline]
  33. Groettrup, M., A. Soza, M. Eggers, L. Kuehn, T. P. Dick, H. Schild, H.-G. Rammensee, U. H. Koszinowski, P.-M. Kloetzel. 1996. A role for the proteasome regulator PA28a in antigen presentation. Nature 381: 166-168.[Medline]
  34. van Hall, T., A. Sijts, M. Camps, R. Offringa, C. Melief, P. M. Kloetzel, F. Ossendorp. 2000. Differential influence on cytotoxic T lymphocyte epitope presentation by controlled expression of either proteasome immunosubunits or PA28. J. Exp. Med. 192: 483-494.[Abstract/Free Full Text]
  35. Murata, S., H. Udono, N. Tanahashi, N. Hamada, K. Watanabe, K. Adachi, T. Yamano, K. Yui, N. Kobayashi, M. Kasahara, K. Tanaka, T. Chiba. 2001. Immunoproteasome assembly and antigen presentation in mice lacking both PA28{alpha} and PA28{beta}. EMBO J. 20: 5898-5907.[Medline]
  36. Sun, Y., A. J. Sijts, M. Song, K. Janek, A. K. Nussbaum, S. Kral, M. Schirle, S. Stevanovic, A. Paschen, H. Schild, P. M. Kloetzel, D. Schadendorf. 2002. Expression of the proteasome activator PA28 rescues the presentation of a cytotoxic T lymphocyte epitope on melanoma cells. Cancer Res. 62: 2875-2882.[Abstract/Free Full Text]
  37. Winzler, C., P. Rovere, M. Rescigno, F. Granucci, G. Penna, L. Adorini, V. S. Zimmermann, J. Davoust, P. Ricciardi-Castagnoli. 1997. Maturation stages of mouse dendritic cells in growth factor-dependent long-term cultures. J. Exp. Med. 185: 317-328.[Abstract/Free Full Text]
  38. Schuurhuis, D. H., A. Ioan-Facsinay, B. Nagelkerken, J. J. van Schip, C. Sedlik, C. J. Melief, J. S. Verbeek, F. Ossendorp. 2002. Antigen-antibody immune complexes empower dendritic cells to efficiently prime specific CD8+ CTL responses in vivo. J. Immunol. 168: 2240-2246.[Abstract/Free Full Text]
  39. Regnault, A., D. Lankar, V. Lacabanne, A. Rodriguez, C. Thery, M. Rescigno, T. Saito, S. Verbeek, C. Bonnerot, P. Ricciardi-Castagnoli, S. Amigorena. 1999. Fc{gamma} receptor-mediated induction of dendritic cell maturation and major histocompatibility complex class I-restricted antigen presentation after immune complex internalization. J. Exp. Med. 189: 371-380.[Abstract/Free Full Text]
  40. Lelouard, H., E. Gatti, F. Cappello, O. Gresser, V. Camosseto, P. Pierre. 2002. Transient aggregation of ubiquitinated proteins during dendritic cell maturation. Nature 417: 177-182.[Medline]
  41. Lelouard, H., V. Ferrand, D. Marguet, J. Bania, V. Camosseto, A. David, E. Gatti, P. Pierre. 2004. Dendritic cell aggresome-like induced structures are dedicated areas for ubiquitination and storage of newly synthesized defective proteins. J. Cell Biol. 164: 667-675.[Abstract/Free Full Text]
  42. Schreurs, M. W., A. A. Eggert, A. J. de Boer, J. L. Vissers, T. van Hall, R. Offringa, C. G. Figdor, G. J. Adema. 2000. Dendritic cells break tolerance and induce protective immunity against a melanocyte differentiation antigen in an autologous melanoma model. Cancer Res. 60: 6995-7001.[Abstract/Free Full Text]
  43. Beekman, N. J., P. A. van Veelen, T. van Hall, A. Neisig, A. Sijts, M. Camps, P. M. Kloetzel, J. J. Neefjes, C. J. Melief, F. Ossendorp. 2000. Abrogation of CTL epitope processing by single amino acid substitution flanking the C-terminal proteasome cleavage site. J. Immunol. 164: 1898-1905.[Abstract/Free Full Text]
  44. Heid, C. A., J. Stevens, K. J. Livak, P. M. Williams. 1996. Real-time quantitative PCR. Genome Res. 6: 986-994.[Abstract/Free Full Text]
  45. Gobin, S. J., V. Keijsers, M. van Zutphen, P. J. van den Elsen. 1998. The role of enhancer A in the locus-specific transactivation of classical and nonclassical HLA class I genes by nuclear factor {kappa}B. J. Immunol. 161: 2276-2283.[Abstract/Free Full Text]
  46. Kohda, K., T. Ishibashi, N. Shimbara, K. Tanaka, Y. Matsuda, M. Kasahara. 1998. Characterization of the mouse PA28 activator complex gene family: complete organizations of the three member genes and a physical map of the approximately 150-kb region containing the {alpha}- and {beta}-subunit genes. J. Immunol. 160: 4923-4935.[Abstract/Free Full Text]
  47. Rescigno, M., M. Martino, C. L. Sutherland, M. R. Gold, P. Ricciardi-Castagnoli. 1998. Dendritic cell survival and maturation are regulated by different signaling pathways. J. Exp. Med. 188: 2175-2180.[Abstract/Free Full Text]
  48. Ma, C. P., C. A. Slaughter, G. N. DeMartino. 1992. Identification, purification, and characterization of a protein activator (PA28) of the 20 S proteasome (macropain). J. Biol. Chem. 267: 10515-10523.
  49. Hoshino, K., O. Takeuchi, T. Kawai, H. Sanjo, T. Ogawa, Y. Takeda, K. Takeda, S. Akira. 1999. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J. Immunol. 162: 3749-3752.[Abstract/Free Full Text]
  50. Hemmi, H., O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, S. Akira. 2000. A Toll-like receptor recognizes bacterial DNA. [Published erratum appears in 2001 Nature 409: 646.]. Nature 408: 740-745.[Medline]
  51. Yamano, T., S. Murata, N. Shimbara, N. Tanaka, T. Chiba, K. Tanaka, K. Yui, H. Udono. 2002. Two distinct pathways mediated by PA28 and hsp90 in major histocompatibility complex class I antigen processing. J. Exp. Med. 196: 185-196.[Abstract/Free Full Text]
  52. Pierre, P., S. J. Turley, E. Gatti, M. Hull, J. Meltzer, A. Mirza, K. Inaba, R. M. Steinman, I. Mellman. 1997. Developmental regulation of MHC class II transport in mouse dendritic cells. Nature 388: 787-792.[Medline]
  53. Sallusto, F., M. Cella, C. Danieli, A. Lanzavecchia. 1995. Dendritic cells use macropinocytosis and the mannose receptor to concentrate macromolecules in the major histocompatibility complex class II compartment: down-regulation by cytokines and bacterial products. J. Exp. Med. 182: 389-400.[Abstract/Free Full Text]
  54. Kleijmeer, M., G. Ramm, D. Schuurhuis, J. Griffith, M. Rescigno, P. Ricciardi-Castagnoli, A. Y. Rudensky, F. Ossendorp, C. J. Melief, W. Stoorvogel, H. J. Geuze. 2001. Reorganization of multivesicular bodies regulates MHC class II antigen presentation by dendritic cells. J. Cell Biol. 155: 53-63.[Abstract/Free Full Text]
  55. Schepers, K., M. Toebes, G. Sotthewes, F. A. Vyth-Dreese, T. A. Dellemijn, C. J. Melief, F. Ossendorp, T. N. Schumacher. 2002. Differential kinetics of antigen-specific CD4+ and CD8+ responses in the regression of retrovirus-induced sarcomas. J. Immunol. 169: 3191-3199.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager