The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Syrovets, T.
Right arrow Articles by Simmet, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Syrovets, T.
Right arrow Articles by Simmet, T.
The Journal of Immunology, 2005, 174: 498-506.
Copyright © 2005 by The American Association of Immunologists

Acetyl-Boswellic Acids Inhibit Lipopolysaccharide-Mediated TNF-{alpha} Induction in Monocytes by Direct Interaction with I{kappa}B Kinases1

Tatiana Syrovets, Berthold Büchele, Christine Krauss, Yves Laumonnier and Thomas Simmet2

Department of Pharmacology of Natural Products and Clinical Pharmacology, University of Ulm, Ulm, Germany


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of proinflammatory cytokines by monocytes is tightly regulated by transcription factors such as NF-{kappa}B. In this study, we show that, in LPS-stimulated human peripheral monocytes, the pentacyclic triterpenes acetyl-{alpha}-boswellic acid (A{alpha}BA) and acetyl-11-keto-{beta}-boswellic acid (AK{beta}BA) down-regulate the TNF-{alpha} expression. A{alpha}BA and AK{beta}BA inhibited NF-{kappa}B signaling both in LPS-stimulated monocytes as detected by EMSA, as well as in a NF-{kappa}B-dependent luciferase gene reporter assay. By contrast, the luciferase expression driven by the IFN-stimulated response element was unaffected, implying specificity of the inhibitory effect observed. Both A{alpha}BA and AK{beta}BA did not affect binding of recombinant p50/p65 and p50/c-Rel dimers to DNA binding sites as analyzed by surface plasmon resonance. Instead, both pentacyclic triterpenes inhibited the LPS-induced degradation of I{kappa}B{alpha}, as well as phosphorylation of p65 at Ser536 and its nuclear translocation. A{alpha}BA and AK{beta}BA inhibited specifically the phosphorylation of recombinant I{kappa}B{alpha} and p65 by I{kappa}B{alpha} kinases (IKKs) immunoprecipitated from LPS-stimulated monocytes. In line with this, A{alpha}BA and AK{beta}BA also bound to and inhibited the activities of active human recombinant GST-IKK{alpha} and His-IKK{beta}. The LPS-triggered induction of TNF-{alpha} in monocytes is dependent on IKK activity, as confirmed by IKK-specific antisense oligodeoxynucleotides. Thus, via their direct inhibitory effects on IKK, A{alpha}BA and AK{beta}BA convey inhibition of NF-{kappa}B and subsequent down-regulation of TNF-{alpha} expression in activated human monocytes. These findings provide a molecular basis for the anti-inflammatory properties ascribed to A{alpha}BA- and AK{beta}BA-containing drugs and suggest acetyl-boswellic acids as tools for the development of novel therapeutic interventions.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Despite the substantial progress in understanding the molecular mechanisms underlying chronic inflammatory diseases and the intensive search for new drugs, the current treatment options are still not satisfactory. Therefore, the quest continues for both novel targets and compounds that combine therapeutic efficacy with a low profile of side effects.

The nuclear transcription factor NF-{kappa}B is a key player in the development and progression of chronic inflammatory diseases, such as rheumatoid arthritis, inflammatory bowel disease, asthma, and atherosclerosis (1). NF-{kappa}B is therefore considered a promising target for anti-inflammatory intervention (1, 2, 3). The available treatment regimens for chronic inflammatory diseases already include several drugs such as glucocorticosteroids, sulfasalazine, aspirin, and gold compounds that may in very high concentrations and mostly unspecifically mediate part of their effects through inhibition of NF-{kappa}B activity (1, 2, 3).

Molecular biological approaches blocking NF-{kappa}B by adenoviral transfer of I{kappa}B{alpha} or by NF-{kappa}B decoy inhibited joint inflammation in vitro and in animal models of arthritis (1, 3). Similarly, molecular biological interventions also reduced inflammation in models of chronic intestinal inflammation and myocardial infarction (1, 3). Inhibition of NF-{kappa}B leads to a reduction of the inflammatory response, because NF-{kappa}B takes the center stage in the regulation of a wide range of genes involved in chronic inflammatory diseases including cytokines such as TNF and IL-1, but also inducible NO synthase and the adhesion molecule ICAM-1 (1, 4). Therapeutic approaches targeting these effector proteins have also been developed. For example, inhibition of TNF-{alpha} and its signaling with Abs or soluble receptors has been recognized as a highly successful strategy for the treatment of chronic inflammatory diseases, such as rheumatoid arthritis (5, 6).

Only recently, resveratrol, a polyphenolic phytoalexin present in the skin of red grapes and in several other plants, was found to inhibit NF-{kappa}B activation (7). In addition, some other plant-derived compounds have also been reported to interfere with the NF-{kappa}B signaling pathway (8, 9). Indeed, plants harbor a plethora of secondary metabolites that might serve as lead compounds for the development of novel therapeutic approaches. In traditional Ayurvedic medicine, extracts from the gum resin from Boswellia serrata, commonly termed Indian frankincense, have been used as anti-inflammatory remedies. Such extracts, which are marketed in the United States, have already been used in small clinical pilot studies for the treatment of rheumatoid arthritis and inflammatory bowel diseases (10, 11, 12, 13). After purification to chemical homogeneity, we have previously characterized the structural configuration of acetyl-boswellic acids (ABAs)3 belonging to the family of pentacyclic triterpenes (14, 15); these compounds are believed to represent the active principle of the aforementioned phytopharmaceuticals (10, 16).

Monocytes and macrophages represent essential effector cells in both chronic inflammation and in the host defense against bacterial infection. Using LPS as a potent activator of human monocytes, we found that acetyl-{alpha}-boswellic acid (A{alpha}BA) and acetyl-11-keto-{beta}-boswellic acid (AK{beta}BA) inhibit NF-{kappa}B signaling. We succeeded in identifying specific inhibitory effects of ABAs on I{kappa}B{alpha} kinase (IKK), which is pivotal for the degradation of the NF-{kappa}B inhibitor I{kappa}B, as well as the phosphorylation of p65, two steps essential for NF-{kappa}B activation and the subsequent cytokine expression. Using purified human recombinant GST-IKK{alpha} and His-IKK{beta}, we positively confirmed the direct effect of the A{alpha}BA and AK{beta}A on the IKK complex. The direct inhibition of IKK places A{alpha}BA and AK{beta}BA apart from other plant-derived compounds, such as flavopiridol, and ursolic and betulinic acid, which seem to exert their effects upstream of the IKK (8, 9, 17). Against this background, A{alpha}BA and AK{beta}BA could be used either as tools or as lead compounds for the development of novel therapeutic approaches in inflammation research.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials

A{alpha}BA and AK{beta}BA were isolated from African frankincense, purified by reverse-phase HPLC to chemical homogeneity (i.e., >99% purity), and characterized by mass spectrometry and one- and two-dimensional nuclear magnetic resonance spectroscopy (14, 15, 18). The compounds were dissolved in DMSO, and controls contained equivalent amounts of solvent. Abs against p65, I{kappa}B{alpha}, IKK (SC-7607), and the subunit IKK{alpha} were from Santa Cruz Biotechnology, and those against ERK2 (used for immunoprecipitation) were from BD Pharmingen. Abs against the phosphorylated form of p65, and ERK1/2, as well as Elk-1 fusion protein, were from Cell Signaling Technology. Human recombinant GST-IKK{alpha} and His-IKK{beta} were from Upstate. Ab against {alpha}-tubulin were from Sigma-Aldrich. Monoclonal anti-CD14 and anti-CD41 Abs were purchased from Immunotech. Rhodamine Red-X-conjugated donkey anti-rabbit IgG F(ab)2 was purchased from Dianova. Human recombinant p50 and c-Rel were from Promega, p65 was from Active Motif, tagged I{kappa}B{alpha} fusion protein was from Santa Cruz Biotechnology, and LPS (Escherichia coli serotype 055:B5) was obtained from Sigma-Aldrich. Percoll and poly(dI:dC) were from Amersham Biosciences, TRIzol was from Invitrogen Life Technologies, and neutravidin was from Pierce. Recombinant human TNF-{alpha} was obtained from R&D Systems. RPMI 1640, DMEM, and FCS were from Invitrogen Life Technologies. Other chemicals were of analytical grade; all reagents were LPS-free as measured by the Limulus amebocyte lysate assay (Sigma-Aldrich).

Monocyte preparation and viability test

Monocytes were isolated by autologous plasma-Percoll gradient centrifugation as described (19, 20, 21). Preparations with ≥94% CD14+ cells were used. Contaminating cells were lymphocytes. Flow cytometric analysis (FACScan; BD Biosciences) with anti-CD41 mAb did not reveal any platelets associated with monocytes.

Monocyte and human embryonic kidney epithelial cell line 293 (HEK293; American Type Culture Collection) cell viability was measured, according to the manufacturer’s instructions, either by a modified formazan assay (XTT assay) (22) after 8 h of treatment with A{alpha}BA or AK{beta}BA using the Cell Proliferation kit II, or the Cytotoxicity Detection kit (lactate dehydrogenase; Roche Diagnostics). Briefly, 0.25 x 106 monocytes were seeded in 300 µl of phenol red-free RPMI 1640 supplemented with 1% FCS (FCS) in 96-well plate, and treated for 8 h either with DMSO or ABAs (each at 10 µM). For the analysis of the HEK293 viability, the cells were seeded at a density of 5000 cells/300 µl phenol red-free DMEM with 0.5% FCS, treated with A{alpha}BA, AK{beta}BA (each at 10 µM), or DMSO, and analyzed 8 h later.

Expression of TNF-{alpha}

Monocytes (0.5 x 106) were resuspended in 200 µl of RPMI 1640 with 1% FCS, and after preincubation with A{alpha}BA, AK{beta}BA, or the solvent DMSO for 60 min, they were stimulated with LPS (100 ng/ml) for 6 h; in previous experiments, this LPS concentration was found to trigger a near-maximum release of TNF-{alpha} into the medium (21, 23). Total RNA isolated with TRIzol (Invitrogen Life Technologies) was analyzed with specific primers for TNF-{alpha} and GAPDH as an internal standard (19). PCR did not reach the saturation phase. Control experiments showed no DNA contaminations. The amplification products were identified by direct sequencing (Prism 310; Applied Biosystems).

The supernatants of cells treated with A{alpha}BA, AK{beta}BA, or solvent, as described above, were used for TNF-{alpha} measurements with an ELISA (R&D Systems).

Luciferase gene reporter assay

The HEK293 was transiently transfected with the vector pNF{kappa}B-Luc containing four tandem copies of the {kappa}B enhancer element upstream of the firefly luciferase reporter gene (Clontech). One day before transfection, 0.2 x 106 cells/500-µl DMEM with 10% FCS were seeded into 24-well plates. The vector pNF{kappa}B-Luc (0.5 µg) was transfected with Superfect reagent (Qiagen), according to the manufacturer’s instructions. Media were changed 3 h after transfection. Twenty-four hours after transfection, media were replaced by DMEM with 0.5% FCS for 6 h to reduce background NF-{kappa}B activation due to FCS. Subsequently, cells were treated with A{alpha}BA, AK{beta}BA, or the solvent DMSO for 1 h, followed by stimulation with TNF-{alpha} (100 ng/ml). After 4 h, the cells were washed, harvested in 200 µl of 0.1 M potassium phosphate buffer (pH 7.8), lysed by three freezing/thawing cycles, and analyzed for protein contents with the BCA kit (Pierce). Aliquots of 20 µl were measured in 96-well microtiter plates in a PlateLumino luminometer (Stratec) with 10-s integration time of the luciferase reaction. The luciferase activities were normalized to the protein contents. Results are expressed as fold change from the nonstimulated promoter activity. Lysates from each transfection were assayed in triplicate from at least three independent transfection experiments. Control cells were transfected with pTal-Luc vector (Clontech) and treated with TNF-{alpha} (100 ng/ml) in the same way as samples from pNF-{kappa}B-Luc-transfected cells. The control cells showed no increase in luciferase activity, indicating that the effects observed were due to NF-{kappa}B activation.

Alternatively, the cells were transfected with an IFN-stimulated response element (ISRE) luciferase reporter gene (Stratagene) either alone, or together with the constitutively active form of IFN regulatory factor (IRF)-3 (IRF-3 5D) (24). Twenty-four hours posttransfection, the medium was replaced with DMEM containing 0.5% FCS, and cells were treated with ABAs or solvent for 6 h. Luciferase expression was analyzed as above.

EMSA

Freshly isolated human monocytes (5 x 106) resuspended in 500 µl of RPMI 1640 supplemented with 1% FCS were cultured on hydrophobic PetriPerm membranes (Vivascience); they were preincubated in the presence of A{alpha}BA, AK{beta}BA (3 and 10 µM each), or the solvent DMSO for 60 min, followed by stimulation with LPS (100 ng/ml) for 60 min. Nuclear extracts (5 µg) were subjected to EMSA as previously described (21, 23, 25). For competition experiments, nuclear extracts were incubated for 30 min with a 100-fold excess of unlabeled specific NF-{kappa}B or AP-2 oligonucleotides.

Surface plasmon resonance (SPR) analysis

Binding of p50/c-Rel and p50/p65 heterodimers to NF-{kappa}B binding sites was measured by SPR using a CMD-20 B2 sensor chip. Double-stranded biotinylated DNA containing the NF-{kappa}B binding site (AGTTGAGGGGACTTTCCCAGGC) was immobilized on a SPR sensor chip (XanTec Analysensysteme) (23, 26). Mixtures of human recombinant p50 and c-Rel, or p50 and p65 (200 nM each) in 60 µl of NF-{kappa}B binding buffer (10 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM MgCl2, 0.5 mM EDTA, 0.5 mM DTT, 0.1% BSA, 0.1% Nonidet P40, and 3 µg of poly(dI:dC)) were preincubated for 30 min at 20°C with 100 µM of either A{alpha}BA or AK{beta}BA, or equivalent amounts of DMSO. The mixture was applied to the sensor chip, and binding to DNA carrying the NF-{kappa}B binding site was analyzed with a dual-channel ESPRIT optical sensor device (Autolab). The binding of the recombinant proteins to DNA containing the AP-1 consensus binding sequence (CGCTTGATGAGTCAGCCGGAA) was used as a control. Alternatively, human recombinant GST-IKK{alpha} and His-IKK{beta} were immobilized on the surface of the SPR sensor chip. A{alpha}BA or AK{beta}BA (100 µM each) in kinase buffer (20 mM HEPES (pH 7.5), 10 mM MgCl2, 20 mM {beta}-glycerophosphate, 100 µM Na-orthovanadate, 1 mM DTT, and 0.01% Nonidet P40) was applied onto the sensor chip surface. Pretreatment for 20 min at 20°C with 100 nM of either GST-IKK{alpha} or His-IKK{beta} before the analysis of the binding to immobilized kinase was used to ensure the specificity of the binding.

Confocal microscopy

Monocytes (2 x 106) resuspended in 800 µl of RPMI 1640 with 1% FCS, were permitted to adhere to chamber slides (Nalgene Nunc) for 30 min, and were treated for 60 min with the solvent DMSO or 10 µM of either A{alpha}BA or AK{beta}BA, followed by stimulation with LPS (100 ng/ml) for an additional 60 min. Monocytes were fixed, permeabilized with 1% Triton X-100, and stained with Hoechst 33342 (DNA marker), FITC-labeled anti-{alpha}-tubulin Ab (cytosol marker), and rabbit anti-p65 visualized with anti-rabbit Rhodamine Red-labeled secondary Ab. The cells were analyzed with a Leica DM IRBE confocal laser-scanning microscope (Leica Microsystems).

Western blotting

Monocytes (1–2 x 106 cells/sample) were treated with the indicated concentrations of A{alpha}BA or AK{beta}BA for 60 min, and were subsequently stimulated with LPS (100 ng/ml) for an additional 60 min. Whole-cell lysates, and cytosolic and nuclear fractions were prepared and analyzed as described (21, 25). p65 was analyzed in cytosolic and nuclear fractions. Phosphorylation of p65 was analyzed in monocyte nuclear extracts. Abs against I{kappa}B{alpha}, p65, and the phosphorylated form of p65 (Ser536) were used. For the control of equal protein loading, blots were reprobed with ERK1/2, p65, or topoisomerase I Ab.

Immunoprecipitation and kinase assay

Monocytes (20 x 106) were resuspended in 2 ml of RPMI 1640 and stimulated with LPS (1 µg/ml) for 30 min. Monocytes were lysed with buffer containing 0.1% Nonidet P-40. Lysates were precleared with rabbit IgG and protein agarose beads. The IKK complex or ERK2 were immunoprecipitated from the precleared cell lysates with appropriate rabbit Abs and protein A-agarose beads. After extensive washing of immunoprecipitated IKKs, equal amounts of kinases in terms of protein were pretreated with different concentrations of A{alpha}BA or AK{beta}BA at 20°C for 15 min and used for kinase assays with rI{kappa}B{alpha}-tagged fusion protein corresponding to full-length I{kappa}B{alpha} (aa 1–317) of human origin, or recombinant p65 in the presence of 32P-labeled ATP, at 30°C for 20 min. ERK2 kinase assay was performed in analogy using a rElk-1 fusion protein as substrate. Samples were separated by SDS-PAGE and blotted onto nitrocellulose membranes. Phosphorylated I{kappa}B{alpha}, p65, and Elk-1 were visualized and quantified using a PhosphorImager (Molecular Dynamics) (21, 25). Alternatively, 30 nM human recombinant GST-IKK{alpha} or His-IKK{beta} were treated with 0.1–10 µM of either A{alpha}BA or AK{beta}BA, or solvent and analyzed as indicated above.

Antisense experiments

For in vitro knockdown of IKKs, phosphorothioate oligodeoxynucleotides (ODN; ThermoHybaid) were used. The ODN were selected on the basis of the major predicted secondary structures, i.e., loops (27). The antisense ODN used against IKK{alpha} and IKK{beta} were 5'-CAATTATTTTATGTATT-3' and 5'-GTCGACGGTCACTGTGT-3', respectively; control ODN was 5'-AAACAGAATCATCCATC-3'.

Monocytes were treated with 0.1 µM IKK-specific antisense or control phosphorothioate ODNs in DMEM supplemented with 10% FCS for 28 h (28). After treatment, media were replaced by RPMI 1640, and the cells were allowed to recover for 12 h to reduce any putative procedure-induced signaling. Subsequently, the cells were incubated in RPMI 1640 supplemented with 1% human AB serum and were used for additional experiments.

Statistical analysis

Values shown represent mean ± SEM where applicable. Statistical significance was calculated with the Newman-Keuls test. Differences were considered significant for p < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ABAs inhibit the LPS-induced expression of TNF-{alpha} in monocytes

Macrophages and monocytes are considered to be the main source of TNF-{alpha} (29), which as a prototypical proinflammatory cytokine plays a key role not only in chronic inflammatory diseases but also in innate immunity (6, 30). In this study, we have investigated whether A{alpha}BA or AK{beta}BA is able to affect the TNF-{alpha} generation in LPS-stimulated human peripheral monocytes. TNF-{alpha} is synthesized as a precursor, which is processed and released from the membrane (31), implying that regulation can occur at any of those steps. Therefore, we have measured TNF-{alpha} expression at both the mRNA and the protein level. Stimulation of monocytes with 100 ng/ml LPS triggered an increased expression of TNF-{alpha} mRNA, which was concentration-dependently inhibited by A{alpha}BA and AK{beta}BA (Fig. 1A). At a concentration of 10 µM, AK{beta}BA was a more potent inhibitor of TNF-{alpha} mRNA expression than A{alpha}BA.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 1. ABAs inhibit the LPS-induced expression of TNF-{alpha}. A, Expression of TNF-{alpha} mRNA. Human peripheral monocytes (0.5 x 106 in 200 µl of RPMI 1640) were treated for 60 min with the indicated concentrations of A{alpha}BA and AK{beta}BA or the solvent DMSO, followed by stimulation with LPS (100 ng/ml) for 6 h. TNF-{alpha} mRNA expression was analyzed by semiquantitative RT-PCR. The identity of the PCR products was confirmed by direct sequencing. Expression of GAPDH mRNA was used for normalization. Representative results of one of three independent experiments are shown. B, TNF-{alpha} release. Cells (0.5 x 106 in 200 µl of RPMI 1640) were treated for 60 min with different concentrations of A{alpha}BA and AK{beta}BA or the solvent DMSO, and subsequently stimulated with LPS (100 ng/ml) for 6 h. TNF-{alpha} release into the medium was measured by ELISA. A{alpha}BA and AK{beta}BA (10 µM each) did not significantly affect TNF-{alpha} expression in the absence of LPS. Results are the mean ± SEM of five independent experiments. *, p < 0.05; **, p < 0.01, vs LPS controls.

 
We further analyzed the effects of the ABAs on the release of mature TNF-{alpha} into the medium. Stimulation of monocytes with 100 ng/ml LPS induced the expected TNF-{alpha} release that was concentration-dependently inhibited by both ABAs (Fig. 1B). Similar to the inhibition of the mRNA expression, AK{beta}BA at a concentration of 10 µM was more potent than A{alpha}BA. Treatment of monocytes with 10 µM A{alpha}BA or AK{beta}BA alone significantly affected neither the expression of TNF-{alpha} (Fig. 1B) nor the monocyte viability as measured by the XTT assay (data not shown).

ABAs inhibit the TNF-{alpha} and LPS-induced activation of NF-{kappa}B

NF-{kappa}B activation is essential for the expression of various proinflammatory genes, including the TNF-{alpha} gene, which contains several binding sites for NF-{kappa}B in its promoter region (32). Only recently has it been shown that the plant-derived compound resveratrol exerts its effects at least partially through inhibition of the NF-{kappa}B activation (7). Against the background of the observed down-regulation of TNF-{alpha} mRNA, we decided to analyze the effects of ABAs on NF-{kappa}B activation in a luciferase gene reporter assay, where the amount of the luciferase gene product reflects the extent of NF-{kappa}B activation. The low concentrations of A{alpha}BA and AK{beta}BA, i.e., not >10 µM, did not affect the viability of HEK293 cells as judged by the lactate dehydrogenase release assay (data not shown). TNF-{alpha}-mediated stimulation of cells transfected with NF-{kappa}B reporter vector, but not with the control vector, resulted in a 17-fold increase of the luciferase activity. Both A{alpha}BA and AK{beta}BA concentration-dependently inhibited the NF-{kappa}B activation in transfected HEK293 cells (Fig. 2A); pretreatment with A{alpha}BA and AK{beta}BA (10 µM) inhibited the NF-{kappa}B activity by 40.9 ± 9.8 and 76.9 ± 7.6%, respectively.



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 2. ABAs inhibit the TNF-{alpha} and LPS-induced activation of NF-{kappa}B. A, NF-{kappa}B luciferase gene reporter assay. HEK293 cells (0.2 x 106 in 500 µl of DMEM) were transiently transfected with pNF{kappa}B-Luc vector. Media were changed after 3 and 24 h; 6 h later, cells were pretreated with A{alpha}BA, AK{beta}BA, or solvent for 1 h before stimulation with TNF-{alpha} (100 ng/ml). Four hours after TNF-{alpha} stimulation, luciferase activity was quantified. Results are mean ± SEM of triplicates of three independent experiments. *, p < 0.05; **, p < 0.01, vs TNF-{alpha} control. B, ISRE luciferase gene reporter assay. HEK293 cells (0.2 x 106 in 500 µl of DMEM) were transiently transfected with pISRE-Luc vector alone or together with the constitutively active IRF-3 5D. Media were changed after 3 and 24 h; cells were pretreated with A{alpha}BA, AK{beta}BA, or solvent for 6 h. Results are mean ± SEM of triplicates of two independent experiments. C, EMSA. Human monocytes (5 x 106 cells) were preincubated in the presence or absence of A{alpha}BA or AK{beta}BA (3 and 10 µM each) or equivalent amounts of the solvent DMSO for 60 min and subsequently stimulated with LPS (100 ng/ml) for 60 min. After stimulation, the cells were lysed, and the nuclei were isolated. Nuclear extracts (5 µg) were subjected to EMSA with a 32P-labeled DNA probe containing the NF-{kappa}B binding site. In competition and specificity experiments, nuclear extracts were incubated for 30 min with unlabeled NF-{kappa}B- or AP-2-specific oligonucleotides (100-fold excess). Results of one of four independent experiments are shown.

 
To prove the specificity of the observed inhibitory effects of ABAs, we analyzed their effects on the ISRE-mediated luciferase expression. ABAs did not affect the basal luciferase expression by pISRE-luciferase-transfected HEK293 cells. Cotransfection of pISRE-luciferase with the constitutively active form of IRF-3, IRF-3 5D, resulted in a >100-fold increase in luciferase expression, which was not affected by pretreatment with 10 µM of either A{alpha}BA or AK{beta}BA (Fig. 2B). This indicated that ABAs specifically inhibit NF-{kappa}B.

To confirm the inhibitory effects of A{alpha}BA and AK{beta}BA on NF-{kappa}B in activated human monocytes, we stimulated monocytes with 100 ng/ml LPS and analyzed the NF-{kappa}B activity by EMSA. LPS stimulation led to the expected NF-{kappa}B activation, which was concentration-dependently inhibited by A{alpha}BA and AK{beta}BA (3 and 10 µM), and almost abolished by preincubation with 10 µM AK{beta}BA (Fig. 2C). Inhibition of the NF-{kappa}B activation by EMSA may reflect either a lack of NF-{kappa}B proteins in the nuclei, i.e., inhibition of translocation, or inhibition of DNA binding, or inhibition of transactivation, or a combination thereof.

ABAs do not affect binding of NF-{kappa}B to DNA

We have previously shown that, in an enzymatic assay system, high concentrations of ABAs are able to reduce binding of human topoisomerases to substrate DNA (26). This prompted us to investigate whether A{alpha}BA and AK{beta}BA affect NF-{kappa}B activity through a similar mechanism. Binding of human recombinant p50/c-Rel and p50/p65 heterodimers was analyzed in vitro by SPR. dsDNA containing NF-{kappa}B binding sites was immobilized on a SPR sensor chip. The addition of rNF-{kappa}B proteins to the liquid phase resulted in an increase in the SPR signal reflecting binding of the proteins to the immobilized DNA. There was no binding of rNF-{kappa}B proteins to dsDNA containing the AP-1 binding sequence, which was linked to the sensor chip of the reference channel. Preincubation of p50/c-Rel (Fig. 3A) or p50/p65 (B) with up to 100 µM A{alpha}BA or AK{beta}BA did not affect their binding to DNA carrying NF-{kappa}B binding sites. Thus, ABAs do not interfere with the binding of NF-{kappa}B to DNA. These data indicated that ABAs inhibit NF-{kappa}B activation upstream of DNA binding.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 3. ABAs do not affect binding of NF-{kappa}B to DNA. Binding of rNF-{kappa}B proteins was measured by SPR. A, p50/c-Rel heterodimers. B, p50/p65 heterodimers. Double-stranded biotinylated DNA containing the NF-{kappa}B binding sites was immobilized on the surface of the SPR sensor chip. Equimolar mixtures of the respective human rNF-{kappa}B proteins (200 nM each) were allowed to form dimers in NF-{kappa}B binding buffer at 20°C for 30 min before they were applied onto the sensor chip surface. An enhanced SPR response indicates binding of NF-{kappa}B dimers to the NF-{kappa}B response element (solid lines). Pretreatment for 30 min at 20°C with 100 µM A{alpha}BA (broken line) and 100 µM AK{beta}BA (dotted broken line) did not affect binding of the respective heterodimers. A{alpha}BA and AK{beta}BA (each 100 µM) did not bind to the NF-{kappa}B response element (A, lower lines). Representative tracings of one of three independent experiments are shown.

 
ABAs prevent LPS-induced translocation of p65 to the nucleus

After phosphorylation and degradation of the inhibitors, NF-{kappa}B proteins translocate to the nucleus and activate NF-{kappa}B-dependent genes. Through laser-scanning microscopy of monocytes stained with fluorescence-labeled Ab against p65, we analyzed the nuclear accumulation of p65 in the presence of A{alpha}BA and AK{beta}BA. To distinguish between nucleus and cytosol, monocytes were stained with DNA-specific Hoechst 33342 and with anti-{alpha}-tubulin Ab. In nonstimulated monocytes, p65 was diffusely distributed throughout the cytosol and the nucleus (Fig. 4A). p50 and p65 contain a nuclear-export sequence, which is effectively masked by I{kappa}B{alpha} only at p65 (4). Therefore, it has been proposed that p65/p50 might be shuttling into the nucleus in nonstimulated cells, but, being bound to the inhibitor, is not able to activate genes. After stimulation with 100 ng/ml LPS, p65 nearly disappeared from the cytosol and strongly accumulated in the nucleus (Fig. 4A), a distribution inhibited by both 10 µM A{alpha}BA and 10 µM AK{beta}BA. After treatment of monocytes with the ABAs in the absence of LPS, the pattern of the p65 subcellular distribution was similar to that in the nonstimulated cells (data not shown). Similar results were obtained when the subcellular distribution of p65 was studied by Western blotting analysis of the cytosolic and nuclear fractions (Fig. 4B); again, 10 µM AK{beta}BA basically abolished and 10 µM A{alpha}BA severely hampered the nuclear localization of p65 in LPS-stimulated monocytes.



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 4. ABAs prevent LPS-induced translocation of p65 to the nucleus. A, Monocytes (2 x 106) resuspended in 800 µl of RPMI 1640 were allowed to adhere onto chamber slides for 0.5 h. Monocytes were then treated for 60 min with the solvent DMSO or 10 µM of either A{alpha}BA or AK{beta}BA, followed by stimulation with LPS (100 ng/ml) for an additional 60 min. Monocytes were fixed, permeabilized, and stained with Hoechst 33342 (DNA marker, blue), FITC-labeled anti-{alpha}-tubulin Ab (cytosol marker, green), and rabbit anti-p65 visualized with anti-rabbit Rhodamine Red-labeled secondary Ab (red). Cells were analyzed by confocal fluorescence microscopy. Results of one of three independent experiments are shown. B, Monocytes (5 x 106) were treated with A{alpha}BA or AK{beta}BA (for 60 min) and then stimulated with LPS (100 ng/ml) for an additional 60 min. Nuclear and cytosolic fractions were subjected to Western blot analysis for p65. For the control of equal protein loading, the blots were reprobed with actin or topoisomerase I (topo I) Ab. Results of one of three independent experiments are shown.

 
ABAs inhibit the LPS-induced degradation of I{kappa}B{alpha} and phosphorylation of p65

To investigate the mechanism of the NF-{kappa}B inhibition by ABAs, we analyzed the degradation of the NF-{kappa}B inhibitor, I{kappa}B{alpha}, in the presence of A{alpha}BA and AK{beta}BA. I{kappa}B{alpha} is present in nontreated cells and is degraded upon stimulation with 100 ng/ml LPS (Fig. 5A). However, preincubation of monocytes with the A{alpha}BA and AK{beta}BA concentration-dependently inhibited the LPS-induced degradation of I{kappa}B{alpha}. AK{beta}BA appeared to be more potent than A{alpha}BA.



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 5. ABAs inhibit the LPS-induced degradation of I{kappa}B{alpha} and phosphorylation of p65. A, I{kappa}B{alpha} degradation. Monocyte lysates were subjected to Western blot analysis for I{kappa}B{alpha}. B, Phosphorylation of p65 on serine 536. Nuclear extracts were subjected to Western blot analysis for phosphorylated p65. Monocytes (2 x 106) were treated with A{alpha}BA or AK{beta}BA (for 60 min) and then stimulated with LPS (100 ng/ml) for an additional 60 min. Proteins were analyzed by Western blotting with appropriate Abs. For the control of equal protein loading, the blots were reprobed with ERK1/2 or topoisomerase I (topo I) Ab. Results of one of three independent experiments are shown.

 
The gene transactivation activity of NF-{kappa}B depends also on posttranslational modifications, as, for example, phosphorylation of the NF-{kappa}B proteins. Only recently has it been demonstrated that IKK{beta} is essential for the phosphorylation of p65 at Ser536 (33), although a role for IKK{alpha} in this process has also been suggested (34). The phosphorylation increases the transcriptional activity of p65. Therefore, we further analyzed whether ABAs in addition to the degradation of I{kappa}B{alpha} also affect the LPS-induced phosphorylation of p65. Treatment of monocytes with 100 ng/ml LPS led to p65 phosphorylation in nuclear extracts (Fig. 5B). Pretreatment with A{alpha}BA concentration-dependently reduced, and pretreatment with AK{beta}BA abolished the LPS-induced phosphorylation of p65.

ABAs inhibit I{kappa}B kinase activity

Both I{kappa}B{alpha} and p65 are phosphorylated by IKK (1, 4, 33, 34, 35). Hence, we hypothesized that ABAs might inhibit IKK. The effects of A{alpha}BA and AK{beta}BA on IKK were analyzed in an in vitro kinase assay using immunoprecipitated IKK. The Ab used recognizes both the IKK{alpha} and IKK{beta} subunits. As expected, LPS (1 µg/ml) triggered activation of IKK within 30 min (Fig. 6A). We immunoprecipitated activated IKK complex from monocytes stimulated with 1 µg/ml LPS for 30 min and analyzed phosphorylation of recombinant I{kappa}B{alpha} and p65 in the presence of A{alpha}BA and AK{beta}BA. In the presence of the solvent DMSO, the immunoprecipitated IKK complex phosphorylated rI{kappa}B{alpha}. This IKK-mediated phosphorylation was concentration-dependently inhibited by both A{alpha}BA and AK{beta}BA (1–10 µM) (Fig. 6B). By contrast, both A{alpha}BA and AK{beta}BA did not affect ERK2 activity, supporting the view that the ABAs exert a specific inhibitory effect on the IKK complex. Inhibition of IKKs by ABAs was confirmed by performing an in vitro kinase assay with active human recombinant GST-IKK{alpha} and His-IKK{beta}. A{alpha}BA and, to a larger extent, AK{beta}BA inhibited activity of both GST-IKK{alpha} and His-IKK{beta}. As little as 1 µM of AK{beta}BA affected the phosphorylation of I{kappa}B{alpha} by either kinase (Fig. 6C). We used the more potent compound AK{beta}BA to prove direct interaction with rIKKs using SPR analysis. AK{beta}BA evidently binds to GST-IKK{alpha} with higher affinity than to His-IKK{beta} (Fig. 6D). This binding was specific, because it was inhibited by pretreatment of AK{beta}BA with GST-IKK{alpha} or His-IKK{beta} before measurement. Thus, we have identified A{alpha}BA and AK{beta}BA as distinct inhibitors of IKK activity.



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 6. ABAs inhibit I{kappa}B kinase activity. A, LPS triggers a rapid activation of IKK. Monocytes (5 x 106) were treated for 10 or 30 min with LPS (1 µg/ml), or left unstimulated. The IKK complex was immunoprecipitated using Ab that recognizes both IKK{alpha} and IKK{beta}, and analyzed in an in vitro kinase assay with rI{kappa}B{alpha} as a substrate. B, Phosphorylation of recombinant I{kappa}B{alpha} and p65 by the immunoprecipitated IKK complex and phosphorylation of rElk-1 by ERK2. Monocytes (20 x 106) were resuspended in 2 ml of RPMI 1640 and stimulated with LPS (1 µg/ml) for 30 min. The immunoprecipitated IKK complex was extensively washed, pretreated with different concentrations of A{alpha}BA or AK{beta}BA for 15 min, and used for kinase assays. Samples were separated by SDS-PAGE and blotted onto nitrocellulose membranes. Phosphorylated I{kappa}B{alpha} and p65 were visualized by phosphor imaging. IKK was detected by immunostaining. Alternatively, ERK2 was immunoprecipitated, incubated with A{alpha}BA or AK{beta}BA, and analyzed using Elk-1 as a substrate. C, Phosphorylation of rI{kappa}B{alpha} by active human recombinant GST-IKK{alpha} and His-IKK{beta} subunits. GST-IKK{alpha} and His-IKK{beta} (each 30 nM) were pretreated with ABAs (0.1–10 µM). Phosphorylated substrate was visualized by phosphor imaging. IP, Immunoprecipitation; KA, kinase assay; WB, Western blot. Results of one of three independent experiments are shown. D, AK{beta}BA binds to human recombinant GST-IKK{alpha} and His-IKK{beta}. Binding was measured by SPR. GST-IKK{alpha} and His-IKK{beta} were immobilized on the surface of the SPR sensor chip. AK{beta}BA (100 µM) in the kinase buffer was applied onto the sensor chip surface. An enhanced SPR response indicates binding of AK{beta}BA to the immobilized GST-IKK{alpha} (solid lines) and His-IKK{beta} (broken line). Pretreatment for 20 min at 20°C with 100 nM of either GST-IKK{alpha} or His-IKK{beta} abolished the subsequent binding to the immobilized kinase. Representative tracings of one of three independent experiments are shown.

 
Suppression of I{kappa}B kinase expression inhibits LPS-induced TNF-{alpha} generation

It has previously been suggested that LPS-induced expression of proinflammatory cell activation involves activation of IKK{alpha} and IKK{beta} (36, 37, 38). To confirm the link between IKK and TNF-{alpha} induction in our LPS-stimulated monocytes, we used an in vitro knockdown approach, using IKK-specific antisense ODN. Through immunoblot analysis, we confirmed that treatment of monocytes with IKK-specific antisense, but not with control ODN, induces significant down-regulation of IKK{alpha} and IKK{beta} (Fig. 7A). In line with these findings, the control ODN did not significantly affect the TNF-{alpha} release into the medium, whereas the antisense ODN against IKK{alpha} and IKK{beta} significantly inhibited the TNF-{alpha} release by 46.1 ± 12.4% (n = 4; p < 0.01) and 79.4 ± 3.7% (n = 4; p < 0.01), respectively. Thus, inhibition of IKK{alpha} and IKK{beta} clearly leads to inhibition of the TNF-{alpha} release in the LPS-stimulated monocytes.



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 7. Suppression of I{kappa}B kinase expression inhibits LPS-induced TNF-{alpha} generation. Monocytes (0.2 x 106/100 µl) were treated with 0.1 µM IKK{alpha}- or IKK{beta}-specific antisense or control phosphorothioate ODN for 28 h. After a recovery period for 12 h, the cells were stimulated with LPS (100 ng/ml) for 4 h. A, IKK expression. Monocyte lysates were subjected to Western blot analysis for IKK{alpha} and IKK{beta}; the complementary IKK is shown for comparison. Results of one of three experiments are shown. B, TNF-{alpha} release. TNF-{alpha} release into the medium was analyzed by ELISA. Results are mean ± SEM of four experiments. **, p < 0.01 vs LPS control.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In a number of clinical pilot studies, therapeutic benefits have been claimed when chronic inflammatory diseases, such as rheumatoid arthritis, inflammatory bowel diseases, or asthma, were treated with ABA-containing extracts (10, 11, 12, 13, 39). The anti-inflammatory mechanism of action of ABAs, specifically of AK{beta}BA, was originally thought to involve inhibition of the 5-lipoxygenase pathway of arachidonic acid metabolism (16, 40). Although leukotrienes generated via this pathway were believed to act as important lipid mediators of inflammatory diseases, a number of potent leukotriene antagonists and inhibitors failed in clinical studies, casting doubts on the significance of these mediators. Despite enormous industrial efforts, currently only a few compounds with moderate therapeutic activity, such as montelukast, zafirlukast, or zileuton, are being used for the sole indication of asthma (41). In the light of the claimed therapeutic efficacy of ABA-containing therapeutics in chronic inflammatory diseases, we assumed that ABAs might target different proinflammatory mechanisms that might be worth therapeutic exploitation.

A common theme in chronic inflammation is stimulation of the proinflammatory transcription factors AP-1 and NF-{kappa}B (1, 3, 42). Having observed that ABAs inhibit TNF-{alpha} release, we tested the hypothesis that ABAs might exert their anti-inflammatory activity through inhibition of NF-{kappa}B.

We used endotoxic LPS, which is one of the most potent activators of monocytes (29, 36). LPS is first engaged by CD14 and then brought into direct contact with the LPS-responsive TLR4 and the coreceptor MD-2 (43, 44). Toll signaling to NF-{kappa}B originates from the conserved Toll-IL-1R (TIR) domain, which mediates recruitment of the TIR domain-containing adapter molecule MyD88 that is important for signaling through all TLRs. The recruitment of MyD88 to cytoplasmic TIR domains of activated TLR4 allows for the interaction and activation of the IL-1R-associated kinase family members and the subsequent activation of TNFR-associated factor-6 (45). A larger protein complex that contains TNFR-associated factor-6 activates TGF-{beta}-activated kinase 1, which phosphorylates the IKK complex and thereby induces the activation of transcription factors NF-{kappa}B and AP-1 (44, 46). Apart from the MyD88-dependent pathway, in dendritic cells and macrophages TLR4 can also trigger signaling in a MyD88-independent fashion that requires interaction with additional adapter proteins, such as TIR domain-containing adapter-inducing IFN-{beta}-related adapter molecule and TIR domain-containing adapter-inducing IFN-{beta} (43, 47, 48). However, information on this signaling mechanism is still incomplete, and it has been suggested that the TLR4 signaling pathway might acquire activation of both the MyD88-dependent and -independent pathways to induce inflammatory cytokines, such as TNF-{alpha} (44).

Activation of NF-{kappa}B is a multistep process that involves activation of the IKK complex, phosphorylation of inhibitors and their degradation, transport of NF-{kappa}B proteins to the nucleus, binding to the NF-{kappa}B-consensus sequence, and activation of genes (1, 4). In unstimulated cells, mature NF-{kappa}B dimers are trapped in the cytoplasm by interaction with the inhibitory proteins termed I{kappa}Bs, which mask the nuclear localization sequence of NF-{kappa}B proteins. In response to stimuli, the I{kappa}B proteins are phosphorylated, which enables NF-{kappa}B to enter the nucleus where it activates gene expression such as TNF (4, 49). It is the multi-subunit IKK complex, consisting of two catalytic subunits, IKK{alpha} and IKK{beta}, and a regulatory subunit IKK{gamma}, that phosphorylates I{kappa}B proteins on two distinct serine residues, thereby targeting them to rapid ubiquitin-dependent proteolysis that initiates the activation of NF-{kappa}B (4, 49). Recently, additional posttranslational modifications of the NF-{kappa}B proteins, such as phosphorylation or acetylation, have been shown to be essential for the stimulatory activity of NF-{kappa}B (4). Inhibition of either step would lead to the impaired activation of target genes.

LPS stimulation triggers activation of IKK in monocytes and the monocytic THP-1 cell line. From transfection experiments with dominant-negative mutants of IKK{alpha} and IKK{beta} in THP-1 cells, it was concluded that IKK{beta} plays a dominant role in LPS-induced signaling (36). This finding contrasts with recent data from macrophages showing that, for the LPS-induced NF-{kappa}B activation and TNF-{alpha} production, IKK{beta} is not required (50). Others have shown that LPS stimulation of THP-1 cells leads to activation of IKK{alpha} and IKK{beta} (38). Furthermore, activation of both IKK{alpha} and IKK{beta} appears to be essential for CD14-independent LPS signaling (37). Using the IKK-specific antisense ODN approach, our data clearly indicate that both IKK{alpha} and IKK{beta} are engaged in the LPS-stimulated TNF-{alpha} production in human primary monocytes. In that regard, they are consistent with data from mouse embryonic fibroblasts, where it was shown that IKK{alpha} is just as critical as IKK{beta} and NEMO/IKK{gamma} for the global activation of NF-{kappa}B-dependent, TNF-{alpha}- and IL-1-responsive genes (49), indicating that each IKK might be required for the NF-{kappa}B-mediated inflammatory response program.

Several plant-derived compounds have been shown to interfere with the NF-{kappa}B pathway (7, 8, 9, 17, 51). Despite the fact that ursolic and betulinic acids are structurally similar to the ABAs, they do not directly interfere with the IKK activity (8, 9). Similarly, the synthetic flavone flavopiridol exerts its activity, probably, via inhibition of Akt, and has no direct effect on the IKKs (17). Curcumin seems to inhibit the activity of immunoprecipitated IKKs; however, these data were not confirmed with purified enzymes, nor were effects on other kinases excluded (51).

With both native IKK complexes immunoprecipitated from LPS-activated monocytes, as well as recombinant active GST-IKK{alpha} and His-IKK{beta}, we demonstrate that A{alpha}BA and AK{beta}BA inhibit the IKK activity. The inhibitory effect on IKK activity is reflected by the inhibition of phosphorylation of I{kappa}B{alpha} and of p65 on Ser536, resulting in reduced nuclear translocation of p65 and the inhibition of subsequent NF-{kappa}B-dependent expression of TNF-{alpha}. Phosphorylation of I{kappa}B{alpha} in conjunction with that of p65 on Ser536 located in the TA1 transactivation domain was originally identified in TNF-{alpha}-stimulated HeLa cells (35), a finding that has also been confirmed in other cell types, including LPS-stimulated mouse macrophages and human monocytic cell lines (33, 35, 38). The existing evidence from various in vitro studies, transfection, as well as from knockout experiments, indicates that p65 phosphorylation on Ser536 in the cytoplasm is catalyzed by both IKK{alpha} and IKK{beta} (34, 52). Although phosphorylation of p65 in general and on Ser536 (33) has been implicated in enhanced NF-{kappa}B transcriptional activity (53), the precise physiological role of the Ser536 phosphorylation is at present still unclear (52).

As to the potential pharmacotherapeutic use of IKK inhibitors, there are quite some reservations against the background that IKK{beta} knockout in mice is associated with embryonic lethality owing to TNF-{alpha}-driven massive liver necrosis (54). Similarly, ablation of IKK{beta} in mouse enterocytes prevented the systemic inflammatory response upon mesenteric ischemia-reperfusion injury, but also resulted in severe apoptotic damage to the reperfused intestinal mucosa (55). In contrast to IKK{beta} knockout mice, IKK{alpha} knockout mice show normal liver development, but skin and limb abnormalities (56). Furthermore, there are also concerns regarding side effects when IKK is inhibited. However, preliminary data from our laboratory show that mice treated with therapeutic doses of ABAs do not exhibit any major toxic effects. Similarly, patients using ABA-containing phytopharmaceuticals do not experience major side effects either, suggesting that inhibition of IKK might offer realistic therapeutic opportunities.

Oral administration of a single dose of 1200–1600 mg of ABA-containing extract preparations yielded effective plasma concentrations of 2–32 µM of various acetylated and nonacetylated boswellic acids (11, 57, 58), yet a high bioavailability of boswellic acids strongly depends on concomitant food intake (58). Treatment of glioblastoma patients with an extract from the gum resin of B. serrata, i.e., Indian frankincense, over 10 days led to a plasma levels of acetylated and nonacetylated forms of {alpha}-boswellic acid of 4 µM (18). Thus, oral intake of frankincense extracts may very well yield concentrations required for the inhibition of NF-{kappa}B signaling.

In conclusion, our data demonstrate that selective inhibition of IKK represents a potential therapeutic target for the suppression of NF-{kappa}B-dependent cytokine expression, and that both A{alpha}BA and AK{beta}BA are novel selective inhibitors of IKK activity. Taken together, these findings offer new perspectives for novel therapeutic approaches.


    Acknowledgments
 
We are grateful to Dr. M. Cathcart for valuable advice concerning the ODN experiments, and we thank J. Marinaci and W. Zugmaier for expert technical assistance.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by the Deutsche Forschungsgemeinschaft. Back

2 Address correspondence and reprint requests to Dr. Thomas Simmet, Department of Pharmacology of Natural Products and Clinical Pharmacology, University of Ulm, Helmholtzstrasse 20, D-89081 Ulm, Germany. E-mail address: thomas.simmet{at}medizin.uni-ulm.de Back

3 Abbreviations used in this paper: ABA, acetyl-boswellic acid; A{alpha}BA, acetyl-{alpha}-boswellic acid; AK{beta}BA, acetyl-11-keto-{beta}-boswellic acid; IKK, I{kappa}B{alpha} kinase; ISRE, IFN-stimulated response element; IRF, IFN regulatory factor; SPR, surface plasmon resonance; ODN, oligodeoxynucleotide; TIR, Toll-IL-1R. Back

Received for publication June 19, 2004. Accepted for publication October 18, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Tak, P. P., G. S. Firestein. 2001. NF-{kappa}B: a key role in inflammatory diseases. J. Clin. Invest. 107:7.[Medline]
  2. Baldwin, A. S., Jr. 2001. Series introduction: the transcription factor NF-{kappa}B and human disease. J. Clin. Invest. 107:3.[Medline]
  3. Makarov, S. S.. 2000. NF-{kappa}B as a therapeutic target in chronic inflammation: recent advances. Mol. Med. Today 6:441.[Medline]
  4. Ghosh, S., M. Karin. 2002. Missing pieces in the NF-{kappa}B puzzle. Cell 109:S81.[Medline]
  5. Romas, E., M. T. Gillespie, T. J. Martin. 2002. Involvement of receptor activator of NF{kappa}B ligand and tumor necrosis factor-{alpha} in bone destruction in rheumatoid arthritis. Bone 30:340.[Medline]
  6. Feldmann, M., R. N. Maini. 2003. Lasker Clinical Medical Research Award: TNF defined as a therapeutic target for rheumatoid arthritis and other autoimmune diseases. Nat. Med. 9:1245.[Medline]
  7. Estrov, Z., S. Shishodia, S. Faderl, D. Harris, Q. Van, H. M. Kantarjian, M. Talpaz, B. B. Aggarwal. 2003. Resveratrol blocks interleukin-1{beta}-induced activation of the nuclear transcription factor NF-{kappa}B, inhibits proliferation, causes S-phase arrest, and induces apoptosis of acute myeloid leukemia cells. Blood 102:987.[Abstract/Free Full Text]
  8. Shishodia, S., S. Majumdar, S. Banerjee, B. B. Aggarwal. 2003. Ursolic acid inhibits nuclear factor-{kappa}B activation induced by carcinogenic agents through suppression of I{kappa}B{alpha} kinase and p65 phosphorylation: correlation with down-regulation of cyclooxygenase 2, matrix metalloproteinase 9, and cyclin D1. Cancer Res. 63:4375.[Abstract/Free Full Text]
  9. Takada, Y., B. B. Aggarwal. 2003. Betulinic acid suppresses carcinogen-induced NF-{kappa}B activation through inhibition of I{kappa}B{alpha} kinase and p65 phosphorylation: abrogation of cyclooxygenase-2 and matrix metalloprotease-9. J. Immunol. 171:3278.[Abstract/Free Full Text]
  10. Ammon, H. P. T.. 2002. Boswellic acids (components of frankincense) as the active principle in treatment of chronic inflammatory diseases. Wien. Med. Wochenschr. 152:373.[Medline]
  11. Gupta, I., A. Parihar, P. Malhotra, G. B. Singh, R. Ludtke, H. Safayhi, H. P. T. Ammon. 1997. Effects of Boswellia serrata gum resin in patients with ulcerative colitis. Eur. J. Med. Res. 2:37.[Medline]
  12. Gupta, I., A. Parihar, P. Malhotra, S. Gupta, R. Ludtke, H. Safayhi, H. P. T. Ammon. 2001. Effects of gum resin of Boswellia serrata in patients with chronic colitis. Planta Med. 67:391.[Medline]
  13. Gerhardt, H., F. Seifert, P. Buvari, H. Vogelsang, R. Repges. 2001. Therapy of active Crohn disease with Boswellia serrata extract H 15. Z. Gastroenterol. 39:11.[Medline]
  14. Belsner, K., B. Büchele, U. Werz, T. Syrovets, T. Simmet. 2003. Structural analysis of pentacyclic triterpenes from the gum resin of Boswellia serrata by NMR spectroscopy. Magn. Reson. Chem. 41:115.
  15. Büchele, B., W. Zugmaier, T. Simmet. 2003. Analysis of pentacyclic triterpenic acids from frankincense gum resins and related phytopharmaceuticals by high-performance liquid chromatography: identification of lupeolic acid, a novel pentacyclic triterpene. J. Chromatogr. B 791:21.
  16. Safayhi, H., E. R. Sailer, H. P. T. Ammon. 1995. Mechanism of 5-lipoxygenase inhibition by acetyl-11-keto-{beta}-boswellic acid. Mol. Pharmacol. 47:1212.[Abstract]
  17. Takada, Y., B. B. Aggarwal. 2004. Flavopiridol inhibits NF-{kappa}B activation induced by various carcinogens and inflammatory agents through inhibition of I{kappa}B{alpha} kinase and p65 phosphorylation: abrogation of cyclin D1, cyclooxygenase-2, and matrix metalloprotease-9. J. Biol. Chem. 279:4750.[Abstract/Free Full Text]
  18. Büchele, B., T. Simmet. 2003. Analysis of 12 different pentacyclic triterpenic acids from frankincense in human plasma by high-performance liquid chromatography and photodiode array detection. J. Chromatogr. B 795:355.
  19. Colognato, R., J. R. Slupsky, M. Jendrach, L. Burysek, T. Syrovets, T. Simmet. 2003. Differential expression and regulation of protease-activated receptors in human peripheral monocytes and monocyte-derived antigen-presenting cells. Blood 102:2645.[Abstract/Free Full Text]
  20. Syrovets, T., B. Tippler, M. Rieks, T. Simmet. 1997. Plasmin is a potent and specific chemoattractant for human peripheral monocytes acting via a cyclic guanosine monophosphate-dependent pathway. Blood 89:4574.[Abstract/Free Full Text]
  21. Syrovets, T., M. Jendrach, A. Rohwedder, A. Schüle, T. Simmet. 2001. Plasmin-induced expression of cytokines and tissue factor in human monocytes involves AP-1 and IKK{beta}-mediated NF-{kappa}B activation. Blood 97:3941.[Abstract/Free Full Text]
  22. Mosmann, T.. 1983. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods 65:55.[Medline]
  23. Syrovets, T., A. Schule, M. Jendrach, B. Büchele, T. Simmet. 2002. Ciglitazone inhibits plasmin-induced proinflammatory monocyte activation via modulation of p38 MAP kinase activity. Thromb. Haemost. 88:274.[Medline]
  24. Grandvaux, N., M. J. Servant, B. tenOever, G. C. Sen, S. Balachandran, G. N. Barber, R. Lin, J. Hiscott. 2002. Transcriptional profiling of interferon regulatory factor 3 target genes: direct involvement in the regulation of interferon-stimulated genes. J. Virol. 76:5532.[Abstract/Free Full Text]
  25. Burysek, L., T. Syrovets, T. Simmet. 2002. The serine protease plasmin triggers expression of MCP-1 and CD40 in human primary monocytes via activation of p38 MAPK and Janus kinase (JAK)/STAT signaling pathways. J. Biol. Chem. 277:33509.[Abstract/Free Full Text]
  26. Syrovets, T., B. Büchele, E. Gedig, J. R. Slupsky, T. Simmet. 2000. Acetyl-boswellic acids are novel catalytic inhibitors of human topoisomerases I and II{alpha}. Mol. Pharmacol. 58:71.[Abstract/Free Full Text]
  27. Zuker, M.. 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31:3406.[Abstract/Free Full Text]
  28. Bey, E. A., M. K. Cathcart. 2002. Antisense oligodeoxyribonucleotides: a better way to inhibit monocyte superoxide anion production?. Methods Enzymol. 353:421.[Medline]
  29. Vassalli, P.. 1992. The pathophysiology of tumor necrosis factors. Annu. Rev. Immunol. 10:411.[Medline]
  30. Greaves, D. R., K. M. Channon. 2002. Inflammation and immune responses in atherosclerosis. Trends Immunol. 23:535.[Medline]
  31. Watanabe, N., K. Nakada, Y. Kobayashi. 1998. Processing and release of tumor necrosis factor {alpha}. Eur. J. Biochem. 253:576.[Medline]
  32. Udalova, I. A., J. C. Knight, V. Vidal, S. A. Nedospasov, D. Kwiatkowski. 1998. Complex NF-{kappa}B interactions at the distal tumor necrosis factor promoter region in human monocytes. J. Biol. Chem. 273:21178.[Abstract/Free Full Text]
  33. Yang, F., E. Tang, K. Guan, C. Y. Wang. 2003. IKK{beta} plays an essential role in the phosphorylation of RelA/p65 on serine 536 induced by lipopolysaccharide. J. Immunol. 170:5630.[Abstract/Free Full Text]
  34. Sizemore, N., N. Lerner, N. Dombrowski, H. Sakurai, G. R. Stark. 2002. Distinct roles of the I{kappa}B kinase {alpha} and {beta} subunits in liberating nuclear factor {kappa}B (NF-{kappa}B) from I{kappa}B and in phosphorylating the p65 subunit of NF-{kappa}B. J. Biol. Chem. 277:3863.[Abstract/Free Full Text]
  35. Sakurai, H., H. Chiba, H. Miyoshi, T. Sugita, W. Toriumi. 1999. I{kappa}B kinases phosphorylate NF-{kappa}B p65 subunit on serine 536 in the transactivation domain. J. Biol. Chem. 274:30353.[Abstract/Free Full Text]
  36. O’Connell, M. A., B. L. Bennett, F. Mercurio, A. M. Manning, N. Mackman. 1998. Role of IKK1 and IKK2 in lipopolysaccharide signaling in human monocytic cells. J. Biol. Chem. 273:30410.[Abstract/Free Full Text]
  37. Sanlioglu, S., C. M. Williams, L. Samavati, N. S. Butler, G. Wang, P. B. McCray, Jr, T. C. Ritchie, G. W. Hunninghake, E. Zandi, J. F. Engelhardt. 2001. Lipopolysaccharide induces Rac1-dependent reactive oxygen species formation and coordinates tumor necrosis factor-{alpha} secretion through IKK regulation of NF-{kappa}B. J. Biol. Chem. 276:30188.[Abstract/Free Full Text]
  38. Hawiger, J., R. A. Veach, X. Y. Liu, S. Timmons, D. W. Ballard. 1999. I{kappa}B kinase complex is an intracellular target for endotoxic lipopolysaccharide in human monocytic cells. Blood 94:1711.[Abstract/Free Full Text]
  39. Gupta, I., V. Gupta, A. Parihar, S. Gupta, R. Ludtke, H. Safayhi, H. P. T. Ammon. 1998. Effects of Boswellia serrata gum resin in patients with bronchial asthma: results of a double-blind, placebo-controlled, 6-week clinical study. Eur. J. Med. Res. 3:511.[Medline]
  40. Safayhi, H., T. Mack, J. Sabieraj, M. I. Anazodo, L. R. Subramanian, H. P. T. Ammon. 1992. Boswellic acids: novel, specific, nonredox inhibitors of 5-lipoxygenase. J. Pharmacol. Exp. Ther. 261:1143.[Abstract/Free Full Text]
  41. McMillan, R. M.. 2001. Leukotrienes in respiratory disease. Paediatr. Respir. Rev. 2:238.[Medline]
  42. Yamamoto, Y., R. B. Gaynor. 2001. Therapeutic potential of inhibition of the NF-{kappa}B pathway in the treatment of inflammation and cancer. J. Clin. Invest. 107:135.[Medline]
  43. Beutler, B., K. Hoebe, X. Du, R. J. Ulevitch. 2003. How we detect microbes and respond to them: the Toll-like receptors and their transducers. J. Leukocyte Biol. 74:479.[Abstract/Free Full Text]
  44. Takeda, K., S. Akira. 2004. TLR signaling pathways. Semin. Immunol. 16:3.[Medline]
  45. Zhang, F. X., C. J. Kirschning, R. Mancinelli, X. P. Xu, Y. Jin, E. Faure, A. Mantovani, M. Rothe, M. Muzio, M. Arditi. 1999. Bacterial lipopolysaccharide activates nuclear factor-{kappa}B through interleukin-1 signaling mediators in cultured human dermal endothelial cells and mononuclear phagocytes. J. Biol. Chem. 274:7611.[Abstract/Free Full Text]
  46. Imler, J. L., L. Zheng. 2004. Biology of Toll receptors: lessons from insects and mammals. J. Leukocyte Biol. 75:18.[Abstract/Free Full Text]
  47. Toshchakov, V., B. W. Jones, P. Y. Perera, K. Thomas, M. J. Cody, S. Zhang, B. R. Williams, J. Major, T. A. Hamilton, M. J. Fenton, S. N. Vogel. 2002. TLR4, but not TLR2, mediates IFN-{beta}-induced STAT1{alpha}/{beta}-dependent gene expression in macrophages. Nat. Immunol. 3:392.[Medline]
  48. Fitzgerald, K. A., D. C. Rowe, B. J. Barnes, D. R. Caffrey, A. Visintin, E. Latz, B. Monks, P. M. Pitha, D. T. Golenbock. 2003. LPS-TLR4 signaling to IRF-3/7 and NF-{kappa}B involves the Toll adapters TRAM and TRIF. J. Exp. Med. 198:1043.[Abstract/Free Full Text]
  49. Li, X., P. E. Massa, A. Hanidu, G. W. Peet, P. Aro, A. Savitt, S. Mische, J. Li, K. B. Marcu. 2002. IKK{alpha}, IKK{beta}, and NEMO/IKK{gamma} are each required for the NF-{kappa}B-mediated inflammatory response program. J. Biol. Chem. 277:45129.[Abstract/Free Full Text]
  50. Andreakos, E., S. M. Sacre, C. Smith, A. Lundberg, S. Kiriakidis, T. Stonehouse, C. Monaco, M. Feldmann, B. M. Foxwell. 2004. Distinct pathways of LPS-induced NF-{kappa}B activation and cytokine production in human myeloid and nonmyeloid cells defined by selective utilization of MyD88 and Mal/TIRAP. Blood 103:2229.[Abstract/Free Full Text]
  51. Bharti, A. C., N. Donato, S. Singh, B. B. Aggarwal. 2003. Curcumin (diferuloylmethane) down-regulates the constitutive activation of nuclear factor-{kappa}B and I{kappa}B{alpha} kinase in human multiple myeloma cells, leading to suppression of proliferation and induction of apoptosis. Blood 101:1053.[Abstract/Free Full Text]
  52. Sakurai, H., S. Suzuki, N. Kawasaki, H. Nakano, T. Okazaki, A. Chino, T. Doi, I. Saiki. 2003. Tumor necrosis factor-{alpha}-induced IKK phosphorylation of NF-{kappa}B p65 on serine 536 is mediated through the TRAF2, TRAF5, and TAK1 signaling pathway. J. Biol. Chem. 278:36916.[Abstract/Free Full Text]
  53. Vermeulen, L., G. De Wilde, S. Notebaert, W. Vanden Berghe, G. Haegeman. 2002. Regulation of the transcriptional activity of the nuclear factor-{kappa}B p65 subunit. Biochem. Pharmacol. 64:963.[Medline]
  54. Li, Q., D. Van Antwerp, F. Mercurio, K. F. Lee, I. M. Verma. 1999. Severe liver degeneration in mice lacking the I{kappa}B kinase 2 gene. Science 284:321.[Abstract/Free Full Text]
  55. Chen, L. W., L. Egan, Z. W. Li, F. R. Greten, M. F. Kagnoff, M. Karin. 2003. The two faces of IKK and NF-{kappa}B inhibition: prevention of systemic inflammation but increased local injury following intestinal ischemia-reperfusion. Nat. Med. 9:575.[Medline]
  56. Takeda, K., O. Takeuchi, T. Tsujimura, S. Itami, O. Adachi, T. Kawai, H. Sanjo, K. Yoshikawa, N. Terada, S. Akira. 1999. Limb and skin abnormalities in mice lacking IKK{alpha}. Science 284:313.[Abstract/Free Full Text]
  57. Tawab, M. A., A. Kaunzinger, U. Bahr, M. Karas, M. Wurglics, M. Schubert-Zsilavecz. 2001. Development of a high-performance liquid chromatographic method for the determination of 11-keto-{beta}-boswellic acid in human plasma. J. Chromatogr. B Biomed. Sci. Appl. 761:221.[Medline]
  58. Sterk, V., B. Büchele, and T. Simmet. Effect of food intake on the bioavailability of boswellic acids from a herbal preparation in healthy volunteers. Planta Med. In press.



This article has been cited by other articles:


Home page
Mol Cancer ResHome page
A. B. Kunnumakkara, A. S. Nair, B. Sung, M. K. Pandey, and B. B. Aggarwal
Boswellic Acid Blocks Signal Transducers and Activators of Transcription 3 Signaling, Proliferation, and Survival of Multiple Myeloma via the Protein Tyrosine Phosphatase SHP-1
Mol. Cancer Res., January 1, 2009; 7(1): 118 - 128.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. Popovic, Y. Laumonnier, L. Burysek, T. Syrovets, and T. Simmet
Thrombin-induced expression of endothelial CX3CL1 potentiates monocyte CCL2 production and transendothelial migration
J. Leukoc. Biol., July 1, 2008; 84(1): 215 - 223.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
P. Kruger, R. Daneshfar, G. P. Eckert, J. Klein, D. A. Volmer, U. Bahr, W. E. Muller, M. Karas, M. Schubert-Zsilavecz, and M. Abdel-Tawab
Metabolism of Boswellic Acids in Vitro and in Vivo
Drug Metab. Dispos., June 1, 2008; 36(6): 1135 - 1142.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
C. Cuaz-Perolin, L. Billiet, E. Bauge, C. Copin, D. Scott-Algara, F. Genze, B. Buchele, T. Syrovets, T. Simmet, and M. Rouis
Antiinflammatory and Antiatherogenic Effects of the NF-{kappa}B Inhibitor Acetyl-11-Keto-{beta}-Boswellic Acid in LPS-Challenged ApoE-/- Mice
Arterioscler. Thromb. Vasc. Biol., February 1, 2008; 28(2): 272 - 277.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
F. Wieser, M. Cohen, A. Gaeddert, J. Yu, C. Burks-Wicks, S. L. Berga, and R. N. Taylor
Evolution of medical treatment for endometriosis: back to the roots?
Hum. Reprod. Update, September 1, 2007; 13(5): 487 - 499.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
Q. Li, Y. Laumonnier, T. Syrovets, and T. Simmet
Plasmin Triggers Cytokine Induction in Human Monocyte-Derived Macrophages
Arterioscler. Thromb. Vasc. Biol., June 1, 2007; 27(6): 1383 - 1389.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
D. Poeckel, L. Tausch, N. Kather, J. Jauch, and O. Werz
Boswellic Acids Stimulate Arachidonic Acid Release and 12-Lipoxygenase Activity in Human Platelets Independent of Ca2+ and Differentially Interact with Platelet-Type 12-Lipoxygenase
Mol. Pharmacol., September 1, 2006; 70(3): 1071 - 1078.
[Abstract] [Full Text] [PDF]


Home page
Evid Based Complement Alternat MedHome page
A. Vojdani and J. Erde
Regulatory T Cells, a Potent Immunoregulatory Target for CAM Researchers: The Ultimate Antagonist (I).
Evid. Based Complement. Altern. Med., March 1, 2006; 3(1): 25 - 30.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Takada, H. Ichikawa, V. Badmaev, and B. B. Aggarwal
Acetyl-11-Keto-beta-Boswellic Acid Potentiates Apoptosis, Inhibits Invasion, and Abolishes Osteoclastogenesis by Suppressing NF-{kappa}B and NF-{kappa}B-Regulated Gene Expression.
J. Immunol., March 1, 2006; 176(5): 3127 - 3140.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
D. Poeckel, L. Tausch, S. George, J. Jauch, and O. Werz
3-O-Acetyl-11-keto-boswellic Acid Decreases Basal Intracellular Ca2+ Levels and Inhibits Agonist-Induced Ca2+ Mobilization and Mitogen-Activated Protein Kinase Activation in Human Monocytic Cells
J. Pharmacol. Exp. Ther., January 1, 2006; 316(1): 224 - 232.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Syrovets, T.
Right arrow Articles by Simmet, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Syrovets, T.
Right arrow Articles by Simmet, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS