The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Persky, M. E.
Right arrow Articles by Farrar, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Persky, M. E.
Right arrow Articles by Farrar, J. D.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
The Journal of Immunology, 2005, 174: 294-301.
Copyright © 2005 by The American Association of Immunologists

IL-12, but Not IFN-{alpha}, Promotes STAT4 Activation and Th1 Development in Murine CD4+ T Cells Expressing a Chimeric Murine/Human Stat2 Gene1

Meredith E. Persky*, Kenneth M. Murphy{dagger},{ddagger} and J. David Farrar2,*

* Center for Immunology and Department of Molecular Biology, University of Texas Southwestern Medical Center, Dallas, TX 75390; {dagger} Department of Pathology and Center for Immunology, and {ddagger} Howard Hughes Medical Institute, Washington University School of Medicine, St. Louis, MO 63110


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Humans and mice have evolved distinct pathways for Th1 cell development. Although IL-12 promotes CD4+ Th1 development in both murine and human T cells, IFN-{alpha}{beta} drives Th1 development only in human cells. This IFN-{alpha}{beta}-dependent pathway is not conserved in the mouse species due in part to a specific mutation within murine Stat2. Restoration of this pathway in murine T cells would provide the opportunity to more closely model specific human disease states that rely on CD4+ T cell responses to IFN-{alpha}{beta}. To this end, the C terminus of murine Stat2, harboring the mutation, was replaced with the corresponding human Stat2 sequence by a knockin targeting strategy within murine embryonic stem cells. Chimeric m/h Stat2 knockin mice were healthy, bred normally, and exhibited a normal lymphoid compartment. Furthermore, the murine/human STAT2 protein was expressed in murine CD4+ T cells and was activated by murine IFN-{alpha} signaling. However, the murine/human STAT2 protein was insufficient to restore full IFN-{alpha}-driven Th1 development as defined by IFN-{gamma} expression. Furthermore, IL-12, but not IFN-{alpha}, promoted acute IFN-{gamma} secretion in collaboration with IL-18 stimulation in both CD4+ and CD8+ T cells. The inability of T cells to commit to Th1 development correlated with the lack of STAT4 phosphorylation in response to IFN-{alpha}. This finding suggests that, although the C terminus of human STAT2 is required for STAT4 recruitment and activation by the human type I IFNAR (IFN-{alpha}{beta}R), it is not sufficient to restore this process through the murine IFNAR complex.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A defining hallmark of an adaptive immune response is the orchestrated development of naive CD4+ T cells into effector populations that secrete distinct subsets of cytokines ( 1). These developmental cues are directed by innate cytokines secreted by professional APCs responding to pathogens ( 2, 3). For example, macrophages and dendritic cells responding to Gram-negative bacteria secrete high levels of IL-12 and IL-18 (innate cytokines) and present Ag to naive CD4+ T cells ( 4). IL-12 directs T cell development to the Th1 phenotype ( 5) through the activation of a key second messenger, STAT4 ( 6, 7). The Th1 phenotype is characterized by secretion of high concentrations of IFN-{gamma} at sites of inflammation. Furthermore, IFN-{gamma} secreted by Th1 cells mediates the elimination of both intracellular and extracellular bacterial pathogens through the activation of granulocytes and phagocytic cells.

The importance of Th1 cells in the immune response to pathogens is highlighted by the fact that this developmental pathway is conserved in mammalian species. For CD4+ T cells, IL-12 signaling and STAT4 activation is a conserved pathway that regulates the first steps of commitment to IFN-{gamma} expression ( 6, 7, 8, 9). However, in humans, in addition to IL-12, type I IFNs (IFN-{alpha}{beta}) also signal through STAT4 ( 10, 11, 12) and promote IFN-{gamma} secretion in CD4+ T cells ( 12, 13, 14, 15). Furthermore, this pathway is not conserved and/or is not efficient in murine CD4+ T cells ( 11, 12). Although recent studies have called this observation into question ( 16, 17, 18), clearly the murine (m)3 IFN-{alpha}{beta}R (IFNAR) is inefficient at promoting Th1 development and requires extremely high concentrations of IFN-{alpha} to detect this effect in murine T cells. The lack of an experimentally tractable mouse model of IFN-{alpha}-driven Th1 development is a major barrier to understanding human immune responses to pathogens that promote IFN-{alpha}{beta} secretion, such as viruses.

Our previous studies have provided a molecular explanation for the lack of IFN-{alpha}{beta}-dependent Th1 development in mouse CD4+ T cells ( 11, 19, 20). Unlike the IL-12R, our studies of the human (h)IFNAR demonstrated that recruitment and activation of STAT4 by the hIFNAR is mediated by STAT2 ( 11). STAT2 is recruited to the hIFNAR by an Src homology 2 (SH2)-dependent interaction with phosphorylated Y466 within the hIFNAR1 subunit ( 21, 22). In contrast, although STAT4 requires an intact SH2 domain for efficient activation by the hIFNAR ( 19), it does not interact directly with any phosphorylated tyrosine residues within either the hIFNAR1 or R2 subunit ( 11). Rather, STAT4 recruitment occurs in a STAT2-dependent manner, possibly by an either direct or indirect interaction with Y833 and Y841 within the C terminus of human STAT2 ( 19). This interaction does not occur in mouse due to a significant mutation and insertion of a repetitive minisatellite sequence within the C terminus of murine STAT2. As such, murine STAT2 fails to mediate STAT4 activation by the hIFNAR. Importantly, expression of a chimeric m/h STAT2 molecule, whereby the C terminus of the murine sequence has been replaced with the human counterpart, restores IFN-{alpha}{beta}-dependent STAT4 phosphorylation in STAT2-deficient human fibroblasts ( 19).

Based on these results and the lack of IFN-{alpha}{beta}-dependent Th1 responses observed in murine CD4+ T cells ( 12, 23), we proposed that mice and humans might respond differently to pathogens such as viruses that primarily evoke IFN-{alpha}{beta} secretion, as opposed to IL-12, from innate cells ( 20). A definitive test of this hypothesis involves reconstructing the IFN-{alpha}{beta} pathway to activate STAT4 in murine T cells. As a first step, we report here the development of a chimeric m/h Stat2 knockin (KI) mouse. The exon encoding the murine STAT2 C terminus, exon 23, was replaced with the corresponding human sequence by a targeted mutation of murine embryonic stem (ES) cells. Surprisingly, and in contrast to recent reports, we found that murine CD4+ T cells from m/h Stat2 KI mice were not able to activate STAT4 or commit to IFN-{gamma} expression in response to mIFN-{alpha}, even at extremely high concentrations of the cytokine. These results would suggest that an additional species-specific component is required for the efficient recruitment of STAT4 to the mIFNAR.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

IL-12p40–/– ( 24) were purchased from The Jackson Laboratory and backcrossed five generations onto the DO11.10 TCR transgenic (BALB/c background) ( 25).

Generation of m/h Stat2 KI mice

A 129/SvJ bacterial artificial chromosome clone harboring the murine Stat2 gene was obtained by screening a bacterial artificial chromosome library with a probe generated from the 5' end of the murine Stat2 cDNA (Genome Systems). A 20-kb fragment of the 3' region of murine Stat2 was subcloned into pBluescript (Stratagene) and extensively characterized by restriction mapping and sequencing. The 5' region of the targeting construct was assembled with three segments that included the replacement of exon 23 sequence with the corresponding human Stat2 C terminus sequence. A 4-kb HindIII/AflII genomic fragment was cloned upstream of a 450-bp AflII/BamHI-digested human Stat2 PCR fragment that was amplified with primers 5'-GCTGCAGCAGCCTCTGGAGCTTAAGCAGGATTCAGA and 3'-ACTGTCGGGATCCGGTTCCTAGAAGTCAGAAGGCATCAAGGGTCC. The fusion of these two fragments at the AflII site maintained the correct reading frame of exon 23. A 150-bp BglII-digested PCR fragment from the exon/intron junction of exon 23 was amplified with primers 5'-GCCTGAGATCTTGCAGCAGATTAGCGTGGAGG and 3'-GATGAAGGAGATCTTTGGGGCTCACGTTTTGGC. This exon/intron joint fragment was cloned at the 3' BamHI site at the end of the human Stat2 sequence described above, and this final 4.7-kb fragment was cloned into the XhoI site of the pLNTK targeting vector. Together, these three components created the 5' region of homologous recombination and effectively replaced the murine Stat2 C terminus with the human counterpart that included a stop codon at the end of this sequence. The remaining segment of exon 23 was preserved within this altered exon to ensure proper splicing to exon 24, which encodes the natural polyadenylation sequence. The 3' end of homologous recombination consisted of a 4-kb XhoI fragment that included the remaining segment of intron 23 through to the end of the last exon 24. This fragment was cloned into the SalI site within pLNTK.

Transfected RW-4 ES cells ( 26) were placed in selection with G418. Correctly targeted clones were identified by Southern blotting with probes derived from genomic sequence outside the regions of homologous recombination. The PGK-neor cassette was removed by transient infection of ES clones with adenovirus vector expressing Cre recombinase. ES cells were injected into C57BL/6 blastocysts and implanted into pseudopregnant Swiss Black females. Chimeric male offspring were mated to C57BL/6 females to determine germline transmission. Founders that were determined to transmit the chimeric allele were then mated to DO11.10 (BALB/c background) for five generations. In addition, a second line was maintained on the 129 background by first crossing founders to 129/SvJ followed by intercross breedings to maintain this colony. Experimental groups were generated from crosses of heterozygous KI parents to generate both homozygous KI and wild-type littermate controls. The m/h Stat2 KI allele was routinely detected by genomic PCR with primers 5'-GTGGACGAGCTGCAGCAG, 3'-ATACCATGCATAGTGTG, and 3'-CTAGTCCTCAGAAGGTATCAAGAGTCCATCCCAAGAG.

T cell cultures

Spleen and mesenteric lymph node cells from wild-type and m/h Stat2 KI x DO11.10 mice were cultured in IMDM supplemented with 10% FBS, L-glutamine (200 µM), nonessential amino acids (10 µM each), sodium pyruvate (100 µM), 2-ME (50 µM), and penicillin/streptomycin (100 U/ml each) (HyClone). CD4+ T cells were activated with OVA peptide (0.3 mM) and IL-2 (50 U/ml) under Th1 (anti-IL-4 (11B11; 10 µg/ml) and rmIL-12 (10 U/ml; R&D Systems)), Th2 (anti-IL-12 (Tosh; 10 µg/ml) and rmIL-4 (100 U/ml)), or under neutralizing conditions (anti-IL-4 plus anti-IL-12) in the absence or presence of IFN-{alpha} (typically 1000 U/ml; R&D Systems). Cells were activated for 3 days and split 1:8 into medium containing additional IL-2 (50 U/ml) and cultured for an additional 4 days.

For CD8+ T cell cultures, splenocytes and lymph node cells were isolated from m/h Stat2 KI mice (129/SvJ background), and CD8+ T cells were purified by flow-cytometric sorting. Purified CD8 T cells were activated with Con A in the presence of irradiated BALB/c splenocytes and IL-2 (100 U/ml) in complete IMDM for 3 days. Cells were diluted 1/10 on day 3 in medium containing additional IL-2 (100 U/ml) and rested to day 7.

Intracellular cytokine staining and flow-cytometric analysis

Resting T cell cultures were restimulated in medium containing PMA (50 ng/ml) and ionomycin (1 µM) for 4 h. In some cases, cells were restimulated with recombinant cytokines rmIL-12 (10 U/ml), rmIL-18 (50 ng/ml), and rmIFN-{alpha} (1000 U/ml). Brefeldin A (1 µg/ml; Sigma-Aldrich) was added during the last 2 h of stimulation. Activated cells were collected, fixed in 4% formalin, permeabilized with 0.05% saponin, and stained with fluorochrome-conjugated anti-IL-4 (11B11) and anti-IFN-{gamma} (R46A2) mAbs (Caltag). Relative fluorescence was measured by flow-cytometric analysis using a FACSCalibur instrument (BD Biosciences) with emission compensation detection.

IFN-{gamma} ELISA

Detection of IFN-{gamma} by ELISA has been described previously ( 27). Briefly, Immulon 1B microtiter plates (ThermoLabsystems) were coated with purified mAb R46A2 (2 µg/ml; Caltag), and IFN-{gamma} protein was detected with a biotin-conjugated secondary mAb XMG1.2 (0.5 mg/ml; Caltag). Complexes were detected by incubation with streptavidin-HRP followed by detection with 3,3',5,5'-tetramethylbenzidine substrate.

EMSA

Nuclear extracts were prepared from T cells activated for 30 min with either medium alone, IL-12 (10 U/ml), or rmIFN-{alpha} (A) (1000 U/ml) as previously described ( 11). To detect STAT2-containing IFN-sensitive gene factor-3 (ISGF3) complexes, 3 µg of nuclear extracts were incubated in 20 µl of binding reaction (10 mM Tris-Cl (pH 7.5), 50 mM NaCl, 1 mM DTT, 1 mM EDTA, 5% (v/v) glycerol, and 3 µg of poly(dI:dC) containing 1 x 105 cpm 32P-labeled double-stranded IFN-stimulated regulatory element oligonucleotide (GGGGGAAAGGGAAACCGAAACTGAACCCC). Reactions were incubated at room temperature for 30 min followed by the addition of a supershifting Ab to some reactions. Complexes were resolved on nondenaturing 4.5% acrylamide gels and visualized by autoradiography, as previously described.

Immunoprecipitation and Western blotting

Resting T cell cultures (day 7, described above) were restimulated with either medium alone, or with medium containing rmIL-12 (10 U/ml) or rmIFN-{alpha} (A) (1000 U/ml) for 30 min at 37°C. Cells were harvested, washed once in cold PBS, and lysed with 1 ml of lysis buffer (0.15 M NaCl, 1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, and 50 mM Tris-Cl (pH 8.0)). Cell lysates were immunoprecipitated sequentially with anti-STAT4 (5 µg/ml; SC-486; Santa Cruz) and anti-STAT1 (5 µg/ml; SC-346) polyclonal Abs in the presence of protein A-Sepharose (Amersham Biosciences). Immunoprecipitates were resolved by SDS-PAGE and immunoblotted with a peroxidase-conjugated anti-phosphotyrosine Ab (RC20; Upstate Biotechnology). Immunoreactive complexes were detected by chemiluminescence. To detect equivalent STAT precipitation, blots were stripped and incubated again with polyclonal Abs anti-STAT4 (SC-486) or anti-STAT1 (SC-346) and with a peroxidase-conjugated goat anti-rabbit Ig secondary Ab.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation of m/h Stat2 KI mice

We previously demonstrated that a chimeric m/h STAT2 molecule could restore IFN-{alpha}{beta}-dependent STAT4 activation when expressed in STAT2-deficient human fibroblasts (U6A cells) ( 19). To reconstruct this pathway in murine CD4+ T cells, we wished to express the same molecule from the endogenous murine Stat2 locus as that expressed in our in vitro studies (Fig. 1A). The divergence of sequence similarity between murine and human Stat2 begins within the first 50 nt of exon 23. The targeting construct was designed such that the region of sequence divergence within exon 23 was replaced with the cDNA sequence encoding the human STAT2 C terminus, including a stop codon (Fig. 1, A and B). The PGK-neor cassette was flanked by loxP sites and placed within the middle of intron 23. Following in vitro Cre-mediated deletion, only a single 12-nt loxP site was left within intron 23 and did not interfere with proper splicing of the message to exon 24, encoding the natural polyadenylation signal. Homologous recombination within ES cells was detected by Southern blotting with a genomic DNA probe from the 3' end of the Stat2 gene outside the region of recombination (Fig. 1C). Generation of chimeric m/h Stat2 KI mice was performed by injection of targeted ES cells into C57BL/6 blastocysts and implantation into pseudopregnant females. Germline transmission was confirmed for three highly chimeric founders. Offspring were routinely monitored for the presence of the KI allele by genomic PCR analysis (Fig. 1D).



View larger version (63K):
[in this window]
[in a new window]
 
FIGURE 1. Generation of m/h Stat2 KI mice. A, A chimeric m/h Stat2 molecule spliced just past the SH2 domain restores IFN-{alpha}{beta}-dependent STAT4 activation in human cells ( 19 ) and is the basis for the KI targeting construct. B, The divergence between the murine and human sequences begins within exon 23. The targeting construct replaces this sequence with the human counterpart that contains the natural stop codon. The intron/exon structure is maintained following Cre-mediated deletion of the neor cassette that is flanked by loxP sites. C, Genomic DNAs from progeny (lanes 3–5) were probed with a segment of exon 24 resulting in a 14-kb band for the wild-type (WT) allele and a 4.5-kb band for the KI allele. D, Genomic DNAs from progeny (lanes 7–14) were amplified with one sense primer and two antisense primers resulting in a 850-bp band corresponding to the wild-type allele (lane 4) and 250- and 900-bp bands corresponding to the KI allele (lanes 5–6; see B).

 
Both heterozygous and homozygous m/h Stat2 KI mice were fertile, produced normal-sized litters, and were of normal size and weight. Lymphocyte analysis of thymus, mesenteric lymph nodes, and spleen revealed a normal complement of CD4+ and CD8+ cells, indicating that T cell development was unaltered by the Stat2 modification (data not shown). Additionally, we found that splenic B cells (B220+) and monocytes (CD11b+) were also normal in m/h Stat2 KI mice (data not shown).

The chimeric m/h STAT2 molecule is expressed and functional in murine CD4+ T cells

Our previous studies demonstrated that both the full-length murine STAT2 and the m/h STAT2 chimeric molecules could be recruited and activated by the hIFNAR ( 19). However, it is possible that activation of murine STAT2 by the mIFNAR requires specific sequences within the murine STAT2 molecule that would be abolished by the expression of the chimeric m/h STAT2. Thus, two criteria must be met before IFN-{alpha}{beta}-dependent STAT4 activation can be assessed: the m/h STAT2 molecule must be 1) expressed in CD4+ T cells and 2) activated by the mIFNAR. Northern blot analysis of RNA isolated from purified CD4+ T cells demonstrated a gene-dose-dependent expression of murine Stat2 in the wild-type and m/h Stat2 heterozygous backgrounds that hybridized with a probe specific for the murine Stat2 C terminus (Fig. 2A, upper panel). This probe contained a 20-nt overlap of sequence within the C terminus that is not divergent between mouse and human, and explains the low degree of hybridization seen in the homozygous KI (Fig. 2A, upper panel, lane 3). Furthermore, a probe from the C terminus of human Stat2 hybridized to a band corresponding to the m/h Stat2 mRNA in both heterozygous and homozygous KI T cells (Fig. 2A, middle panel).



View larger version (53K):
[in this window]
[in a new window]
 
FIGURE 2. Expression and activation of the m/h STAT2 chimeric molecule. A, Total RNA isolated from wild-type, m/h Stat2 heterozygous, and homozygous splenocytes, and human Hut78 cells were probed with cDNA corresponding to the murine STAT2 C terminus (top panel), the human STAT2 C terminus (middle panel), and GAPDH (bottom panel). B, Whole-cell lysates from wild-type, and m/h Stat2 KI homozygous splenocytes were probed with an anti-STAT2 Ab specific for the C terminus of human STAT2 and an anti-STAT1 polyclonal Ab. C, Whole-cell lysates from wild-type and m/h Stat2 heterozygous splenocytes were immunoprecipitated with an anti-STAT2 Ab specific for the C terminus of human STAT2. The resulting blot was probed with the same anti-STAT2 Ab. D, Enriched CD4+ T cells from wild-type, heterozygous and homozygous m/h Stat2 KI mice were activated for 30 min with rmIFN-{alpha} (A) (1000 U/ml). Nuclear extracts from activated cells were incubated with a 32P-labeled IFN-stimulated regulatory element probe in the presence or absence of an anti-STAT2 Ab specific for the human C terminus.

 
The m/h Stat2 mRNA was translated into a protein of the correct molecular mass and was recognized by an anti-STAT2 Ab specific for the C terminus of human STAT2 (Fig. 2, B and C). In addition, this Ab was also capable of specifically immunoprecipitating the chimeric m/h STAT2 molecule from CD4+ T cell lysates. A previous report of the STAT2 knockout demonstrated that ablation of STAT2 dramatically decreased the expression of other STAT molecules, including STAT1. However, the m/h STAT2 molecule described in this study did not alter expression of STAT1 in murine T cells (Fig. 2B).

IFN-{alpha}{beta}-mediated STAT2 phosphorylation is accompanied by concomitant phosphorylation of STAT1 and the assembly of the ISGF3 complex containing a heterotrimer of STAT1, STAT2, and IFN regulatory factor 9 ( 28). We detected the formation of this complex in murine T cells by EMSA. ISGF3 was induced by murine IFN-{alpha} (A) in both wild-type and m/h Stat2 KI T cells (Fig. 2D). Furthermore, a supershift complex was identified in heterozygous and homozygous KI T cells by incubation of nuclear extracts with an anti-STAT2 Ab specific for the human STAT2 C terminus. Collectively, these data demonstrate that the chimeric m/h Stat2 gene is expressed and translated into protein in murine T cells. Furthermore, the chimeric m/h STAT2 molecule is functionally activated by the mIFNAR and capable of binding DNA.

Expression of m/h STAT2 is not sufficient to restore IFN-{alpha}{beta}-dependent Th1 development

Commitment of CD4+ T cells to high levels of IFN-{gamma} secretion occurs, in part, by a STAT4-dependent process ( 29). As a first step in measuring the reconstitution of IFN-{alpha}{beta}-dependent signaling for Th1 development, we crossed the m/h Stat2 KI to the DO11.10 TCR (TCR) transgenic on the BALB/c background ( 25). In these mice, the majority of T cells are selected by I-Ad and respond to a single peptide derived from the chicken OVA protein. Thus, in vitro T cell cultures from these mice can be activated by a single Ag (OVA peptide) under well-defined cytokine conditions. To assess developmental commitment to the Th1 phenotype, lymph node and splenic T cells were activated with OVA peptide and IL-2 in the absence or presence of specific cytokines and/or anti-cytokine Abs for 3 days. Cells were split into new medium containing IL-2 for an additional 4 days before restimulation and cytokine measurements. As expected, primary activation of cells under typical Th1-inducing conditions ({alpha}-IL-4 plus IL-12) led to robust IFN-{gamma} secretion upon secondary activation of cells with either PMA/ionomycin (Fig. 3A, condition no. 2), or with plate-bound anti-CD3 (B). Activation with rmIFN-{alpha} (A) (Fig. 3, A and B, condition no. 3) induced a 2- to 4-fold increase in the percentage of cells capable of producing IFN-{gamma} when compared with cells developing under neutralizing conditions (Fig. 3, A and B, condition no. 1). Although rmIFN-{alpha} (A) (specific activation of murine cells) was more active than rhIFN-{alpha} (A/D) (active on both murine and human cells) at promoting some cells to commit to IFN-{gamma} secretion, the induction of Th1 development relative to the effects of IL-12 was very low. However, similar levels of IFN-{gamma} secretion were observed in wild-type and m/h Stat2 KI T cells regardless of primary stimulation conditions.



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 3. IFN-{alpha} does not induce Th1 development in m/h Stat2 KI CD4+ T cells. DO11.10+ splenocytes and lymph nodes from wild-type, heterozygous and homozygous m/h Stat2 KI mice were stimulated with OVA peptide and the indicated anti-cytokine Abs or cytokines. A and B, Cells were restimulated with PMA/ionomycin (A) or plate-bound anti-CD3 (B) and analyzed for IFN-{gamma} expression by intracellular staining and flow cytometry. Live cells were gated on CD4+ T cells. C and D, DO11.10+ splenocytes and lymph nodes from wild-type, homozygous m/h Stat2 KI, and IL-12p40–/– mice were stimulated with OVA peptide in the presence of anti-IL-12 (Control), IL-12 (10 U/ml), or with anti-IL-12 and increasing concentrations of rmIFN-{alpha} (A) as indicated in the figure. Cells were restimulated for 4 h (C) or 24 h (D) on day 7, and IFN-{gamma} expression was measured on by intracellular cytokine staining (C) and ELISA (D). Each experimental point was performed in triplicate, and the data are representative of three independent experiments.

 
Recent studies have suggested that murine T cells have the capacity to respond to IFN-{alpha}{beta} for IFN-{gamma} production ( 16, 17, 18). However, in some cases, those experiments were performed with relatively high concentrations of IFN-{alpha} (50,000–100,000 U/ml) compared with the levels normally used to assess human T cell differentiation (500–1,000 U/ml). Based on these observations, wild-type and m/h Stat2 KI T cells were tested for their ability to commit to Th1 development in response to increasing concentrations of IFN-{alpha}. In this study, T cell cultures were activated in the presence of anti-IL-12 (Tosh) ( 30) and increasing concentrations of rmIFN-{alpha} (A) ranging from 100 to 100,000 U/ml (see Fig. 5, C and D). In contrast to previous studies, we found no difference in the levels of IFN-{gamma} secreted upon secondary activation when comparing cells activated under neutralizing conditions (anti-IL-12) and cells activated with IFN-{alpha} at any concentration. In addition, there were no significant differences in the percentage of cells capable of secreting IFN-{gamma} between wild-type and m/h Stat2 KI T cells. The overall quantity of IFN-{gamma} secreted by cells polarized in the presence of increasing concentrations of rmIFN-{alpha} (A) was confirmed by ELISAs (Fig. 3D) and further demonstrated that IFN-{alpha} failed to promote Th1 polarization in m/h Stat2 KI T cells.



View larger version (78K):
[in this window]
[in a new window]
 
FIGURE 5. The C terminus of hSTAT2 is not sufficient to restore IFN-{alpha}-dependent STAT4 tyrosine phosphorylation in murine CD4+ T cells. DO11.10+ lymph node and spleen cells from wild-type (lanes 1–3) and m/h Stat2 KI (lanes 4–6) mice were stimulated with OVA peptide in Th1-inducing conditions (anti-IL-4, IFN-{gamma}, and IL-12) for 3 days and split 1:8 in medium containing IL-2. On day 7, cells were washed and restimulated for 30 min at 37°C with either medium alone (lanes 1 and 4), or with medium containing IL-12 (10 ng/ml; lanes 2 and 5) or with rmIFN-{alpha} (A) (1000 U/ml; lanes 3 and 6). Cell lysates were prepared and immunoprecipitated with anti-STAT4 (SC-486) and anti-STAT1 (SC-346; Santa Cruz) polyclonal Abs. Immunoprecipitates were immunoblotted for both phosphotyrosine (P-Y; RC20) and for STAT4 and STAT1 as indicated in the figure.

 
In addition to the developmental effects exerted by STAT4 activation, an additional STAT4-dependent pathway regulates acute induction of IFN-{gamma} gene transcription within fully differentiated Th1 cells. Combinatorial treatment of Th1 cells with IL-12 plus IL-18 induces sustained levels of IFN-{gamma} secretion in the absence of TCR activation ( 31, 32). This dual signaling pathway is dependent upon STAT4 activation and is conserved between murine and human Th1 cells ( 14, 33). In human Th1 cells, IFN-{alpha} plus IL-18 also induce acute IFN-{gamma} secretion, in part, due to the activation of STAT4 ( 33). Although the m/h STAT2 molecule failed to mediate IFN-{alpha}{beta}-dependent Th1 development, it was possible that the acute pathway for IFN-{gamma} gene expression in fully differentiated Th1 cells was restored by this genetic modification. This hypothesis was tested by activating DO11.10+ T cells from wild-type and m/h Stat2 KI mice in the presence of IL-12 for 7 days to promote Th1 development. These cells were then restimulated in the presence of either IL-12 plus IL-18 or with rmIFN-{alpha} (A) plus IL-18 for 24 h (Fig. 4). Consistent with our prior results, we found that dual stimulation with IFN-{alpha} plus IL-18 did not promote IFN-{gamma} secretion from either wild-type or m/h Stat2 KI T cells.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 4. IFN-{alpha} does not synergize with IL-18 to induce IFN-{gamma} secretion in m/h Stat2 KI CD4+ T cells. DO11.10+ splenocytes and lymph node cells from wild-type, heterozygous and homozygous m/h Stat2 KI mice were stimulated with OVA peptide under Th1-inducing conditions (IL-12 plus IFN-{gamma} plus anti-IL-4) for 3 days and rested in medium containing IL-2 until day 7. Cells were restimulated as indicated in the figure and analyzed for IFN-{gamma} secretion by intracellular staining and flow cytometry. Live cells were gated on CD4+ T cells.

 
The C terminus of human STAT2 is not sufficient to mediate IFN-{alpha}{beta}-dependent STAT4 activation

In human cells, species-specific determinants within the human STAT2 C terminus were necessary for recruiting STAT4 to the hIFNAR ( 19). To test the sufficiency of this domain in recruiting STAT4 to the mIFNAR, we assessed STAT4 phosphorylation in wild-type and m/h Stat2 KI T cells. DO11.10+ T cells were activated with OVA peptide and IL-12 for 7 days to generate cells that could respond to subsequent activation with IL-12 as a positive control. Resting Th1 cells were restimulated with either medium alone, IL-12, or with rmIFN-{alpha} (A). STAT4 and STAT1 tyrosine phosphorylation was determined by immunoblotting (Fig. 5). IL-12 was active in both wild-type and KI Th1 cells to promote STAT4 phosphorylation; however, rmIFN-{alpha} did not exhibit such activity. The failure of IFN-{alpha} to activate STAT4 was not due to a general lack of IFNAR activation, because STAT1 was robustly phosphorylated in both wild-type and KI T cells (Fig. 5, lower panel). Furthermore, previous studies with both human and murine STAT2-deficient cells demonstrated that STAT1 activation is dependent upon the presence of a functional STAT2 molecule ( 22, 34, 35). Thus, we conclude that the chimeric m/h STAT2 molecule is functional to recruit and activate STAT1, but not STAT4, in murine T cells. Taken together, this study demonstrates that, although sequences within the C terminus of STAT2 are required in human cells, this domain is not sufficient to promote STAT4 recruitment and activation by the mIFNAR.

IFN-{alpha} fails to promote IFN-{gamma} secretion in murine CD8+ T cells

A recent report has suggested that IFN-{alpha}{beta} can promote STAT4 phosphorylation and IFN-{gamma} secretion from murine T cells in a murine model of lymphocytic choriomeningitis virus infection ( 16). However, their system relied primarily on the secretion of IFN-{gamma} by CD8+ T cells. Thus, it was possible that IFN-{alpha} signaling for IFN-{gamma} secretion was more efficient in murine CD8+ than in CD4+ T cells. Based on those results, we wished to determine whether IFN-{alpha}-driven IFN-{gamma} secretion was more efficient in murine CD8+ cells that expressed the m/h STAT2 chimeric molecule. Unlike CD4+ T cells, murine CD8+ T cells do not require STAT4 signaling to become competent to secrete high levels of IFN-{gamma} upon restimulation through the TCR ( 29). However, acute IL-12/IL-18-mediated IFN-{gamma} secretion from CD8+ T cells remains dependent upon STAT4 activation. Thus, for these experiments, CD8+ T cells were purified from wild-type and m/h Stat2 KI mice (on 129/SvJ background) by flow-cytometric sorting. Cells were activated with irradiated allogeneic BALB/c splenocytes in the presence of Con A for 3 days followed by dilution in medium containing additional IL-2 and rested to day 7. CD8+ T cells were then washed extensively, restimulated with recombinant cytokines, and analyzed for IFN-{gamma} secretion by both intracellular cytokine staining (Fig. 6A) and ELISA (B).



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 6. IFN-{alpha} does not synergize with IL-18 to induce IFN-{gamma} secretion in m/h Stat2 KI CD8+ T cells. CD8+ T cells were purified by flow-cytometric sorting from lymph nodes of wild-type and m/h Stat2 KI mice (on 129/SvJ background). Cells were stimulated with Con A (5 µg/ml) in the presence of irradiated BALB/c splenocytes for 3 days and rested in medium containing IL-2 until day 7. Cells were restimulated with recombinant cytokines as indicated in the figure for 4 h (A) or 24 h (B), and IFN-{gamma} expression was determined by intracellular cytokine staining (A) and by ELISA (B).

 
Stimulation of CD8+ cells with either IL-12 or IFN-{alpha} alone did not lead to significant increases in either the percentage of cells capable of expressing IFN-{gamma} (Fig. 6A, b, d, h, and j) or accumulation of IFN-{gamma} in the culture supernatants (B), as expected. IL-18 stimulation led to a marked increase in the percentage of IFN-{gamma}-secreting cells (Fig. 6A, c and i), and this effect was enhanced by combined stimulation with IL-12 (A, e and k) but not with IFN-{alpha} (f and l). However, only IL-12 plus IL-18 activation led to a significant accumulation of IFN-{gamma} in the culture supernatants during a 24-h stimulation (Fig. 6B), indicating that the percentage of cells capable of expressing IFN-{gamma} in response to IL-18 or IL-18 plus IFN-{alpha} was transient and not sustained. Furthermore, the levels of IFN-{gamma} secreted in response to IL-18 were not significantly different from the levels observed in response to combined stimulation with IL-18 plus IFN-{alpha}. These data demonstrate that, unlike IL-12, IFN-{alpha} stimulation has no direct effect on acute induction of IFN-{gamma} gene expression in CD8+ T cells. Furthermore, we found no significant difference in either the percentage of cells capable of expressing IFN-{gamma} or the accumulation of IFN-{gamma} within the culture supernatants of wild-type vs m/h Stat2 KI CD8+ cells responding to IFN-{alpha} stimulation.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A central role for STAT4 in promoting Th1 development and type I responses in vivo has been demonstrated directly in Stat4-deficient mice ( 6, 7) as well as in other genetic backgrounds that influence STAT4 activation such as IL-12R knockouts ( 36, 37). Early evidence of species-specific IFN-{alpha}{beta}-induced STAT4 activation ( 11, 12, 23, 38) correlated well with the known biological responses when comparing mouse and human T cells. Collectively, these correlations predict that any receptor, including the IFNAR, that can activate STAT4 within CD4+ T cells would have the capacity to drive IFN-{gamma} gene expression in both mouse and human T cells. STAT4 activation by the hIFNAR involves the presence of activated STAT2 ( 11), and this interaction maps to a nonconserved region within the STAT2 C terminus ( 19). In this study, we demonstrated that, although this sequence within STAT2 is required to recruit and activate STAT4 within human cells, it is not sufficient to promote STAT4 phosphorylation or Th1 commitment within murine CD4+ T cells.

In our initial studies of the hIFNAR, we considered the possibility that STAT4 was recruited directly to the IFNAR via interactions with the cytoplasmic domain of the receptor subunits ( 11). Indeed, neither the IFNAR1 nor -R2 subunits are well conserved between mouse and human. However, we demonstrated that STAT4 did not interact with any potential phosphotyrosine residues within either the hIFNAR1 or -R2 subunit by a phosphopeptide competition EMSA assay ( 11). Recently, several studies have demonstrated a unique requirement for STAT N-terminal domains that regulate receptor-proximal activation. For example, in human cells, the STAT2 N-domain mediates a direct interaction with the IFNAR2 cytoplasmic domain, and this interaction is formed before cytokine activation ( 39). This preassociated complex facilitates cytokine-mediated phosphorylation of STAT2.

An analogous mechanism might be operative for STAT4. First, several reports have demonstrated that the STAT4 N-domain is required for efficient phosphorylation in response to both IL-12 and IFN-{alpha} ( 40, 41, 42). Indeed, transgenic expression of STAT4 lacking the N-domain fails to reconstitute IL-12-driven STAT4 phosphorylation or Th1 development when crossed to the STAT4-deficient background ( 42). Crystallographic data have demonstrated that the STAT4 N-domain exists as a latent dimer through homotypic interaction ( 43). Although this structure has been re-evaluated ( 41, 44), the existence and purpose of this latent STAT4 dimer in cytokine-driven phosphorylation has been recently examined. In this study, instead of completely removing the N-domain from the primary STAT4 sequence, specific residues that mediate N-domain dimer formation were mutated and expressed within both human fibroblasts and murine Stat4-deficient T cells ( 41). These experiments revealed that mutation of these critical N-domain residues abrogated STAT4 phosphorylation in response to both IFN-{alpha} (in human fibroblasts) and IL-12 (in murine T cells), suggesting a common mechanism for recruitment of STAT4 to both the IL-12R and the hIFNAR. Whether STAT4, like STAT2, preassociates with either the IL-12R or the hIFNAR has not been reported yet. However, due to the significant sequence divergence within both the IFNAR1 and -R2 subunits between mouse and human, it is expected that the conserved STAT4 N-domain would interact in a species-specific manner with the cytoplasmic domain of the hIFNAR. If this is the case, then the hIFNAR cytoplasmic domain would represent a second species-specific component necessary for the recruitment and activation of STAT4. Furthermore, this possibility would also explain why the modification of STAT2 described here was not sufficient to activate STAT4 by the mIFNAR in murine CD4+ T cells.

In contrast to our initial characterization of the species-specific link between IFN-{alpha}{beta} signaling and STAT4 activation, recent reports have suggested that IFN-{alpha}{beta} can activate STAT4 and promote IFN-{gamma} expression in murine T cells ( 16, 17). These studies used relatively high concentrations of IFN-{alpha} to detect this effect. Based on this observation, we considered the possibility that, although the mIFNAR was inefficient at activating STAT4, this effect could be overcome by titrating IFN-{alpha} to very high concentrations. However, we found that wild-type, m/h Stat2 KI, and IL-12p40-deficient CD4+ T cells did not secrete significant levels of IFN-{gamma} when activated in the presence of rmIFN-{alpha} (A) at any concentration (up to 100,000 U/ml; Fig. 3, C and D). It has been suggested that the use of different IFN-{alpha} subtypes could account for this discrepancy. However, Berenson et al. ( 45) recently demonstrated that, although mIFN-{alpha} (A) was more active than rhIFN-{alpha} (A/D) at promoting weak STAT4 phosphorylation (as observed by Nguyen et al. ( 16)), neither of these IFN-{alpha} subtypes was able to induce Th1 commitment within CD4+ T cells, and the present study confirms this observation. In addition, Nguyen et al. ( 16) reported elevated STAT4 phosphorylation in response to IFN-{alpha}{beta} in murine CD8+ cells compared with enriched CD4+ T cells. Although a STAT4-dependent, IL-12-independent mechanism for commitment to IFN-{gamma} secretion exists for CD8+ T cells ( 29), we found no evidence that CD8+ T cells could secrete IFN-{gamma} in response to acute stimulation with IFN-{alpha} in either the absence or presence of IL-18. Thus, based on our present findings, we conclude that IFN-{alpha} does not promote efficient STAT4 phosphorylation or IFN-{gamma} expression in murine T cells even in the presence of a humanized STAT2 molecule. A direct comparison of IFN-{alpha}{beta}-dependent STAT4 phosphorylation ( 11, 12) and Th1 development ( 12) between mouse and human CD4+ T cells has been described in detail, and forms the basis of the present study. However, given the recent controversy using different in vivo and in vitro model systems, this issue clearly warrants further study.


    Acknowledgments
 
We thank Erik Geissal and Loderick Matthews for excellent technical assistance, Alec Cheng and Barry Sleckman for help with ES cell targeting, Michael White for blastocyst injections, and Angela Mobley for assistance with flow cytometry. We thank Theresa Murphy, Douglas Tyler, Ann Davis, and Nishant Sahni for helpful discussions, and Christoph Wülfing and Lora Hooper for critically reading the manuscript.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by grants from Howard Hughes Medical Institute and the National Institutes of Health awarded to K.M.M., and by a grant from the Leukemia and Lymphoma Society and start-up funds from Howard Hughes Medical Institute awarded to J.D.F. Back

2 Address correspondence and reprint requests to Dr. J. David Farrar, Center for Immunology, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, TX 75390-9093. E-mail address: David.Farrar{at}UTSouthwestern.edu Back

3 Abbreviations used in this paper: m, murine; h, human; KI, knockin; IFNAR, IFN-{alpha}{beta}R; SH2, Src homology 2; ES cell, embryonic stem cell; ISGF3, IFN-sensitive gene factor-3. Back

Received for publication April 16, 2004. Accepted for publication October 26, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Murphy, K. M., W. Ouyang, J. D. Farrar, J. Yang, S. Ranganath, H. Asnagli, M. Afkarian, T. L. Murphy. 2000. Signaling and transcription in T helper development. Annu. Rev. Immunol. 18:451.[Medline]
  2. Moser, M., K. M. Murphy. 2000. Dendritic cell regulation of TH1-TH2 development. Nat. Immunol. 1:199.[Medline]
  3. Szabo, S. J., B. M. Sullivan, S. L. Peng, L. H. Glimcher. 2003. Molecular mechanisms regulating Th1 immune responses. Annu. Rev. Immunol. 21:713.[Medline]
  4. Reis e Sousa, C., A. Sher, P. Kaye. 1999. The role of dendritic cells in the induction and regulation of immunity to microbial infection. Curr. Opin. Immunol. 11:392.[Medline]
  5. Hsieh, C. S., S. E. Macatonia, C. S. Tripp, S. F. Wolf, A. O’Garra, K. M. Murphy. 1993. Development of TH1 CD4+ T cells through IL-12 produced by Listeria-induced macrophages. Science 260:547.[Abstract/Free Full Text]
  6. Thierfelder, W. E., J. M. van Deursen, K. Yamamoto, R. A. Tripp, S. R. Sarawar, R. T. Carson, M. Y. Sangster, D. A. Vignali, P. C. Doherty, G. C. Grosveld, J. N. Ihle. 1996. Requirement for Stat4 in interleukin-12-mediated responses of natural killer and T cells. Nature 382:171.[Medline]
  7. Kaplan, M. H., Y. L. Sun, T. Hoey, M. J. Grusby. 1996. Impaired IL-12 responses and enhanced development of Th2 cells in Stat4-deficient mice. Nature 382:174.[Medline]
  8. Jacobson, N. G., S. J. Szabo, R. M. Weber-Nordt, Z. Zhong, R. D. Schreiber, J. E. Darnell, Jr, K. M. Murphy. 1995. Interleukin 12 signaling in T helper type 1 (Th1) cells involves tyrosine phosphorylation of signal transducer and activator of transcription (Stat)3 and Stat4. J. Exp. Med. 181:1755.[Abstract/Free Full Text]
  9. Bacon, C. M., E. F. Petricoin, III, J. R. Ortaldo, R. C. Rees, A. C. Larner, J. A. Johnston, J. J. O’Shea. 1995. Interleukin 12 induces tyrosine phosphorylation and activation of STAT4 in human lymphocytes. Proc. Natl. Acad. Sci. USA 92:7307.[Abstract/Free Full Text]
  10. Cho, S. S., C. M. Bacon, C. Sudarshan, R. C. Rees, D. Finbloom, R. Pine, J. J. O’Shea. 1996. Activation of STAT4 by IL-12 and IFN-{alpha}: evidence for the involvement of ligand-induced tyrosine and serine phosphorylation. J. Immunol. 157:4781.[Abstract]
  11. Farrar, J. D., J. D. Smith, T. L. Murphy, K. M. Murphy. 2000. Recruitment of Stat4 to the human interferon-{alpha}/{beta} receptor requires activated Stat2. J. Biol. Chem. 275:2693.[Abstract/Free Full Text]
  12. Rogge, L., D. D’Ambrosio, M. Biffi, G. Penna, L. J. Minetti, D. H. Presky, L. Adorini, F. Sinigaglia. 1998. The role of Stat4 in species-specific regulation of Th cell development by type I IFNs. J. Immunol. 161:6567.[Abstract/Free Full Text]
  13. Parronchi, P., M. De Carli, R. Manetti, C. Simonelli, S. Sampognaro, M. P. Piccinni, D. Macchia, E. Maggi, G. Del Prete, S. Romagnani. 1992. IL-4 and IFN ({alpha} and {gamma}) exert opposite regulatory effects on the development of cytolytic potential by Th1 or Th2 human T cell clones. J. Immunol. 149:2977.[Abstract]
  14. Sareneva, T., S. Matikainen, M. Kurimoto, I. Julkunen. 1998. Influenza A virus-induced IFN-{alpha}/{beta} and IL-18 synergistically enhance IFN-{gamma} gene expression in human T cells. J. Immunol. 160:6032.[Abstract/Free Full Text]
  15. Brinkmann, V., T. Geiger, S. Alkan, C. H. Heusser. 1993. Interferon-{alpha} increases the frequency of interferon-{gamma}-producing human CD4+ T cells. J. Exp. Med. 178:1655.[Abstract/Free Full Text]
  16. Nguyen, K. B., W. T. Watford, R. Salomon, S. R. Hofmann, G. C. Pien, A. Morinobu, M. Gadina, J. J. O’Shea, C. A. Biron. 2002. Critical role for STAT4 activation by type 1 interferons in the interferon-{gamma} response to viral infection. Science 297:2063.[Abstract/Free Full Text]
  17. Freudenberg, M. A., T. Merlin, C. Kalis, Y. Chvatchko, H. Stubig, C. Galanos. 2002. Cutting edge: a murine, IL-12-independent pathway of IFN-{gamma} induction by Gram-negative bacteria based on STAT4 activation by type I IFN and IL-18 signaling. J. Immunol. 169:1665.[Abstract/Free Full Text]
  18. Wang, J., N. Pham-Mitchell, C. Schindler, I. L. Campbell. 2003. Dysregulated Sonic hedgehog signaling and medulloblastoma consequent to IFN-{alpha}-stimulated STAT2-independent production of IFN-{gamma} in the brain. J. Clin. Invest. 112:535.[Medline]
  19. Farrar, J. D., J. D. Smith, T. L. Murphy, S. Leung, G. R. Stark, K. M. Murphy. 2000. Selective loss of type I interferon-induced STAT4 activation caused by a minisatellite insertion in mouse Stat2. Nat. Immunol. 1:65.[Medline]
  20. Farrar, J. D., K. M. Murphy. 2000. Type I interferons and T helper development. Immunol. Today 21:484.[Medline]
  21. Yan, H., K. Krishnan, A. C. Greenlund, S. Gupta, J. T. Lim, R. D. Schreiber, C. W. Schindler, J. J. Krolewski. 1996. Phosphorylated interferon-{alpha} receptor 1 subunit (IFNaR1) acts as a docking site for the latent form of the 113 kDa STAT2 protein. EMBO J. 15:1064.[Medline]
  22. Qureshi, S. A., S. Leung, I. M. Kerr, G. R. Stark, J. E. Darnell, Jr. 1996. Function of Stat2 protein in transcriptional activation by {alpha}-interferon. Mol. Cell. Biol. 16:288.[Abstract]
  23. Wenner, C. A., M. L. Guler, S. E. Macatonia, A. O’Garra, K. M. Murphy. 1996. Roles of IFN-{gamma} and IFN-{alpha} in IL-12-induced T helper cell-1 development. J. Immunol. 156:1442.[Abstract]
  24. Magram, J., S. E. Connaughton, R. R. Warrier, D. M. Carvajal, C. Y. Wu, J. Ferrante, C. Stewart, U. Sarmiento, D. A. Faherty, M. K. Gately. 1996. IL-12-deficient mice are defective in IFN-{gamma} production and type 1 cytokine responses. Immunity 4:471.[Medline]
  25. Murphy, K. M., A. B. Heimberger, D. Y. Loh. 1990. Induction by antigen of intrathymic apoptosis of CD4+CD8+TCRlo thymocytes in vivo. Science 250:1720.[Abstract/Free Full Text]
  26. Hug, B. A., R. L. Wesselschmidt, S. Fiering, M. A. Bender, E. Epner, M. Groudine, T. J. Ley. 1996. Analysis of mice containing a targeted deletion of {beta}-globin locus control region 5' hypersensitive site 3. Mol. Cell. Biol. 16:2906.[Abstract]
  27. Hsieh, C. S., A. B. Heimberger, J. S. Gold, A. O’Garra, K. M. Murphy. 1992. Differential regulation of T helper phenotype development by interleukins 4 and 10 in an {alpha}{beta} T-cell-receptor transgenic system. Proc. Natl. Acad. Sci. USA 89:6065.[Abstract/Free Full Text]
  28. Qureshi, S. A., M. Salditt-Georgieff, J. E. Darnell, Jr. 1995. Tyrosine-phosphorylated Stat1 and Stat2 plus a 48-kDa protein all contact DNA in forming interferon-stimulated-gene factor 3. Proc. Natl. Acad. Sci. USA 92:3829.[Abstract/Free Full Text]
  29. Carter, L. L., K. M. Murphy. 1999. Lineage-specific requirement for signal transducer and activator of transcription (Stat)4 in interferon {gamma} production from CD4+ versus CD8+ T cells. J. Exp. Med. 189:1355.[Abstract/Free Full Text]
  30. Tripp, C. S., M. K. Gately, J. Hakimi, P. Ling, E. R. Unanue. 1994. Neutralization of IL-12 decreases resistance to Listeria in SCID and C.B-17 mice: reversal by IFN-{gamma}. J. Immunol. 152:1883.[Abstract]
  31. Robinson, D., K. Shibuya, A. Mui, F. Zonin, E. Murphy, T. Sana, S. B. Hartley, S. Menon, R. Kastelein, F. Bazan, A. O’Garra. 1997. IGIF does not drive Th1 development but synergizes with IL-12 for interferon-{gamma} production and activates IRAK and NF{kappa}B. Immunity 7:571.[Medline]
  32. Yang, J., T. L. Murphy, W. Ouyang, K. M. Murphy. 1999. Induction of interferon-{gamma} production in Th1 CD4+ T cells: evidence for two distinct pathways for promoter activation. Eur. J. Immunol. 29:548.[Medline]
  33. Matikainen, S., A. Paananen, M. Miettinen, M. Kurimoto, T. Timonen, I. Julkunen, T. Sareneva. 2001. IFN-{alpha} and IL-18 synergistically enhance IFN-{gamma} production in human NK cells: differential regulation of Stat4 activation and IFN-{gamma} gene expression by IFN-{alpha} and IL-12. Eur. J. Immunol. 31:2236.[Medline]
  34. Park, C., S. Li, E. Cha, C. Schindler. 2000. Immune response in Stat2 knockout mice. Immunity 13:795.[Medline]
  35. Leung, S., S. A. Qureshi, I. M. Kerr, J. E. Darnell, Jr, G. R. Stark. 1995. Role of STAT2 in the {alpha} interferon signaling pathway. Mol. Cell. Biol. 15:1312.[Abstract]
  36. Wu, C., J. Ferrante, M. K. Gately, J. Magram. 1997. Characterization of IL-12 receptor {beta}1 chain (IL-12R{beta}1)-deficient mice: IL-12R{beta}1 is an essential component of the functional mouse IL-12 receptor. J. Immunol. 159:1658.[Abstract]
  37. Wu, C., X. Wang, M. Gadina, J. J. O’Shea, D. H. Presky, J. Magram. 2000. IL-12 receptor {beta}2 (IL-12R{beta}2)-deficient mice are defective in IL-12-mediated signaling despite the presence of high affinity IL-12 binding sites. J. Immunol. 165:6221.[Abstract/Free Full Text]
  38. Rogge, L., L. Barberis-Maino, M. Biffi, N. Passini, D. H. Presky, U. Gubler, F. Sinigaglia. 1997. Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J. Exp. Med. 185:825.[Abstract/Free Full Text]
  39. Li, X., S. Leung, I. M. Kerr, G. R. Stark. 1997. Functional subdomains of STAT2 required for preassociation with the {alpha} interferon receptor and for signaling. Mol. Cell. Biol. 17:2048.[Abstract]
  40. Murphy, T. L., E. D. Geissal, J. D. Farrar, K. M. Murphy. 2000. Role of the Stat4 N domain in receptor proximal tyrosine phosphorylation. Mol. Cell. Biol. 20:7121.[Abstract/Free Full Text]
  41. Ota, N., T. J. Brett, T. L. Murphy, D. H. Fremont, K. M. Murphy. 2004. N-domain-dependent nonphosphorylated STAT4 dimers required for cytokine-driven activation. Nat. Immunol. 5:208.[Medline]
  42. Chang, H. C., S. Zhang, I. Oldham, L. Naeger, T. Hoey, M. H. Kaplan. 2003. STAT4 requires the N-terminal domain for efficient phosphorylation. J. Biol. Chem. 278:32471.[Abstract/Free Full Text]
  43. Vinkemeier, U., I. Moarefi, J. E. Darnell, Jr, J. Kuriyan. 1998. Structure of the amino-terminal protein interaction domain of STAT-4. Science 279:1048.[Abstract/Free Full Text]
  44. Chen, X., R. Bhandari, U. Vinkemeier, F. Van Den Akker, J. E. Darnell, Jr, J. Kuriyan. 2003. A reinterpretation of the dimerization interface of the N-terminal domains of STATs. Protein Sci. 12:361.[Medline]
  45. Berenson, L. S., J. D. Farrar, T. L. Murphy, K. M. Murphy. 2004. Frontline: absence of functional STAT4 activation despite detectable tyrosine phosphorylation induced by murine IFN-{alpha}. Eur. J. Immunol. 34:2365.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
A. M. Davis, K. A. Hagan, L. A. Matthews, G. Bajwa, M. A. Gill, M. Gale Jr., and J. D. Farrar
Blockade of Virus Infection by Human CD4+ T Cells via a Cytokine Relay Network
J. Immunol., May 15, 2008; 180(10): 6923 - 6932.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. J. Ramos, A. M. Davis, T. C. George, and J. D. Farrar
IFN-{alpha} Is Not Sufficient to Drive Th1 Development Due to Lack of Stable T-bet Expression
J. Immunol., September 15, 2007; 179(6): 3792 - 3803.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. E. Remoli, J. Ragimbeau, E. Giacomini, V. Gafa, M. Severa, R. Lande, S. Pellegrini, and E. M. Coccia
NF-{kappa}B is required for STAT-4 expression during dendritic cell maturation
J. Leukoc. Biol., January 1, 2007; 81(1): 355 - 363.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. S. Berenson, M. Gavrieli, J. D. Farrar, T. L. Murphy, and K. M. Murphy
Distinct Characteristics of Murine STAT4 Activation in Response to IL-12 and IFN-{alpha}
J. Immunol., October 15, 2006; 177(8): 5195 - 5203.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Havenar-Daughton, G. A. Kolumam, and K. Murali-Krishna
Cutting Edge: The Direct Action of Type I IFN on CD4 T Cells Is Critical for Sustaining Clonal Expansion in Response to a Viral but Not a Bacterial Infection
J. Immunol., March 15, 2006; 176(6): 3315 - 3319.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Persky, M. E.
Right arrow Articles by Farrar, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Persky, M. E.
Right arrow Articles by Farrar, J. D.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS