|
|
||||||||
, Promotes STAT4 Activation and Th1 Development in Murine CD4+ T Cells Expressing a Chimeric Murine/Human Stat2 Gene1
,
* Center for Immunology and Department of Molecular Biology, University of Texas Southwestern Medical Center, Dallas, TX 75390;
Department of Pathology and Center for Immunology, and
Howard Hughes Medical Institute, Washington University School of Medicine, St. Louis, MO 63110
| Abstract |
|---|
|
|
|---|

drives Th1 development only in human cells. This IFN-
-dependent pathway is not conserved in the mouse species due in part to a specific mutation within murine Stat2. Restoration of this pathway in murine T cells would provide the opportunity to more closely model specific human disease states that rely on CD4+ T cell responses to IFN-
. To this end, the C terminus of murine Stat2, harboring the mutation, was replaced with the corresponding human Stat2 sequence by a knockin targeting strategy within murine embryonic stem cells. Chimeric m/h Stat2 knockin mice were healthy, bred normally, and exhibited a normal lymphoid compartment. Furthermore, the murine/human STAT2 protein was expressed in murine CD4+ T cells and was activated by murine IFN-
signaling. However, the murine/human STAT2 protein was insufficient to restore full IFN-
-driven Th1 development as defined by IFN-
expression. Furthermore, IL-12, but not IFN-
, promoted acute IFN-
secretion in collaboration with IL-18 stimulation in both CD4+ and CD8+ T cells. The inability of T cells to commit to Th1 development correlated with the lack of STAT4 phosphorylation in response to IFN-
. This finding suggests that, although the C terminus of human STAT2 is required for STAT4 recruitment and activation by the human type I IFNAR (IFN-
R), it is not sufficient to restore this process through the murine IFNAR complex. | Introduction |
|---|
|
|
|---|
at sites of inflammation. Furthermore, IFN-
secreted by Th1 cells mediates the elimination of both intracellular and extracellular bacterial pathogens through the activation of granulocytes and phagocytic cells.
The importance of Th1 cells in the immune response to pathogens is highlighted by the fact that this developmental pathway is conserved in mammalian species. For CD4+ T cells, IL-12 signaling and STAT4 activation is a conserved pathway that regulates the first steps of commitment to IFN-
expression ( 6, 7, 8, 9). However, in humans, in addition to IL-12, type I IFNs (IFN-
) also signal through STAT4 ( 10, 11, 12) and promote IFN-
secretion in CD4+ T cells ( 12, 13, 14, 15). Furthermore, this pathway is not conserved and/or is not efficient in murine CD4+ T cells ( 11, 12). Although recent studies have called this observation into question ( 16, 17, 18), clearly the murine (m)3 IFN-
R (IFNAR) is inefficient at promoting Th1 development and requires extremely high concentrations of IFN-
to detect this effect in murine T cells. The lack of an experimentally tractable mouse model of IFN-
-driven Th1 development is a major barrier to understanding human immune responses to pathogens that promote IFN-
secretion, such as viruses.
Our previous studies have provided a molecular explanation for the lack of IFN-
-dependent Th1 development in mouse CD4+ T cells ( 11, 19, 20). Unlike the IL-12R, our studies of the human (h)IFNAR demonstrated that recruitment and activation of STAT4 by the hIFNAR is mediated by STAT2 ( 11). STAT2 is recruited to the hIFNAR by an Src homology 2 (SH2)-dependent interaction with phosphorylated Y466 within the hIFNAR1 subunit ( 21, 22). In contrast, although STAT4 requires an intact SH2 domain for efficient activation by the hIFNAR ( 19), it does not interact directly with any phosphorylated tyrosine residues within either the hIFNAR1 or R2 subunit ( 11). Rather, STAT4 recruitment occurs in a STAT2-dependent manner, possibly by an either direct or indirect interaction with Y833 and Y841 within the C terminus of human STAT2 ( 19). This interaction does not occur in mouse due to a significant mutation and insertion of a repetitive minisatellite sequence within the C terminus of murine STAT2. As such, murine STAT2 fails to mediate STAT4 activation by the hIFNAR. Importantly, expression of a chimeric m/h STAT2 molecule, whereby the C terminus of the murine sequence has been replaced with the human counterpart, restores IFN-
-dependent STAT4 phosphorylation in STAT2-deficient human fibroblasts ( 19).
Based on these results and the lack of IFN-
-dependent Th1 responses observed in murine CD4+ T cells ( 12, 23), we proposed that mice and humans might respond differently to pathogens such as viruses that primarily evoke IFN-
secretion, as opposed to IL-12, from innate cells ( 20). A definitive test of this hypothesis involves reconstructing the IFN-
pathway to activate STAT4 in murine T cells. As a first step, we report here the development of a chimeric m/h Stat2 knockin (KI) mouse. The exon encoding the murine STAT2 C terminus, exon 23, was replaced with the corresponding human sequence by a targeted mutation of murine embryonic stem (ES) cells. Surprisingly, and in contrast to recent reports, we found that murine CD4+ T cells from m/h Stat2 KI mice were not able to activate STAT4 or commit to IFN-
expression in response to mIFN-
, even at extremely high concentrations of the cytokine. These results would suggest that an additional species-specific component is required for the efficient recruitment of STAT4 to the mIFNAR.
| Materials and Methods |
|---|
|
|
|---|
IL-12p40/ ( 24) were purchased from The Jackson Laboratory and backcrossed five generations onto the DO11.10 TCR transgenic (BALB/c background) ( 25).
Generation of m/h Stat2 KI mice
A 129/SvJ bacterial artificial chromosome clone harboring the murine Stat2 gene was obtained by screening a bacterial artificial chromosome library with a probe generated from the 5' end of the murine Stat2 cDNA (Genome Systems). A 20-kb fragment of the 3' region of murine Stat2 was subcloned into pBluescript (Stratagene) and extensively characterized by restriction mapping and sequencing. The 5' region of the targeting construct was assembled with three segments that included the replacement of exon 23 sequence with the corresponding human Stat2 C terminus sequence. A 4-kb HindIII/AflII genomic fragment was cloned upstream of a 450-bp AflII/BamHI-digested human Stat2 PCR fragment that was amplified with primers 5'-GCTGCAGCAGCCTCTGGAGCTTAAGCAGGATTCAGA and 3'-ACTGTCGGGATCCGGTTCCTAGAAGTCAGAAGGCATCAAGGGTCC. The fusion of these two fragments at the AflII site maintained the correct reading frame of exon 23. A 150-bp BglII-digested PCR fragment from the exon/intron junction of exon 23 was amplified with primers 5'-GCCTGAGATCTTGCAGCAGATTAGCGTGGAGG and 3'-GATGAAGGAGATCTTTGGGGCTCACGTTTTGGC. This exon/intron joint fragment was cloned at the 3' BamHI site at the end of the human Stat2 sequence described above, and this final 4.7-kb fragment was cloned into the XhoI site of the pLNTK targeting vector. Together, these three components created the 5' region of homologous recombination and effectively replaced the murine Stat2 C terminus with the human counterpart that included a stop codon at the end of this sequence. The remaining segment of exon 23 was preserved within this altered exon to ensure proper splicing to exon 24, which encodes the natural polyadenylation sequence. The 3' end of homologous recombination consisted of a 4-kb XhoI fragment that included the remaining segment of intron 23 through to the end of the last exon 24. This fragment was cloned into the SalI site within pLNTK.
Transfected RW-4 ES cells ( 26) were placed in selection with G418. Correctly targeted clones were identified by Southern blotting with probes derived from genomic sequence outside the regions of homologous recombination. The PGK-neor cassette was removed by transient infection of ES clones with adenovirus vector expressing Cre recombinase. ES cells were injected into C57BL/6 blastocysts and implanted into pseudopregnant Swiss Black females. Chimeric male offspring were mated to C57BL/6 females to determine germline transmission. Founders that were determined to transmit the chimeric allele were then mated to DO11.10 (BALB/c background) for five generations. In addition, a second line was maintained on the 129 background by first crossing founders to 129/SvJ followed by intercross breedings to maintain this colony. Experimental groups were generated from crosses of heterozygous KI parents to generate both homozygous KI and wild-type littermate controls. The m/h Stat2 KI allele was routinely detected by genomic PCR with primers 5'-GTGGACGAGCTGCAGCAG, 3'-ATACCATGCATAGTGTG, and 3'-CTAGTCCTCAGAAGGTATCAAGAGTCCATCCCAAGAG.
T cell cultures
Spleen and mesenteric lymph node cells from wild-type and m/h Stat2 KI x DO11.10 mice were cultured in IMDM supplemented with 10% FBS, L-glutamine (200 µM), nonessential amino acids (10 µM each), sodium pyruvate (100 µM), 2-ME (50 µM), and penicillin/streptomycin (100 U/ml each) (HyClone). CD4+ T cells were activated with OVA peptide (0.3 mM) and IL-2 (50 U/ml) under Th1 (anti-IL-4 (11B11; 10 µg/ml) and rmIL-12 (10 U/ml; R&D Systems)), Th2 (anti-IL-12 (Tosh; 10 µg/ml) and rmIL-4 (100 U/ml)), or under neutralizing conditions (anti-IL-4 plus anti-IL-12) in the absence or presence of IFN-
(typically 1000 U/ml; R&D Systems). Cells were activated for 3 days and split 1:8 into medium containing additional IL-2 (50 U/ml) and cultured for an additional 4 days.
For CD8+ T cell cultures, splenocytes and lymph node cells were isolated from m/h Stat2 KI mice (129/SvJ background), and CD8+ T cells were purified by flow-cytometric sorting. Purified CD8 T cells were activated with Con A in the presence of irradiated BALB/c splenocytes and IL-2 (100 U/ml) in complete IMDM for 3 days. Cells were diluted 1/10 on day 3 in medium containing additional IL-2 (100 U/ml) and rested to day 7.
Intracellular cytokine staining and flow-cytometric analysis
Resting T cell cultures were restimulated in medium containing PMA (50 ng/ml) and ionomycin (1 µM) for 4 h. In some cases, cells were restimulated with recombinant cytokines rmIL-12 (10 U/ml), rmIL-18 (50 ng/ml), and rmIFN-
(1000 U/ml). Brefeldin A (1 µg/ml; Sigma-Aldrich) was added during the last 2 h of stimulation. Activated cells were collected, fixed in 4% formalin, permeabilized with 0.05% saponin, and stained with fluorochrome-conjugated anti-IL-4 (11B11) and anti-IFN-
(R46A2) mAbs (Caltag). Relative fluorescence was measured by flow-cytometric analysis using a FACSCalibur instrument (BD Biosciences) with emission compensation detection.
IFN-
ELISA
Detection of IFN-
by ELISA has been described previously ( 27). Briefly, Immulon 1B microtiter plates (ThermoLabsystems) were coated with purified mAb R46A2 (2 µg/ml; Caltag), and IFN-
protein was detected with a biotin-conjugated secondary mAb XMG1.2 (0.5 mg/ml; Caltag). Complexes were detected by incubation with streptavidin-HRP followed by detection with 3,3',5,5'-tetramethylbenzidine substrate.
EMSA
Nuclear extracts were prepared from T cells activated for 30 min with either medium alone, IL-12 (10 U/ml), or rmIFN-
(A) (1000 U/ml) as previously described ( 11). To detect STAT2-containing IFN-sensitive gene factor-3 (ISGF3) complexes, 3 µg of nuclear extracts were incubated in 20 µl of binding reaction (10 mM Tris-Cl (pH 7.5), 50 mM NaCl, 1 mM DTT, 1 mM EDTA, 5% (v/v) glycerol, and 3 µg of poly(dI:dC) containing 1 x 105 cpm 32P-labeled double-stranded IFN-stimulated regulatory element oligonucleotide (GGGGGAAAGGGAAACCGAAACTGAACCCC). Reactions were incubated at room temperature for 30 min followed by the addition of a supershifting Ab to some reactions. Complexes were resolved on nondenaturing 4.5% acrylamide gels and visualized by autoradiography, as previously described.
Immunoprecipitation and Western blotting
Resting T cell cultures (day 7, described above) were restimulated with either medium alone, or with medium containing rmIL-12 (10 U/ml) or rmIFN-
(A) (1000 U/ml) for 30 min at 37°C. Cells were harvested, washed once in cold PBS, and lysed with 1 ml of lysis buffer (0.15 M NaCl, 1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS, and 50 mM Tris-Cl (pH 8.0)). Cell lysates were immunoprecipitated sequentially with anti-STAT4 (5 µg/ml; SC-486; Santa Cruz) and anti-STAT1 (5 µg/ml; SC-346) polyclonal Abs in the presence of protein A-Sepharose (Amersham Biosciences). Immunoprecipitates were resolved by SDS-PAGE and immunoblotted with a peroxidase-conjugated anti-phosphotyrosine Ab (RC20; Upstate Biotechnology). Immunoreactive complexes were detected by chemiluminescence. To detect equivalent STAT precipitation, blots were stripped and incubated again with polyclonal Abs anti-STAT4 (SC-486) or anti-STAT1 (SC-346) and with a peroxidase-conjugated goat anti-rabbit Ig secondary Ab.
| Results |
|---|
|
|
|---|
We previously demonstrated that a chimeric m/h STAT2 molecule could restore IFN-
-dependent STAT4 activation when expressed in STAT2-deficient human fibroblasts (U6A cells) ( 19). To reconstruct this pathway in murine CD4+ T cells, we wished to express the same molecule from the endogenous murine Stat2 locus as that expressed in our in vitro studies (Fig. 1A). The divergence of sequence similarity between murine and human Stat2 begins within the first 50 nt of exon 23. The targeting construct was designed such that the region of sequence divergence within exon 23 was replaced with the cDNA sequence encoding the human STAT2 C terminus, including a stop codon (Fig. 1, A and B). The PGK-neor cassette was flanked by loxP sites and placed within the middle of intron 23. Following in vitro Cre-mediated deletion, only a single 12-nt loxP site was left within intron 23 and did not interfere with proper splicing of the message to exon 24, encoding the natural polyadenylation signal. Homologous recombination within ES cells was detected by Southern blotting with a genomic DNA probe from the 3' end of the Stat2 gene outside the region of recombination (Fig. 1C). Generation of chimeric m/h Stat2 KI mice was performed by injection of targeted ES cells into C57BL/6 blastocysts and implantation into pseudopregnant females. Germline transmission was confirmed for three highly chimeric founders. Offspring were routinely monitored for the presence of the KI allele by genomic PCR analysis (Fig. 1D).
|
The chimeric m/h STAT2 molecule is expressed and functional in murine CD4+ T cells
Our previous studies demonstrated that both the full-length murine STAT2 and the m/h STAT2 chimeric molecules could be recruited and activated by the hIFNAR ( 19). However, it is possible that activation of murine STAT2 by the mIFNAR requires specific sequences within the murine STAT2 molecule that would be abolished by the expression of the chimeric m/h STAT2. Thus, two criteria must be met before IFN-
-dependent STAT4 activation can be assessed: the m/h STAT2 molecule must be 1) expressed in CD4+ T cells and 2) activated by the mIFNAR. Northern blot analysis of RNA isolated from purified CD4+ T cells demonstrated a gene-dose-dependent expression of murine Stat2 in the wild-type and m/h Stat2 heterozygous backgrounds that hybridized with a probe specific for the murine Stat2 C terminus (Fig. 2A, upper panel). This probe contained a 20-nt overlap of sequence within the C terminus that is not divergent between mouse and human, and explains the low degree of hybridization seen in the homozygous KI (Fig. 2A, upper panel, lane 3). Furthermore, a probe from the C terminus of human Stat2 hybridized to a band corresponding to the m/h Stat2 mRNA in both heterozygous and homozygous KI T cells (Fig. 2A, middle panel).
|
IFN-
-mediated STAT2 phosphorylation is accompanied by concomitant phosphorylation of STAT1 and the assembly of the ISGF3 complex containing a heterotrimer of STAT1, STAT2, and IFN regulatory factor 9 ( 28). We detected the formation of this complex in murine T cells by EMSA. ISGF3 was induced by murine IFN-
(A) in both wild-type and m/h Stat2 KI T cells (Fig. 2D). Furthermore, a supershift complex was identified in heterozygous and homozygous KI T cells by incubation of nuclear extracts with an anti-STAT2 Ab specific for the human STAT2 C terminus. Collectively, these data demonstrate that the chimeric m/h Stat2 gene is expressed and translated into protein in murine T cells. Furthermore, the chimeric m/h STAT2 molecule is functionally activated by the mIFNAR and capable of binding DNA.
Expression of m/h STAT2 is not sufficient to restore IFN-
-dependent Th1 development
Commitment of CD4+ T cells to high levels of IFN-
secretion occurs, in part, by a STAT4-dependent process ( 29). As a first step in measuring the reconstitution of IFN-
-dependent signaling for Th1 development, we crossed the m/h Stat2 KI to the DO11.10 TCR (TCR) transgenic on the BALB/c background ( 25). In these mice, the majority of T cells are selected by I-Ad and respond to a single peptide derived from the chicken OVA protein. Thus, in vitro T cell cultures from these mice can be activated by a single Ag (OVA peptide) under well-defined cytokine conditions. To assess developmental commitment to the Th1 phenotype, lymph node and splenic T cells were activated with OVA peptide and IL-2 in the absence or presence of specific cytokines and/or anti-cytokine Abs for 3 days. Cells were split into new medium containing IL-2 for an additional 4 days before restimulation and cytokine measurements. As expected, primary activation of cells under typical Th1-inducing conditions (
-IL-4 plus IL-12) led to robust IFN-
secretion upon secondary activation of cells with either PMA/ionomycin (Fig. 3A, condition no. 2), or with plate-bound anti-CD3 (B). Activation with rmIFN-
(A) (Fig. 3, A and B, condition no. 3) induced a 2- to 4-fold increase in the percentage of cells capable of producing IFN-
when compared with cells developing under neutralizing conditions (Fig. 3, A and B, condition no. 1). Although rmIFN-
(A) (specific activation of murine cells) was more active than rhIFN-
(A/D) (active on both murine and human cells) at promoting some cells to commit to IFN-
secretion, the induction of Th1 development relative to the effects of IL-12 was very low. However, similar levels of IFN-
secretion were observed in wild-type and m/h Stat2 KI T cells regardless of primary stimulation conditions.
|

for IFN-
production ( 16, 17, 18). However, in some cases, those experiments were performed with relatively high concentrations of IFN-
(50,000100,000 U/ml) compared with the levels normally used to assess human T cell differentiation (5001,000 U/ml). Based on these observations, wild-type and m/h Stat2 KI T cells were tested for their ability to commit to Th1 development in response to increasing concentrations of IFN-
. In this study, T cell cultures were activated in the presence of anti-IL-12 (Tosh) ( 30) and increasing concentrations of rmIFN-
(A) ranging from 100 to 100,000 U/ml (see Fig. 5, C and D). In contrast to previous studies, we found no difference in the levels of IFN-
secreted upon secondary activation when comparing cells activated under neutralizing conditions (anti-IL-12) and cells activated with IFN-
at any concentration. In addition, there were no significant differences in the percentage of cells capable of secreting IFN-
between wild-type and m/h Stat2 KI T cells. The overall quantity of IFN-
secreted by cells polarized in the presence of increasing concentrations of rmIFN-
(A) was confirmed by ELISAs (Fig. 3D) and further demonstrated that IFN-
failed to promote Th1 polarization in m/h Stat2 KI T cells.
|
gene transcription within fully differentiated Th1 cells. Combinatorial treatment of Th1 cells with IL-12 plus IL-18 induces sustained levels of IFN-
secretion in the absence of TCR activation ( 31, 32). This dual signaling pathway is dependent upon STAT4 activation and is conserved between murine and human Th1 cells ( 14, 33). In human Th1 cells, IFN-
plus IL-18 also induce acute IFN-
secretion, in part, due to the activation of STAT4 ( 33). Although the m/h STAT2 molecule failed to mediate IFN-
-dependent Th1 development, it was possible that the acute pathway for IFN-
gene expression in fully differentiated Th1 cells was restored by this genetic modification. This hypothesis was tested by activating DO11.10+ T cells from wild-type and m/h Stat2 KI mice in the presence of IL-12 for 7 days to promote Th1 development. These cells were then restimulated in the presence of either IL-12 plus IL-18 or with rmIFN-
(A) plus IL-18 for 24 h (Fig. 4). Consistent with our prior results, we found that dual stimulation with IFN-
plus IL-18 did not promote IFN-
secretion from either wild-type or m/h Stat2 KI T cells.
|

-dependent STAT4 activation
In human cells, species-specific determinants within the human STAT2 C terminus were necessary for recruiting STAT4 to the hIFNAR ( 19). To test the sufficiency of this domain in recruiting STAT4 to the mIFNAR, we assessed STAT4 phosphorylation in wild-type and m/h Stat2 KI T cells. DO11.10+ T cells were activated with OVA peptide and IL-12 for 7 days to generate cells that could respond to subsequent activation with IL-12 as a positive control. Resting Th1 cells were restimulated with either medium alone, IL-12, or with rmIFN-
(A). STAT4 and STAT1 tyrosine phosphorylation was determined by immunoblotting (Fig. 5). IL-12 was active in both wild-type and KI Th1 cells to promote STAT4 phosphorylation; however, rmIFN-
did not exhibit such activity. The failure of IFN-
to activate STAT4 was not due to a general lack of IFNAR activation, because STAT1 was robustly phosphorylated in both wild-type and KI T cells (Fig. 5, lower panel). Furthermore, previous studies with both human and murine STAT2-deficient cells demonstrated that STAT1 activation is dependent upon the presence of a functional STAT2 molecule ( 22, 34, 35). Thus, we conclude that the chimeric m/h STAT2 molecule is functional to recruit and activate STAT1, but not STAT4, in murine T cells. Taken together, this study demonstrates that, although sequences within the C terminus of STAT2 are required in human cells, this domain is not sufficient to promote STAT4 recruitment and activation by the mIFNAR.
IFN-
fails to promote IFN-
secretion in murine CD8+ T cells
A recent report has suggested that IFN-
can promote STAT4 phosphorylation and IFN-
secretion from murine T cells in a murine model of lymphocytic choriomeningitis virus infection ( 16). However, their system relied primarily on the secretion of IFN-
by CD8+ T cells. Thus, it was possible that IFN-
signaling for IFN-
secretion was more efficient in murine CD8+ than in CD4+ T cells. Based on those results, we wished to determine whether IFN-
-driven IFN-
secretion was more efficient in murine CD8+ cells that expressed the m/h STAT2 chimeric molecule. Unlike CD4+ T cells, murine CD8+ T cells do not require STAT4 signaling to become competent to secrete high levels of IFN-
upon restimulation through the TCR ( 29). However, acute IL-12/IL-18-mediated IFN-
secretion from CD8+ T cells remains dependent upon STAT4 activation. Thus, for these experiments, CD8+ T cells were purified from wild-type and m/h Stat2 KI mice (on 129/SvJ background) by flow-cytometric sorting. Cells were activated with irradiated allogeneic BALB/c splenocytes in the presence of Con A for 3 days followed by dilution in medium containing additional IL-2 and rested to day 7. CD8+ T cells were then washed extensively, restimulated with recombinant cytokines, and analyzed for IFN-
secretion by both intracellular cytokine staining (Fig. 6A) and ELISA (B).
|
alone did not lead to significant increases in either the percentage of cells capable of expressing IFN-
(Fig. 6A, b, d, h, and j) or accumulation of IFN-
in the culture supernatants (B), as expected. IL-18 stimulation led to a marked increase in the percentage of IFN-
-secreting cells (Fig. 6A, c and i), and this effect was enhanced by combined stimulation with IL-12 (A, e and k) but not with IFN-
(f and l). However, only IL-12 plus IL-18 activation led to a significant accumulation of IFN-
in the culture supernatants during a 24-h stimulation (Fig. 6B), indicating that the percentage of cells capable of expressing IFN-
in response to IL-18 or IL-18 plus IFN-
was transient and not sustained. Furthermore, the levels of IFN-
secreted in response to IL-18 were not significantly different from the levels observed in response to combined stimulation with IL-18 plus IFN-
. These data demonstrate that, unlike IL-12, IFN-
stimulation has no direct effect on acute induction of IFN-
gene expression in CD8+ T cells. Furthermore, we found no significant difference in either the percentage of cells capable of expressing IFN-
or the accumulation of IFN-
within the culture supernatants of wild-type vs m/h Stat2 KI CD8+ cells responding to IFN-
stimulation. | Discussion |
|---|
|
|
|---|

-induced STAT4 activation ( 11, 12, 23, 38) correlated well with the known biological responses when comparing mouse and human T cells. Collectively, these correlations predict that any receptor, including the IFNAR, that can activate STAT4 within CD4+ T cells would have the capacity to drive IFN-
gene expression in both mouse and human T cells. STAT4 activation by the hIFNAR involves the presence of activated STAT2 ( 11), and this interaction maps to a nonconserved region within the STAT2 C terminus ( 19). In this study, we demonstrated that, although this sequence within STAT2 is required to recruit and activate STAT4 within human cells, it is not sufficient to promote STAT4 phosphorylation or Th1 commitment within murine CD4+ T cells. In our initial studies of the hIFNAR, we considered the possibility that STAT4 was recruited directly to the IFNAR via interactions with the cytoplasmic domain of the receptor subunits ( 11). Indeed, neither the IFNAR1 nor -R2 subunits are well conserved between mouse and human. However, we demonstrated that STAT4 did not interact with any potential phosphotyrosine residues within either the hIFNAR1 or -R2 subunit by a phosphopeptide competition EMSA assay ( 11). Recently, several studies have demonstrated a unique requirement for STAT N-terminal domains that regulate receptor-proximal activation. For example, in human cells, the STAT2 N-domain mediates a direct interaction with the IFNAR2 cytoplasmic domain, and this interaction is formed before cytokine activation ( 39). This preassociated complex facilitates cytokine-mediated phosphorylation of STAT2.
An analogous mechanism might be operative for STAT4. First, several reports have demonstrated that the STAT4 N-domain is required for efficient phosphorylation in response to both IL-12 and IFN-
( 40, 41, 42). Indeed, transgenic expression of STAT4 lacking the N-domain fails to reconstitute IL-12-driven STAT4 phosphorylation or Th1 development when crossed to the STAT4-deficient background ( 42). Crystallographic data have demonstrated that the STAT4 N-domain exists as a latent dimer through homotypic interaction ( 43). Although this structure has been re-evaluated ( 41, 44), the existence and purpose of this latent STAT4 dimer in cytokine-driven phosphorylation has been recently examined. In this study, instead of completely removing the N-domain from the primary STAT4 sequence, specific residues that mediate N-domain dimer formation were mutated and expressed within both human fibroblasts and murine Stat4-deficient T cells ( 41). These experiments revealed that mutation of these critical N-domain residues abrogated STAT4 phosphorylation in response to both IFN-
(in human fibroblasts) and IL-12 (in murine T cells), suggesting a common mechanism for recruitment of STAT4 to both the IL-12R and the hIFNAR. Whether STAT4, like STAT2, preassociates with either the IL-12R or the hIFNAR has not been reported yet. However, due to the significant sequence divergence within both the IFNAR1 and -R2 subunits between mouse and human, it is expected that the conserved STAT4 N-domain would interact in a species-specific manner with the cytoplasmic domain of the hIFNAR. If this is the case, then the hIFNAR cytoplasmic domain would represent a second species-specific component necessary for the recruitment and activation of STAT4. Furthermore, this possibility would also explain why the modification of STAT2 described here was not sufficient to activate STAT4 by the mIFNAR in murine CD4+ T cells.
In contrast to our initial characterization of the species-specific link between IFN-
signaling and STAT4 activation, recent reports have suggested that IFN-
can activate STAT4 and promote IFN-
expression in murine T cells ( 16, 17). These studies used relatively high concentrations of IFN-
to detect this effect. Based on this observation, we considered the possibility that, although the mIFNAR was inefficient at activating STAT4, this effect could be overcome by titrating IFN-
to very high concentrations. However, we found that wild-type, m/h Stat2 KI, and IL-12p40-deficient CD4+ T cells did not secrete significant levels of IFN-
when activated in the presence of rmIFN-
(A) at any concentration (up to 100,000 U/ml; Fig. 3, C and D). It has been suggested that the use of different IFN-
subtypes could account for this discrepancy. However, Berenson et al. ( 45) recently demonstrated that, although mIFN-
(A) was more active than rhIFN-
(A/D) at promoting weak STAT4 phosphorylation (as observed by Nguyen et al. ( 16)), neither of these IFN-
subtypes was able to induce Th1 commitment within CD4+ T cells, and the present study confirms this observation. In addition, Nguyen et al. ( 16) reported elevated STAT4 phosphorylation in response to IFN-
in murine CD8+ cells compared with enriched CD4+ T cells. Although a STAT4-dependent, IL-12-independent mechanism for commitment to IFN-
secretion exists for CD8+ T cells ( 29), we found no evidence that CD8+ T cells could secrete IFN-
in response to acute stimulation with IFN-
in either the absence or presence of IL-18. Thus, based on our present findings, we conclude that IFN-
does not promote efficient STAT4 phosphorylation or IFN-
expression in murine T cells even in the presence of a humanized STAT2 molecule. A direct comparison of IFN-
-dependent STAT4 phosphorylation ( 11, 12) and Th1 development ( 12) between mouse and human CD4+ T cells has been described in detail, and forms the basis of the present study. However, given the recent controversy using different in vivo and in vitro model systems, this issue clearly warrants further study.
| Acknowledgments |
|---|
| Footnotes |
|---|
1 This work was supported by grants from Howard Hughes Medical Institute and the National Institutes of Health awarded to K.M.M., and by a grant from the Leukemia and Lymphoma Society and start-up funds from Howard Hughes Medical Institute awarded to J.D.F. ![]()
2 Address correspondence and reprint requests to Dr. J. David Farrar, Center for Immunology, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, TX 75390-9093. E-mail address: David.Farrar{at}UTSouthwestern.edu ![]()
3 Abbreviations used in this paper: m, murine; h, human; KI, knockin; IFNAR, IFN-
R; SH2, Src homology 2; ES cell, embryonic stem cell; ISGF3, IFN-sensitive gene factor-3. ![]()
Received for publication April 16, 2004. Accepted for publication October 26, 2004.
| References |
|---|
|
|
|---|
: evidence for the involvement of ligand-induced tyrosine and serine phosphorylation. J. Immunol. 157:4781.[Abstract]
/
receptor requires activated Stat2. J. Biol. Chem. 275:2693.
and
) exert opposite regulatory effects on the development of cytolytic potential by Th1 or Th2 human T cell clones. J. Immunol. 149:2977.[Abstract]
/
and IL-18 synergistically enhance IFN-
gene expression in human T cells. J. Immunol. 160:6032.
increases the frequency of interferon-
-producing human CD4+ T cells. J. Exp. Med. 178:1655.
response to viral infection. Science 297:2063.
induction by Gram-negative bacteria based on STAT4 activation by type I IFN and IL-18 signaling. J. Immunol. 169:1665.
-stimulated STAT2-independent production of IFN-
in the brain. J. Clin. Invest. 112:535.[Medline]
receptor 1 subunit (IFNaR1) acts as a docking site for the latent form of the 113 kDa STAT2 protein. EMBO J. 15:1064.[Medline]
-interferon. Mol. Cell. Biol. 16:288.[Abstract]
and IFN-
in IL-12-induced T helper cell-1 development. J. Immunol. 156:1442.[Abstract]
production and type 1 cytokine responses. Immunity 4:471.[Medline]
-globin locus control region 5' hypersensitive site 3. Mol. Cell. Biol. 16:2906.[Abstract]

T-cell-receptor transgenic system. Proc. Natl. Acad. Sci. USA 89:6065.
production from CD4+ versus CD8+ T cells. J. Exp. Med. 189:1355.
. J. Immunol. 152:1883.[Abstract]
production and activates IRAK and NF
B. Immunity 7:571.[Medline]
production in Th1 CD4+ T cells: evidence for two distinct pathways for promoter activation. Eur. J. Immunol. 29:548.[Medline]
and IL-18 synergistically enhance IFN-
production in human NK cells: differential regulation of Stat4 activation and IFN-
gene expression by IFN-
and IL-12. Eur. J. Immunol. 31:2236.[Medline]
interferon signaling pathway. Mol. Cell. Biol. 15:1312.[Abstract]
1 chain (IL-12R
1)-deficient mice: IL-12R
1 is an essential component of the functional mouse IL-12 receptor. J. Immunol. 159:1658.[Abstract]
2 (IL-12R
2)-deficient mice are defective in IL-12-mediated signaling despite the presence of high affinity IL-12 binding sites. J. Immunol. 165:6221.
interferon receptor and for signaling. Mol. Cell. Biol. 17:2048.[Abstract]
. Eur. J. Immunol. 34:2365.[Medline]This article has been cited by other articles:
![]() |
A. M. Davis, K. A. Hagan, L. A. Matthews, G. Bajwa, M. A. Gill, M. Gale Jr., and J. D. Farrar Blockade of Virus Infection by Human CD4+ T Cells via a Cytokine Relay Network J. Immunol., May 15, 2008; 180(10): 6923 - 6932. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. J. Ramos, A. M. Davis, T. C. George, and J. D. Farrar IFN-{alpha} Is Not Sufficient to Drive Th1 Development Due to Lack of Stable T-bet Expression J. Immunol., September 15, 2007; 179(6): 3792 - 3803. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Remoli, J. Ragimbeau, E. Giacomini, V. Gafa, M. Severa, R. Lande, S. Pellegrini, and E. M. Coccia NF-{kappa}B is required for STAT-4 expression during dendritic cell maturation J. Leukoc. Biol., January 1, 2007; 81(1): 355 - 363. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Berenson, M. Gavrieli, J. D. Farrar, T. L. Murphy, and K. M. Murphy Distinct Characteristics of Murine STAT4 Activation in Response to IL-12 and IFN-{alpha} J. Immunol., October 15, 2006; 177(8): 5195 - 5203. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Havenar-Daughton, G. A. Kolumam, and K. Murali-Krishna Cutting Edge: The Direct Action of Type I IFN on CD4 T Cells Is Critical for Sustaining Clonal Expansion in Response to a Viral but Not a Bacterial Infection J. Immunol., March 15, 2006; 176(6): 3315 - 3319. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |