|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


* Department of Medicine, University of Michigan, Ann Arbor, MI 48109;
Second Xiangya Hospital, Central South University, Changsha China; and
Ann Arbor Veterans Affairs Healthcare System, Ann Arbor, MI 48105.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
We recently reported (7) that CD70, a T cell costimulatory molecule encoded by the TNFSF7 gene, is overexpressed on CD4+, but not CD8+ T cells treated with a panel of DNA methylation inhibitors including 5-azaC, Pca, PD98059, U0126, and Hyd. 5-azaC and Pca are irreversible and competitive DNA methyltransferase (Dnmt) inhibitors, respectively (10, 11), and PD98059, U0126, and Hyd decrease Dnmt expression by inhibiting ERK pathway signaling (12, 13, 14). CD70 is similarly overexpressed on CD4+ T cells from lupus patients (7), where DNA hypomethylation is due to impaired ERK pathway signaling (14). Whether the same TNFSF7 sequences demethylate in CD4+ T cells treated with Dnmt and signaling inhibitors and in CD4+ T cells from lupus patients is unknown.
In this report we tested the hypothesis that the same sequences in the TNFSF7 promoter demethylate in response to Dnmt inhibitors, ERK pathway inhibitors, and in T cells from lupus patients, and that methylation of the affected sequences suppresses TNFSF7 gene expression. We found that a region flanking the TNFSF7 promoter is demethylated by Dnmt and ERK pathway inhibitors and in T cells from lupus patients, and contributes to the CD70 overexpression observed in T cells treated with these drugs and in lupus. These results provide further support to the hypothesis that DNA hypomethylation is fundamental to the pathogenesis of drug-induced and idiopathic lupus.
| Materials and Methods |
|---|
|
|
|---|
Patients with systemic lupus erythematosus (SLE) and rheumatoid arthritis (RA) were recruited from the outpatient rheumatology clinics and inpatient services at the University of Michigan. Healthy control subjects were recruited by advertising. Patients with SLE and RA met the American College of Rheumatology criteria for these diseases (15, 16), and SLE disease activity was assessed by the SLE disease activity index (SLEDAI) (17). This protocol was approved by the University of Michigan Internal Review Board. Active disease was defined as a SLEDAI score >5. The demographics of the patients are shown in Table I.
|
PBMCs were isolated by density gradient centrifugation as described by our group (4). T cells were isolated by negative selection using magnetic beads and instructions provided by the manufacturer (Pan T cell isolation kit; Miltenyi Biotec), and the CD4+ or CD8+ subset was similarly isolated by magnetic cell sorting. Jurkat cells (E61) were cultured as previously described (3).
Treating T cells with DNA methylation inhibitors
Purified human CD4+ T cells were first stimulated with plate-bound anti-CD3 and soluble anti-CD28. Briefly, 24-well plates were coated with 300 µl of anti-CD3 (10 µg/ml in PBS; Southern Biotechnology Associates) for 18 h at 4°C, washed, then 2 x 106 purified T cells were added to the wells in 2 ml of RPMI 1640/10% FCS containing 2 µg/ml anti-CD28 (Southern Biotechnology Associates). The plates were incubated at 37°C in a humidified atmosphere containing 5% CO2 for 1824 h, then treated with 5 µM 5-azaC (Aldrich), 50 µM Pca (Sigma), 20 µM Hyd (Aldrich), 40 µM UO126 (Promega), or 25 µM PD98059 (Promega), and cultured for 3 additional days as previously described (7).
Real-time RT-PCR
Total cellular RNA was isolated using TRIzol (Invitrogen Life Technologies), then treated with DNaseI (Ambion) using published protocols (18). Real-time semiquantitative RT-PCR was performed using a Rotor-Gene 3000 (Corbett Research) and previously published protocols (7). CD70 mRNA levels were quantitated relative to
-actin transcripts. The following primers were used: CD70 forward: 5'-TGCTTTGGTCCCATTGGTCG-3'; reverse: 5'-TCCTGCTGAGGTCCTGTGTGATTC-3';
-actin forward: 5'-GGACTTCGAGCAAGAGATGG-3'; reverse: 5'-AGCACTGTGTTGGCGTACAG'.
Promoter characterization
A 1018-bp fragment containing the TNFSF7 promoter and predicted transcription start site, identified using Tfsitescan software, was amplified from primary human CD4+ T cells by PCR using the following primers, numbered relative to the predicted transcription start site: forward (966): GCTCTCGAGGTGAAAACCCATCTCTAC; reverse (+52): TCCAAGCTTTCTACTTGCTTCAACCTG.
The forward primer contains an XhoI site at the 5' end, and the reverse a HindIII site at the 3' end. The amplified fragment was cloned into pGL3-Basic, and sequenced by the University of Michigan DNA Sequencing Core to exclude Taq error.
TNFSF7 promoter constructs with 5' deletions were generated by PCR amplification of genomic DNA using the following forward primers: F1(966): GCTCTCGAGGTGAAAACCCATCTCTAC; F2(572): CAGCTCGAGCAACATGGTGAAACC; F3(321): ATTCTCGAGTGTCTGCTGTATCC, all with an XhoI site added.
In all cases the reverse primer was: TCCAAGCTTTCTACTTGCTTCAACCTG with a HindIII site added. These primer combinations generated fragments of 1018 bp (966 to + 52), 624 bp (572 to + 52), and 412 bp (360 to + 52), respectively. The promoter fragments were digested with XhoI and HindIII and inserted upstream of a luc reporter gene in the pGL3 vector (Promega). The constructs were then transfected into Jurkat cells by electroporation using previously described protocols and a previously described
-galactosidase expression construct (19) as control.
Bisulfite sequencing
Genomic DNA was isolated from T cells, treated with sodium bisulfite (19), and the 1-kb TNFSF7 promoter fragment amplified in three fragments by nested PCR. The fragments were cloned into PBS+ (Stratagene), and five independent clones were sequenced for each of the amplified fragments. The following primers were used: fragment 1: round I: forward primer (291
256): 5'-TAGGAATTCGTATAATTTAATTTTTAATAAATGTGT-3'; reverse primer (+400
+436): 5' AACTCTAGATTATCCAACTCTAATCCATACAAAAAAA-3'; round II: forward primer (211
175); 5'-GTGGAATTCGGAATAGGAAGATTGAATGTTTTTTGTT-3'; reverse primer (5
+29): 5'-CTATCTAGAAACCAACCTACCCCTCTCTAAAAATA-3'. Fragment 2: round I: forward primer (609
580): 5'-GGTGAATTCTTTAAGGTTAGGAGTTTAAGTTTAGTT-3'; reverse primer (278
242): 5'-CAATCTAGAACTACACATTTATTAAAAATTAAATTA-3'; round II: forward primer (581
545): 5'-GTTGAATTCGGTTAATATGGTGAAATTTTATTTTTAT-3'; reverse primer (330
288): 5'-CACTCTAGATACAACAAACATCCAAAAATTAAAAATA-3'. Fragment 3: round I: forward primer (966
931): 5'-GTTGAATTCGTGAAAATTTATTTTTATTAAAAATAT-3'; reverse primer (543
580): 5'-AATTCTAGAAAAATTTCACCATATTAACCAAACTAA-3'; round II: forward primer (956
920): 5'-TGAGAATTCATTTTTATTAAAAATATAAAAAGTTAGT3'; reverse primer (567
603): 5'-TTATCTAGACTAAACTTAAACTCCTAACCTTAAATA-3'.
Patch methylation and transfections
The 1018-bp (966 to +52) TNFSF7 gene promoter fragment, cloned into the luciferase-containing vector pGL3-Basic, was digested with the following restriction endonucleases: region 1 (966 to 490): XhoI and NruI, region 2 (490 to 229): NruI and ApaI, region 3 (229 to + 52): ApaI and HindIII.
The three fragments were gel purified, methylated with SssI and S-adenosylmethionine as described (19), and then religated back into the reporter construct. Completeness of methylation was tested by digestion with NarI for regions 1 and 2, and EagI for region 3. Controls included a mock-methylated construct, prepared by omitting the SssI. The methylated or mock-methylated constructs were transfected into Jurkat cells by electroporation using previously described protocols (19) and expression measured relative to
-galactosidase controls (19).
Statistical analysis
Differences between groups were tested using Students t test or ANOVA with post hoc testing using the Bonferroni correction.
| Results |
|---|
|
|
|---|
Our previous studies demonstrated that 5-azaC, Pca, Hyd, U0126, and PD98059 increased CD70 expression on CD4+ T cells. Initial studies determined whether CD70 mRNA levels increased as well. Maintenance DNA methylation is a postsynthetic event (1), and Dnmt inhibitors must be present during S phase to inhibit methylation of the daughter cells. Purified CD4+ T cells were stimulated for 18 h, cultured with 5 µM 5-azaC, 50 µM Pca, 20 µM Hyd, 40 µM UO126, or 25 µM PD98059 for 3 days as before, then CD70 transcripts were quantitated by real-time RT-PCR. Fig. 1 confirms that all five drugs increase CD70 transcripts.
|
We then determined whether the five DNA methylation inhibitors affect the same regulatory sequences. The TNFSF7 promoter has not been characterized, but the TNFSF7 genomic sequence is available from the human genome database (NT 011255). Fig. 2A shows the sequence analyzed, with the location of the predicted start site, CAAT boxes, and potential transcription factor binding sites. Fig. 2B is a graphic representation of the same sequence, identifying the locations of the potentially methylatable CG pairs, start site, CAAT boxes, and putative transcription factor binding motifs.
|
-galactosidase construct as controls. Fig. 3A demonstrates that the TNFSF7 fragment has promoter activity (p = 0.02 by t test). Two 5' truncated fragments were similarly generated by PCR, and the entire fragment (966 to +52) or the truncated mutants (572 to +52 and 360 to +52) were transfected into Jurkat cells (Fig. 3B). The first 321 bp 5' fragment to the predicted start site has promoter activity essentially identical to the longer fragments, suggesting that the majority of the promoter activity is located within this region.
|
Fig. 4 shows the methylation pattern of the 1-kb fragment in CD4+ and CD8+ T cells. CD4+ and CD8+ T cells were isolated from the peripheral blood of healthy subjects, DNA isolated, treated with bisulfite, then the region shown in Fig. 2 was amplified in three sequential fragments as described in Materials and Methods. The amplified fragments were cloned and five clones sequenced from each amplified fragment from each subject. Fig. 4A shows the average methylation of each of the 32 CG pairs in CD4+ T cells from four donors (bp 211 to + 29) or eight donors (bp 956 to 288), thus representing a total of 20 to 40 determinations per CG pair. Fig. 4B shows a similar analysis of the same region in CD8+ T cells from four healthy donors, representing 20 determinations for each CG pair. In both subsets, the region from the transcription start site to 300, corresponding to the region with promoter activity (Fig. 3B), is nearly completely demethylated, consistent with an active gene. The region from
400 to 700 is partially methylated, whereas the more distal region (750 to 1000) is nearly completely methylated. Although there appears to be a small decrease in methylation in the region from 515 to 300 in CD4+ T cells, the average methylation in this region was not significantly different from CD8+ T cells (p = 0.175), and overall, the pattern of methylation in CD4+ and CD8+ T cells is essentially the same.
|
The effects of the DNA methylation inhibitors on the methylation status of this region were then compared. Fig. 5A shows the average methylation of each CG pair in the methylated region (956 to 288) in CD4+ T cells from seven healthy controls stimulated with anti-CD3 and anti-CD28. Again, we sequenced five cloned fragments from each control, for a total of 35 determinations per CG pair. Compared with Fig. 4, stimulation has no significant effect on the methylation status of this region, consistent with the effects of stimulation on other T cell genes like ITGAL and PRF1 (5, 20). Fig. 5B shows the effect of 5-azaC on the methylation pattern of the same region in stimulated CD4+ cells from five healthy donors. The 10 CG pairs in the region between 515 and 423 are hypomethylated compared with controls (Fig. 5A). The same region appears to demethylate in T cells treated with Pca (Fig. 5C), U0126 (Fig. 5D), PD98059 (Fig. 5E), and Hyd (Fig. 5F). Fig. 6 compares the average methylation of the 10 CG pairs in this region relative to stimulated, untreated controls. All five methylation inhibitors, whether signaling inhibitors or Dnmt inhibitors, significantly decrease the overall methylation of this region.
|
|
The transcriptional relevance of the methylation changes was determined using regional or "patch" methylation. The 1018-bp promoter fragment was cloned into pGL3-Basic, then the regions from 996 to 490, 490 to 229, or 229 to +52 were individually excised, methylated in vitro with SssI and S-adenosylmethionine, ligated back into the expression construct, and transfected into Jurkat cells. Controls included
-galactosidase transfection controls as well as mock-methylated constructs, similarly generated but omitting the SssI. The results are illustrated in Fig. 7. Methylation of each fragment suppressed promoter function relative to mock-methylated controls (p = 0.019, by paired t test for 996 to 490, p = 0.009 for 490 to 229, and p = 0.025 for 229 to +52). However, methylation of the region from 490 to 229, which was affected by the methylation inhibitors, inhibits promoter function to a greater extent than does methylation of the distal sequences (996 to 490; p = 0.013 by ANOVA with post hoc testing and Bonferroni correction). Methylation of the core promoter also suppresses promoter function to a greater extent than the distal sequence, but this was of marginal significance (p = 0.070). These studies indicate that methylation of the CG pairs between 490 and 229 is transcriptionally relevant, and suppresses promoter function to a greater degree than methylation of the more distal sequences.
|
The previous study demonstrated that CD70 is overexpressed on the surface of CD4+ T cells from patients with active lupus (7). Initial studies therefore confirmed that the increase was associated with an increase in CD70 mRNA levels. Fig. 8 compares the level of CD70 transcripts in CD4+ T cells from 10 patients with lupus (5 inactive, 5 active), 3 patients with RA, and 9 healthy controls (Table I). CD70 is also significantly (p = 0.03 lupus vs controls) increased at the mRNA level in T cells from lupus patients. The difference in CD70 mRNA levels between patients with active and inactive lupus was not significant (1.52 ± 0.74 vs 0.49 ± 0.09, mean ± SEM, active vs inactive). We previously excluded an effect of medications on CD70 expression (7), and again no correlation between medications and CD70 expression was observed (Table I).
|
|
| Discussion |
|---|
|
|
|---|
(22). The signaling pathways and transcription factors involved are unknown. Our previous studies demonstrated that a panel of DNA methylation inhibitors, including direct Dnmt inhibitors as well as ERK pathway inhibitors, all increased CD70 expression on the surface of CD4+ T cells (7). The same study reported that CD4+ T cells from patients with active lupus, characterized by impaired ERK pathway signaling, decreased Dnmt expression and DNA hypomethylation (4), similarly overexpress CD70 (7). The present studies confirmed that the methylation inhibitor panel also increases CD70 mRNA. This suggests that the drugs may affect transcriptional regulatory mechanisms. Similarly, CD70 transcripts were also increased in T cells from lupus patients.
An
300-bp fragment of the TNFSF7 gene possessing promoter activity was identified using deletion analysis and transient transfection of reporter constructs. The promoter region contains binding sites for several transcription factors including AP-1, Sp1, NF-
B, and AP-2. Further studies will be required to determine whether these transcription factors contribute to CD70 expression in T lymphocytes. Bisulfite sequencing of primary CD4+ and CD8+ T cells revealed complete demethylation of the promoter sequence, with progressively greater methylation in the more distal 5' regions. Hypomethylation of regulatory regions is characteristic of a transcriptionally permissive chromatin configuration, and active promoters are typically hypomethylated (1). The colocalization of promoter activity and regional DNA hypomethylation indicate that the region is likely to be the TNFSF7 promoter.
Treating CD4+, but not CD8+, T cells with two direct Dnmt inhibitors (5-azaC and Pca) (10, 11) or three ERK pathway inhibitors (PD98059, U0126, and Hyd) known to decrease Dnmt expression (12), all increased steady-state levels of CD70 mRNA. Because the only property common to all five agents is DNA methylation inhibition, it is reasonable to propose that the effect is mediated at least in part by demethylation of sequences affecting gene expression. This was confirmed by demonstrating that all five agents demethylate a sequence located within
200 bp upstream of the promoter. Patch methylation of reporter constructs indicated that methylation of the affected region can suppress promoter function, as reflected by transient transfection assays. Thus, it is likely that the decreased methylation contributes to the increased CD70 expression in the treated cells. Whereas the sequences affected are upstream of the promoter, DNA methylation can suppress gene expression from a distance (23). This appears to be due to the effects of methylcytosine-binding proteins such as MeCP2 and MBD1. These proteins recruit chromatin inactivation complexes containing histone deacetylases to methylated sequences, promoting condensation of the chromatin into a transcriptionally repressive configuration (23). Interestingly, one CG pair located at 439 was reproducibly resistant to demethylation. The reason for this localized effect is unknown. Further, the more distal CG pairs (956 to 567) were also less affected by the methylation inhibitors. This indicates that DNA methylation is more stringently regulated in some regions than in others. The mechanism for this is incompletely understood, but may be affected by histone modifications (24).
Although all five DNA methylation inhibitors successfully demethylated the same region in the TNFSF7 gene, it is unlikely that all five demethylate the same sequences throughout the genome. Earlier studies demonstrated that 5-azaC caused a greater decrease in total T cell genomic deoxymethylcytosine content than did Pca or Hyd (3). This suggests differential susceptibility of some sequences to demethylation by different agents and also supports the concept that DNA methylation is more stringently regulated in some regions than in others.
CD4+ T cells from lupus patients were also found to have increased steady-state levels of CD70 mRNA and hypomethylation of the same sequences demethylated by the methylation inhibitors. Because T cells from patients with active lupus have impaired ERK pathway signaling and decreased Dnmt levels (14), it is possible that the same mechanisms contribute to the DNA demethylation in the in vitro model and in patients with lupus. It should be noted that the sequence was demethylated in patients with both active and inactive disease. This is consistent with our observation that CD70 expression was increased on HLA-DR T cells (7), suggesting that T cell activation does not play a major role in the overexpression. However, we previously found a modest correlation with disease activity (r = 0.636) (7) suggesting the possibility of additional factors in the increased expression on lupus T cells. Further, the lack of HLA-DR expression does not necessarily exclude the possibility that the T cells might be in a state of limited or partial activation, as proposed by others (25).
The lack of correlation between disease activity and promoter demethylation is distinct from what we found for the ITGAL and PRF1 genes, where the degree of demethylation was proportional to disease activity (5, 6). However, earlier work by our group and others, examining remethylation kinetics following withdrawal of DNA methylation inhibitors, has shown that some sequences are rapidly remethylated whereas other sequences remain demethylated (3, 26). It is likely that the sequences flanking the TNFSF7 gene are in the latter category.
Overall, the observation that Pca and Hyd demethylate the same sequences demethylated in idiopathic lupus provides further support to the hypothesis that DNA hypomethylation contributes to the pathogenesis of drug-induced and idiopathic lupus. Further, identifying genes overexpressed in T cells treated with DNA methylation inhibitors has allowed us to predict both the genes and sequences affected for ITGAL, PRF1, and now TNFSF7. These studies led to the functional consequences of overexpressing these molecules, with ITGAL overexpression causing autoreactivity (27), PRF1 overexpression contributing to monocyte/macrophage killing by the T cells (6), and TNFSF7 contributing to B cell overstimulation (7). It is likely that this strategy may identify additional genes aberrantly expressed on lupus T cells and provide new insights into disease mechanisms and approaches to identify biomarkers and therapeutic targets for human lupus.
| Acknowledgments |
|---|
| Disclosures |
|---|
|
|
|---|
| Footnotes |
|---|
1 This work was supported by Public Health Service Grant AR42525 and a grant from the Veterans Affairs to B.C.R. ![]()
2 Address correspondence and reprint requests to Dr. Bruce C. Richardson, 5310 Cancer Center and Geriatrics Center Building, Ann Arbor, MI 48109-0940. E-mail address: Brichard{at}umich.edu ![]()
3 Abbreviations used in this paper: Pca, procainamide; Dnmt, DNA methyltransferase; Hyd, hydralazine; 5-azaC, 5-azacytidine; SLE, systemic lupus erythematosus; SLEDAI, SLE disease activity index; SLE, systemic lupus erythematosus; RA, rheumatoid arthritis. ![]()
Received for publication January 11, 2005. Accepted for publication February 25, 2005.
| References |
|---|
|
|
|---|
induced CD70 and interleukin-7R mRNA expression in BEAS-2B cells. Eur. Respir. J. 20: 369-375.This article has been cited by other articles:
![]() |
G. Lal and J. S. Bromberg Epigenetic mechanisms of regulation of Foxp3 expression Blood, October 29, 2009; 114(18): 3727 - 3735. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Li, M. Yu, C. M. Weyand, and J. J. Goronzy Epigenetic regulation of killer immunoglobulin-like receptor expression in T cells Blood, October 15, 2009; 114(16): 3422 - 3430. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Oflazoglu, T. E. Boursalian, W. Zeng, A. C. Edwards, S. Duniho, J. A. McEarchern, C.-L. Law, H.-P. Gerber, and I. S. Grewal Blocking of CD27-CD70 Pathway by Anti-CD70 Antibody Ameliorates Joint Disease in Murine Collagen-Induced Arthritis J. Immunol., September 15, 2009; 183(6): 3770 - 3777. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Basu, Y. Liu, A. Wu, S. Yarlagadda, G. J. Gorelik, M. J. Kaplan, A. Hewagama, R. C. Hinderer, F. M. Strickland, and B. C. Richardson Stimulatory and Inhibitory Killer Ig-Like Receptor Molecules Are Expressed and Functional on Lupus T Cells J. Immunol., September 1, 2009; 183(5): 3481 - 3487. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sunahori, Y.-T. Juang, and G. C. Tsokos Methylation Status of CpG Islands Flanking a cAMP Response Element Motif on the Protein Phosphatase 2Ac{alpha} Promoter Determines CREB Binding and Activity J. Immunol., February 1, 2009; 182(3): 1500 - 1508. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. McEarchern, L. M. Smith, C. F. McDonagh, K. Klussman, K. A. Gordon, C. A. Morris-Tilden, S. Duniho, M. Ryan, T. E. Boursalian, P. J. Carter, et al. Preclinical Characterization of SGN-70, a Humanized Antibody Directed against CD70 Clin. Cancer Res., December 1, 2008; 14(23): 7763 - 7772. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Luo, Q. Zhang, V. Liu, Z. Xia, K. L. Pothoven, and C. Lee Cutting Edge: TGF-{beta}-Induced Expression of Foxp3 in T cells Is Mediated through Inactivation of ERK J. Immunol., March 1, 2008; 180(5): 2757 - 2761. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Lu, A. Wu, L. Tesmer, D. Ray, N. Yousif, and B. Richardson Demethylation of CD40LG on the Inactive X in T Cells from Women with Lupus J. Immunol., November 1, 2007; 179(9): 6352 - 6358. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Gorelik, J. Y. Fang, A. Wu, A. H. Sawalha, and B. Richardson Impaired T Cell Protein Kinase C{delta} Activation Decreases ERK Pathway Signaling in Idiopathic and Hydralazine-Induced Lupus J. Immunol., October 15, 2007; 179(8): 5553 - 5563. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-W. Lee, Z.-Z. Yang, G. Li, C. M. Weyand, and J. J. Goronzy Unchecked CD70 Expression on T Cells Lowers Threshold for T Cell Activation in Rheumatoid Arthritis J. Immunol., August 15, 2007; 179(4): 2609 - 2615. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ballestar, M. Esteller, and B. C. Richardson The epigenetic face of systemic lupus erythematosus. J. Immunol., June 15, 2006; 176(12): 7143 - 7147. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Bonilla-Henao, R. Martinez, F. Sobrino, and E. Pintado Different signaling pathways inhibit DNA methylation activity and up-regulate IFN-{gamma} in human lymphocytes J. Leukoc. Biol., December 1, 2005; 78(6): 1339 - 1346. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |