|
|
||||||||

Departments of
*
Medicine and
Molecular Medicine, University of Massachusetts Medical School, Worcester, MA 01655
| Abstract |
|---|
|
|
|---|
30% of BBDR rats infected with Kilham rat virus (KRV) through a process that does not involve infection of pancreatic
cells. Pretreatment with polyinosinic-polycytidylic (poly(I:C)), a ligand of TLR3, acts synergistically to induce diabetes in 100% of KRV-infected rats. The mechanisms by which KRV induces diabetes and TLR3 ligation facilitates this process are not clear. In this study, we demonstrate that activation of the innate immune system plays a crucial role in diabetes induction. We report that multiple TLR agonists synergize with KRV infection to induce diabetes in BBDR rats, as do heat-killed Escherichia coli or Staphylococcus aureus (natural TLR agonists). KRV infection increases serum IL-12 p40 in a strain-specific manner, and increases IL-12 p40, IFN-
-inducible protein-10, and IFN-
mRNA transcript levels, particularly in the pancreatic lymph nodes of BBDR rats. Infection with vaccinia virus or H-1 parvovirus induced less stimulation of the innate immune system and failed to induce diabetes in BBDR rats. Our results suggest that the degree to which the innate immune system is activated by TLRs is important for expression of virus-induced diabetes in genetically susceptible hosts. | Introduction |
|---|
|
|
|---|
10% of all cases of diabetes (1). Many morphological, biochemical, and clinical studies have suggested that its pathogenesis is an autoimmune process, but the mechanism that initiates the disease remains unknown. It is believed that both genetic susceptibility and environmental perturbants such as viral infection participate in the development of type 1 diabetes (2, 3). Epidemiological studies and a high rate of disease discordance in monozygotic twins support this connection (4), but direct proof and understanding of putative mechanisms are lacking. To investigate the mechanisms of environmentally induced diabetes, we use the BBDR rat. Diabetes does not occur in viral Ab-free BBDR rats (5), but type 1-like diabetes occurs in about a third of these animals following infection with Kilham rat virus (KRV)3 (6, 7). KRV is a ssDNA parvovirus (8). Its genome encodes three overlapping structural proteins, VP1, VP2, and VP3, and two overlapping nonstructural proteins, NS1 and NS2 (8). KRV, H-1, and the recently described rat parvovirus-1 (formerly designated orphan parvovirus) are the three autonomous (i.e., do not require a helper virus for their replication) parvoviruses that infect rats (8).
How KRV infection induces autoimmune diabetes in the BBDR rat is not completely understood. The virus infects lymphoid organs and endothelial cells but not insulin-producing
cells (9). One hypothesis is that islet-specific T cells in the BBDR rat are cross-reactive with a KRV peptide. This molecular mimicry hypothesis, however, was not supported by studies of BBDR rats transduced with viral vectors expressing KRV proteins (10). Robust cellular and humoral immune responses against the viral proteins were observed, but the animals remained diabetes-free. Another hypothesis proposes that a cytokine shift toward a type 1 immune response induced by KRV infection leads to an imbalance between Th1 and Th2 cells (10).
We (11) and others (10, 12) have proposed that KRV alters the balance of regulatory cells and autoreactive effector cells in genetically susceptible hosts. This hypothesis is supported by the observation that infection of BBDR rats with KRV leads to a reduction in the frequency of CD4+CD25+ and CD4+CD45RClow T regulatory cells (10, 11, 12). Regulatory T cell activity is enriched in both the CD4+CD25+ and the CD4+CD45RClow T cell subset (13, 14, 15). How KRV infection alters regulatory T cell number or function is not known, but could involve the interaction of T cells with APCs (16).
T cell interactions with immature APCs are believed to lead to the generation of regulatory T cells, whereas T cell interactions with activated mature APCs leads to the induction of effector T cells (17). TLRs mediate the activation of the immune system by recognizing products of microbial metabolism (18, 19, 20). These microbial TLR ligands exhibit highly conserved pathogen-associated molecular patterns (PAMPs). Recognition of PAMPs expressed on microbial pathogens by TLRs on dendritic cells (DCs) and macrophages triggers a maturation program that includes 1) up-regulation of MHC and costimulatory molecules and 2) expression of proinflammatory cytokines including TNF-
, IL-1, IL-6, and IL-12 (17, 21, 22). This maturational process increases the ability of DCs to prime naive T cells (23).
The role of TLR-induced activation of innate immunity in the pathogenesis of autoimmune diabetes is not clear, and data from rodent models are conflicting. In the BBDR rat, both KRV infection (6, 7) and the TLR3 ligand polyinosinic-polycytidylic acid (poly(I:C)) (24) are diabetogenic. In contrast, in the NOD mouse viral (25, 26, 27), parasitic (28), and bacterial (29) infections, each of which is a strong activator of innate immunity, all prevent diabetes. Direct activation of innate immunity in NOD mice using purified TLR agonists also prevents spontaneous diabetes (30, 31, 32, 33, 34).
We now report that, in the BBDR rat, TLR-induced activation of innate immunity is a critical component for diabetes expression and that this effect is both virus-specific and host-strain dependent.
| Materials and Methods |
|---|
|
|
|---|
Viral Ab-free BBDR/Wor rats of either sex were obtained from BRM and were housed in viral Ab-free quarters. Animals from this vendor are certified to be free of Sendai virus, pneumonia virus of mice, sialodacryoadenitis virus, rat corona virus, KRV, H-1, GD7, Reo-3, Mycoplasma pulmonis, lymphocytic choriomeningitis virus, mouse adenovirus, Hantaan virus, and Encephalitozoon cuniculi. Viral Ab-free WF rats of either sex were purchased from Harlan Sprague Dawley.
KRV (UMass isolate (6)) and NRK cells were obtained from stocks maintained in our laboratories. KRV was propagated in NRK cells grown in DMEM. Stocks of vaccinia virus (VV) were kindly provided by Dr. R. Welsh (University of Massachusetts Medical School, Worcester, MA). Y3-Ag 1.2.3 cells (Y3 cells; American Type Culture Collection) were infected with 0.5 x 106 PFU KRV in 4 ml of complete DMEM for 18 h and used as virus-infected APCs as described (11). Virus titers for KRV and H-1 (11), and VV (35) were determined as described.
Treatment protocols and diagnosis of diabetes
Rats 2225 days of age of either sex were injected i.p. with KRV, VV, or H-1 in a volume of 1 ml as previously described (6, 36). Peptidoglycan (PGN), poly(I:C), and LPS (O26:B6) were purchased from Sigma-Aldrich, dissolved in Dulbeccos PBS (1 mg/ml), and stored at 20°C until used. Zymosan was purchased from Molecular Probes. The sequence of the CpG oligonucleotide used in this study was TCGTCGTTTTGTCGTTTTGTCGTT (37) and was synthesized by TriLink BioTechnologies. This CpG oligonucleotide has a phosphodiester backbone. R848, a synthetic imidazoquinoline compound with antiviral activity that is ligand of TLRs 7 and 8 (38), was purchased from GL Synthesis. The doses used were: 1 µg for poly(I:C), 2 µg for LPS, 2 µg for CpG, 2 µg for zymosan, 5 µg for PGN, and 2 µg for R848 per gram body weight. The concentration of contaminating endotoxin in these agents was determined commercially (Charles River Endosafe) and was <10 endotoxin units/mg (39). Heat-killed Escherichia coli and Staphylococcus aureus were a gift from Dr. G. Teti (University of Messina, Messina, Italy). Rats were injected i.p. with TLR agonists or heat-killed bacteria i.p. on 3 consecutive days. E. coli and S. aureus were administered at a dose of 2 µg/g body weight. Treated animals were either given no further treatment or infected with KRV or VV on the day after the last injection of TLR agonists or heat-killed bacteria. In some experiments, pancreatic, cervical, and mesenteric lymph nodes (MLN), spleens, or ovaries were recovered from control uninfected or KRV- or VV-infected rats 4 or 5 days after infection. In experiments designed to measure the frequency of diabetes induction, all treated rats were screened for glycosuria twice weekly until diabetes onset or until day 40 after infection or the last injection of the TLR ligand. Diabetes was diagnosed on the basis of a plasma glucose concentration >250 mg/dl (11.1 mM/L) on 2 consecutive days. In some experiments, pancreas specimens were obtained from animals that were not diabetic at the conclusion of the experiment, fixed in 10% buffered formalin, stained with H&E, and examined by a pathologist who was unaware of the treatment status of the specimens.
Detection of anti-KRV Abs
Anti-KRV Abs were detected using 96-well ELISA plates coated with intact KRV (Charles River Laboratories) as described (11).
Cell isolation and assay for virus-specific CD8+IFN-
+ T cells
Spleen cells were obtained from control and infected rats. Single cell suspensions were prepared and erythrocytes lysed with a hypotonic NH4Cl buffered solution. Cells were washed twice with PBS and suspended in high-glucose DMEM containing 10% heat-inactivated FBS, 1 mM sodium pyruvate, 100 U/ml penicillin, 0.1 mg/ml streptomycin, and 50 µM 2-ME (Invitrogen Life Technologies).
Virus-specific CD8+ T cell responses were detected as described (11). This flow cytometry assay uses intracellular IFN-
expression as a surrogate marker of CTL. Labeled cells were analyzed using a FACScan or FACSCalibur instrument (BD Biosciences). Lymphoid cells were gated according to their light-scattering properties, and 3050 x 103 events were acquired for each analysis.
ELISA
Levels of serum IL-12 p40 and IL-12 p70 were determined using a BioSource International ELISA kit according to the manufacturers instructions. According to the manufacturers brochure (Rev. B2, 11/4/02, PRO84), levels of IL-12 p40 in 12 pools of serum from naive nonautoimmune rats ranged from 770 to 2200 pg/ml (mean 1362 pg/ml). The lower limit of detection for IL-12 p40 was <3 pg/ml and the limit of detection for IL-12 p70 was <2.5 pg/ml.
RNA extraction, cDNA synthesis, and quantitative and nonquantitative RT-PCR analyses
Total RNA from lymphoid organs was prepared using TriReagent (Molecular Research Center). One microgram of total RNA was incubated with 0.5 µg of oligo(dT) (Promega) for 15 min at 65°C and allowed to stand at room temperature for 2 min. The sample was then incubated for 1 h at 42°C with 10 U of RNase Inhibitor (Boehringer Mannheim), 1.25 mM dNTPs (Promega), 16 U of avian myeloblastosis virus reverse transcriptase (Promega) in reverse transcriptase buffer (50 mM Tris-HCl, pH 8.3, at 42°C, 50 mM KCL, 10 mM MgCl2, 10 mM DTT, and 0.5 mM spermidine) in a final volume of 20 µl. In a total volume of 50 µl of PCR buffer (Promega), 2 µl of cDNA was incubated with 1.25 U of TaqDNA polymerase (Promega), 0.5 mM dNTPs, and 1 µM sense and antisense primers. The primers were synthesized by Invitrogen Life Technologies. To exclude the possibility of genomic contamination, control experiments were performed in which RNA was amplified in the absence of cDNA.
For nonquantitative RT-PCR analysis, samples were incubated in a thermocycler (PTC-100; MJ Research) using one cycle at 94°C for 5 min followed by 30 cycles consisting of 94°C for 30 s, 55°C for 60 s, and 72°C for 60 s. PCR fragments were visualized by 1% agarose gel electrophoresis and ethidium bromide staining. Total RNA from Y3 cells infected in vitro with 0.5 x 106 PFU of KRV for 18 h was used as a control for KRV mRNA amplification. The primer sequences used were obtained from GenBank. Primers for amplification of
-actin were as follows: sense 5'-CGACGAGGCCCAGAGCAAGAGAGG-3' and antisense 5'-CGTCAGGCAGCTCATAGCTCTTCTCCAGGG-3'. Primers for KRV capsid protein 2 (VP2) were as follows: sense 5'-TAGACAGCAACAACATACTGCC-3' and antisense 5'-CCTCAGTTACATAGTTCACCCC-3'. Primers for Western Reserve (WR) VV virokine mRNA were: sense 5'-CGACGGTCCATTGCTAGATA-3' and antisense 5'-TCTCTAGCCACTTTGGCACT-3'.
Quantitative real-time RT-PCR analysis was performed using the Smart Cycler System (Cepheid) applying SYBR Green I fluorescent dye to detect the PCR product. The reactions were conducted in a total volume of 25 µl containing 2.5 µl of 10x HotMaster Taq buffer including 25 mM Mg2+ (Fisher Scientific), 0.2 mM dNTPs (Promega), 0.1x SYBR-Green (Molecular Probes), 1 µM sense and antisense primers, a signal enhancer containing 2 ng/ml nonacetylated BSA and 0.2 M trehalose (both from Sigma-Aldrich) and 2% Tween 20 (Pierce), all in 2 mM Tris buffer, pH 8.0, 0.25 U of HotMaster TaqDNA Polymerase (Fisher Scientific), and 1 µl of sample or standard cDNA. The PCR run was programmed with software provided with the Smart Cycler System using a protocol optimized in preliminary experiments. For each gene of interest, mRNA expression was determined from a standard curve. Data for IL-12 p40, IFN-
-inducible protein-10 (IP-10), and IFN-
are presented as the ratio of cytokine or chemokine expression to
-actin expression in the same sample of cDNA. Melting point analysis was performed in all cases to confirm the presence of the expected gene product. Primers used for the amplification of
-actin were as follows: sense 5'-GCTACAGCTTCACCACA-3' and antisense 5'-TCTCCAGGGAGGAAGAGGAT-3'. The standard used for
-actin amplification was spleen RNA obtained from an untreated BBDR rat. For IL-12 p40: sense 5'-TGGGAGTACCCTGACTCCTG-3' and antisense 5'-GGAACGCACCTTTCTGGTTA-3'. For IP-10: sense 5'-CCAGGGCCATAGGAAAACTT-3' and antisense 5'-TCTTGATGGCCTCAGATTCC-3'. The standard used for IL-12 p40 and IP-10 was RNA isolated from spleen cells activated for 18 h with 1 µg/ml LPS (Sigma-Aldrich). For IFN-
: sense 5'-AGGAAAGAGCCTCCTCTTGG-3' and antisense 5'-CTGATGGCCTGGTTGTCTT-3'. The standard used for IFN-
was RNA extracted from spleen cells activated with 10 ng/ml PMA and 1 µM ionomycin (both purchased from Sigma-Aldrich). For the KRV nonstructural gene: sense 5'-GGAAACGCTTACTCCGATGA-3' and antisense 5'-AACCGATGTCCTTCCCATTT-3'. The standard used for KRV mRNA amplification was RNA extracted from Y3 cells infected in vitro with 0.5 x 106 PFU of KRV for 18 h.
Western blot analysis
Rat lymphoid organs were homogenized in 0.5 ml of lysis buffer containing 1% Brij 96, 50 mM HEPES, 150 mM NaCl, and 2 mM EDTA (all from Sigma-Aldrich), supplemented with a mixture of protease inhibitors(Complete; Roche Diagnostic). Lysates were incubated on ice for 30 min followed by centrifugation at 14,000 rpm for 10 min at 4°C. Supernatants were removed and were loaded onto 14% SDS-PAGE gels for electrophoresis. After separation and transfer, the membrane was probed with a dilution of 1/10,000 anti-
-actin rabbit polyclonal Ab (Abcam) or with a dilution of 1/5,000 rabbit polyclonal anti-IP-10 (Torrey Pines Biolabs). The membranes were then exposed to a dilution of 1/10,000 biotin-conjugated goat anti-rabbit IgG (H+L) followed by incubation with a dilution of 1/5,000 peroxidase-conjugated streptavidin. The blots were developed using the ECL Western Blotting Detection System (Amersham Biosciences).
Statistical analysis
Parametric data are presented as the arithmetic mean ± 1 SD. Comparisons of two means used the independent samples t test and the Bonferroni adjustment as required for multiple comparisons (40, 41). Comparisons of three or more means used one-way ANOVA and the least significant difference procedure for a posteriori contrasts (40). Average duration of diabetes-free survival in treated rats is presented as the median. Statistical comparisons of diabetes-free survival among groups were performed using the method of Kaplan and Meier (42); the equality of allograft survival distributions for animals in different treatment groups was tested using the log rank statistic (43). Comparisons of diabetes frequency in 2 x 2 tables were performed using the Fisher exact statistic (44). Comparison of cytokine and chemokine mRNA expression relative to
actin expression in infected vs uninfected rats used the nonparametric Mann-Whitney U test (44). Comparisons of cytokine and chemokine mRNA expression relative to
actin expression in different lymphoid tissues in infected rats used the Kruskall-Wallis test (44).
| Results |
|---|
|
|
|---|
Infection with KRV typically induces diabetes in
25% of BBDR rats, and coadministration of a TLR3 agonist, poly(I:C), increases the frequency of diabetes to almost 100% (6, 7). To determine whether this effect is restricted to ligation of TLR3, BBDR rats 2225 days of age were injected with purified, endotoxin-free ligands for other TLRs on 3 consecutive days and infected with 1 x 107 PFU of KRV the next day. In this set of experiments, consistent with previous reports (11) the frequency of diabetes in rats injected with KRV alone averaged 23% (Table I, group 1). The survival curve for these rats is shown in Fig. 1. As expected (11), pretreatment for 3 days with the TLR3 ligand poly(I:C) increased the penetrance of diabetes to 100% (Table I, group 2). Surprisingly, pretreatment with ligands of other TLRs, including LPS (TLR4), zymosan (TLR 2, 6), PGN (TLR 2, 6), R848 (TLR 7, 8), and CpG DNA (TLR 9) also increased the frequency of diabetes significantly (Table I, groups 4 and 69). The cumulative frequency of diabetes varied from 50 to 100% depending on the TLR agonist used. In control experiments, we observed that treatment with either poly(I:C) or LPS in the absence of infection failed to induce diabetes (Table I, groups 3, 5). The data document that activation of innate immunity by multiple TLR ligands can synergize with KRV infection to precipitate diabetes in BBDR rats.
|
|
The dose of KRV used in these experiments (1 x 107 PFU given i.p.) represents a much greater viral challenge than that which would be expected in the course of natural exposure to the virus. We therefore tested the relative diabetogenicity of KRV injected at much lower doses, both with and without pretreatment with a TLR3 agonist. We observed first that the injection of 1 x 105 PFU of KRV alone induced diabetes at approximately the same rate (29%, Table II, group 1) as did injection of 1 x 107 PFU of KRV alone (23%, Table I, group 1). Injection of lower doses of KRV (1000 or 10 PFU), however, was not diabetogenic (Table II, groups 2, 3). In striking contrast, infection of poly(I:C)-treated BBDR rats with 1 x 105 or 1 x 103 PFU of KRV increased the cumulative frequency of diabetes to 78% (Table II, groups 4, 5). Even more surprisingly, infection of poly(I:C)-treated BBDR rats with only 10 PFU of KRV induced diabetes in 30% of the animals (Table II, group 6). As noted above poly(I:C) alone at the dose used in these experiments fails to induce diabetes (Table I, group 3). These data suggest that activation of a TLR signaling pathway before infection can amplify the capability of KRV at low doses to precipitate autoimmune diabetes.
|
Our surprising observation that, after pretreatment with a TLR3 ligand, injection of as few as 10 PFU of KRV leads to diabetes prompted us to analyze the expression of viral mRNA in the pancreatic lymph nodes and to characterize the host immune response to this seemingly modest viral challenge. We chose to focus the analysis on pancreatic lymph nodes because they are hypothesized to play a role in the initiation of autoimmune diabetes in the NOD mouse (45, 46).
Viral replication occurs in pancreatic lymph nodes of BBDR rats infected with 10 or 1 x 107 PFU of KRV. The presence of mRNA-encoding capsid protein is indicative of viral replication (8, 47, 48). We measured levels of KRV capsid protein 2 (VP2) mRNA in pancreatic lymph node cells 5 days after infection with 10 or 1 x 107 PFU of KRV. As shown in Fig. 2, KRV VP2 mRNA was readily detectable in all BBDR rats infected with either 10 or 1 x 107 PFU of virus, but the level of viral mRNA appeared considerably lower in the animals given only 10 PFU (Fig. 2). This result suggests that the level of infectious KRV attained in the host in the absence of coligation of TLRs may be an important determinant of viral diabetogenicity.
|
|
as a surrogate marker for virus-specific CD8+ T cells (11). Consistent with previous reports (11), the percentage of CD8+IFN-
+ splenic T cells in one animal treated with poly(I:C) plus 1 x 107 PFU of KRV was 0.7%. The percentage of CD8+IFN-
+ splenic T cells in rats treated with poly(I:C) plus 10 PFU of KRV was 1.1 ± 0.3% (n = 5). Consistent with previous reports (11), the frequency of CD8+IFN-
+ splenic T cells in two control uninfected rats was low (0.2% and 0.4%). Pretreatment with heat-killed bacteria increases the diabetogenicity of KRV in BBDR rats
We next tested the hypothesis that exposure to "natural" TLR ligands in the form of intact heat-killed bacteria would also synergize with KRV to precipitate diabetes. BBDR rats were injected with either heat-killed E. coli, a Gram-negative bacterium thought to activate innate immunity through TLR4 (19), or S. aureus (Gram-positive), thought to activate innate immunity through TLR2 (19), on 3 consecutive days, and were then infected with 1 x 107 PFU of KRV on the following day. In this experiment, the 57 rats from Table I that were treated with KRV only were used as historical reference controls. As shown in Fig. 1, treatment with S. aureus or E. coli in the absence of KRV infection failed to induce diabetes. The combination of pretreatment with E. coli plus KRV infection increased the cumulative frequency of diabetes to 63% (5 of 8, p < 0.01 vs KRV alone). The combination of pretreatment with S. aureus increased the cumulative frequency of diabetes to 100% (8 of 8, p < 0.001 vs KRV alone), with all animals becoming diabetic by day 20. These data suggest that intact heat-killed bacterium providing "natural" TLR ligands can synergize with KRV infection to precipitate diabetes in BBDR rats.
IL-12 p40 is up-regulated in BBDR rats in a virus- and strain-specific manner
To begin to understand the mechanism by which TLR ligation acts to enhance the diabetogenicity of KRV infection (Table I and Fig. 1) we tested three hypotheses: 1) KRV itself is an activator of the innate immune system; 2) the innate immune response to virus infection differs among host strains; and 3) the degree of innate immune system activation varies in a virus-specific manner.
KRV infection induces higher serum IL-12 p40 but not IL-12 p70 levels in BBDR than in WF rats. To test the first two of these hypotheses, we quantified levels of serum IL-12 p40 and IL-12 p70 protein in BBDR and diabetes-resistant WF rats infected with KRV. Animals 2225 days of age were infected with 1 x 107 PFU of KRV and the serum concentrations of IL-12 p40 and IL-12 p70 were measured 5 days later. As shown in Fig. 4, the serum concentration of IL-12 p40 was 5.3-fold greater in KRV-infected BBDR rats than in uninfected control animals (p < 0.001) and 2.4-fold greater than in KRV-infected WF rats (p < 0.01). Serum IL-12 p40 levels in KRV-infected WF rats were not statistically different from those observed in uninfected control WF rats. In contrast, levels of IL-12 p70 were undetectable (<2.5 pg/ml) at all time points. The results suggest that KRV at the dose tested can be a potent inducer of IL-12 p40 in some but not all rat strains.
|
Because the concentration of IL-12 p40 after infection with VV was surprisingly low, we tested for the presence of viral mRNA in the pancreatic lymph nodes and ovaries to confirm that the animals were, in fact, harboring an active infection at the time of the assay. The ovary is known to be a target of VV infection in the mouse (49). BBDR rats were injected with 1 x 106 PFU of VV and their ovaries and pancreatic lymph nodes recovered 2 or 3 days later. As shown in Fig. 5, VV virokine mRNA was detected in both ovaries and pancreatic lymph nodes of infected animals at both time points.
|
|
We next investigated cytokine and chemokine mRNA expression in lymphoid organs. These studies used young BBDR or WF rats that were untreated or infected with 1 x 107 PFU of KRV or 1 x 106 PFU of VV. Lymphoid organs were recovered 45 days later, and mRNA expression was assessed by quantitative RT-PCR. The data are presented as the ratio of cytokine or chemokine mRNA expression to
-actin mRNA expression.
IL-12 p40 after KRV infection.
In BBDR rats infected with KRV the level of IL-12 p40 mRNA in pancreatic, cervical, and MLNs was significantly increased in comparison with that observed in uninfected controls (Fig. 6A). The increase in IL-12 p40 mRNA expression relative to
-actin was higher in the pancreatic lymph nodes than in either cervical or mesenteric lymph nodes (p < 0.05). In contrast, in WF rats infected with KRV the level of IL-12 p40 mRNA was significantly increased only in pancreatic and MLNs as compared with that observed in uninfected controls, with the greater relative increase in IL-12 p40 mRNA observed in MLNs (Fig. 6B, p < 0.05). Splenic expression of IL-12 p40 appeared not to change in either BBDR or WF rats as a function of infection, but the numbers analyzed were small.
|
-actin was highest in the cervical lymph nodes (p < 0.005). In WF rats infected with KRV, the level of IP-10 mRNA was significantly increased in pancreatic, cervical, and mesenteric lymph nodes (Fig. 6D) as compared with uninfected controls. The relative increase in IP-10 mRNA was statistically similar in these tissues (p = NS). Splenic expression of IP-10 in infected BBDR and WF rats appeared to increase somewhat, but the numbers analyzed were small and the changes were not statistically significant.
IFN-
after KRV infection.
In BBDR rats infected with KRV, the level of IFN-
mRNA in pancreatic, cervical, and MLNs was significantly increased in comparison with that observed in uninfected controls (Fig. 6E). The increase in IFN-
mRNA expression relative to
-actin was highest in the cervical lymph nodes (p < 0.025). In WF rats infected with KRV, the level of IFN-
mRNA was significantly increased in pancreatic, cervical, and MLNs as compared with uninfected controls (Fig. 6F). The relative increase in IFN-
mRNA was statistically higher in pancreatic and cervical lymph nodes than in MLNs (p < 0.05). Splenic expression of IFN-
in infected BBDR and WF rats appeared to increase somewhat, but the numbers analyzed were small and the changes were not statistically significant.
IL-12 p40, IP-10, and IFN-
mRNA expression in pancreatic lymph nodes after infection with VV.
We next measured the level of cytokine and chemokine mRNA expression in pancreatic lymph nodes of animals that had been infected with 1 x 106 PFU of VV 4 days earlier. The results are shown in Fig. 7. In contrast to BBDR rats infected with KRV, we observed that the level of IL-12 p40 mRNA in pancreatic lymph nodes did not increase significantly in VV-infected animals as compared with uninfected controls. Levels of IP-10 and IFN-
mRNA in the pancreatic lymph nodes of VV-infected animals were, however, both modestly increased in comparison with uninfected controls (Fig. 7, p < 0.05).
|
To confirm that the increases in IP-10 mRNA expression in the pancreatic lymph nodes of virus-infected rats were, in fact, indicative of increased protein expression, we performed Western blot analyses. BBDR rats were infected with 1 x 106 PFU of VV or 1 x 107 PFU of KRV, and tissues were recovered for analysis on days 4 and 5, respectively.
Expression of IP-10 protein in pancreatic lymph nodes was observed in both KRV and VV-infected rats (Fig. 8). Quantitative densitometry revealed that the increase in IP-10 protein was greater in KRV-infected BBDR rats than in VV-infected animals (p < 0.03). These data are consistent with a virus-specific effect on the magnitude of the innate immune response of BBDR rats.
|
One mechanism by which TLR ligation could synergize with KRV infection to enhance innate immune responses and induce diabetes is by enhancing virus replication. To test this hypothesis, BBDR rats were infected with 1 x 107 PFU of KRV with or without pretreatment with poly(I:C) and then assayed by quantitative RT-PCR for the presence of KRV nonstructural mRNA. We first confirmed that injection of KRV alone leads to active infection in cervical, mesenteric, and pancreatic lymph nodes of BBDR rats 45 days after infection (Fig. 9A). To determine whether TLR ligation increases the replication of KRV, we then assessed the expression of KRV nonstructural mRNA in animals treated with 1 x 107 PFU of KRV preconditioned with poly(I:C) injections. We observed that the level of KRV mRNA in pancreatic lymph nodes of BBDR rats 5 days after infection with KRV was similar to that in animals treated with a combination of poly(I:C) and KRV (Fig. 9B, p = NS). As expected, KRV mRNA was not detected in pancreatic lymph nodes of uninfected control BBDR rats.
|
| Discussion |
|---|
|
|
|---|
transcripts in pancreatic lymph nodes, we determined that innate immune system activation is both virus-specific and host strain-dependent. Specifically, diabetogenic viruses and diabetes susceptible rat strains exhibited the highest levels of innate immune system activation. The mechanism by which TLR ligation and subsequent KRV infection synergize to induce diabetes may involve TLR-mediated maturation of DCs (18, 21, 22, 53, 54). TLR ligation is known to enhance DC costimulation, increase expression of MHC molecules, induce DC migration to lymph nodes, and stimulate production of a set of proinflammatory cytokines and chemokines (55). We hypothesize that the maturation of DCs drives forward the autoreactive T cell response that causes insulitis and diabetes in the BB rat (5). This autoreactive T cell response could in theory be generated either de novo by KRV itself or "unmasked" by the documented ability of KRV to reduce T regulatory cell populations. We suggest that the latter possibility, which has received previous experimental support (10, 11), is further supported by our observation that pretreatment with TLR agonists enables subdiabetogenic doses of KRV to induce diabetes.
We have previously documented that poly(I:C), a ligand for TLR3 (56), enhances the expression of diabetes in BBDR rats depleted of regulatory T cells (7) or infected with KRV (6, 11, 57, 58). The present data extend those observations by documenting that ligation of many members of the rat TLR family can synergize with KRV to induce diabetes. The result suggests that activation of the innate immune system generically enhances the ability of diabetogenic infectious agents to induce disease in genetically susceptible hosts. This inference is consistent with many recent observations. It has been shown, for example, that pre-existing autoreactive T cell populations can be activated by stimulation of an innate immune response using either an agonistic anti-CD40 mAb or CpG oligonucleotide (59, 60). Another study has shown that poly(I:C) exacerbates autoimmunity induced by insulin immunization in transgenic mice expressing B7-2 molecules on their islets (61). Studies involving the experimental autoimmune encephalitis (EAE) model of multiple sclerosis have been particularly informative in this regard. Mice deficient for the TLR signaling molecule, IL-1R-associated kinase-1 fail to develop EAE (62). Conversely, in both the rat (63) and mouse (64), activation of innate immunity by microbial products or TLR ligands breaks self tolerance and stimulates autoreactive T cells to induce EAE.
The EAE results and our data from diabetic BBDR rats might be thought to predict that innate immune system activation would also enhance the expression of autoimmune diabetes in the NOD mouse model of type 1 diabetes, but this is not the case. Both purified TLR agonists and the overwhelming majority of infectious agents (26, 30, 31, 34, 65, 66, 67) reduce the frequency of diabetes in NOD mice and often prevent it entirely (68). The reason for this difference between BBDR rats and NOD mice is not clear but could be related to the multiple immune system abnormalities that are found in NOD mice, particularly in their innate immune responses (69, 70). The immune response of the BBDR rat is relatively normal in comparison (5). Correction of defective innate immune responses in NOD mice would be hypothesized to prevent autoimmune diabetes. Consistent with this hypothesis, it has recently been shown that activation of NKT cells prevents diabetes in NOD mice by inducing the maturation of DCs (71). TLR agonists may act in a similar way in this strain.
Why infection with KRV but not with VV or H-1 induces diabetes in the BBDR rat is a fascinating but unanswered question. There are at least three possible mechanisms, but at present each must be regarded as speculative. First, it is known that KRV, but not H-1 infection down-modulates regulatory T cells in BBDR rats (11). Although only a correlation, it is possible that a reduction in T regulatory cells could disequilibrate the regulatory-to-effector T cell balance in favor of effector T cells, favoring the expression of diabetes. Whether vaccinia behaves like H-1 in this regard is not yet known. Second, the site and extent of viral proliferation could be important. We show that KRV induces a higher degree of viral mRNA expression in pancreatic lymph nodes than does vaccinia. Higher levels of infectious virus could exacerbate the ensuing proinflammatory response, leading in turn to the accumulation of mature APCs able to activate autoreactive T cells in pancreatic lymph nodes. Preliminary data (not shown) suggest that, like vaccinia, H-1 leads to only weak expression of viral mRNA in pancreatic lymph nodes. Third, KRV may induce diabetes because it may itself induce a relatively strong innate immune response. We observed that KRV induces high levels of IL-12 p40 in the blood and high levels of IL-12 p40 transcripts in pancreatic lymph nodes. It also induces high IP-10 protein expression in pancreatic lymph nodes. These data suggest that KRV induces a potent proinflammatory response that could activate autoreactive T cells (72). Our finding that infection with VV induces a relatively weak host innate immune response in the pancreatic lymph nodes supports this hypothesis and is consistent with recent data demonstrating that VV interferes with TLR signaling (73).
Type 1 diabetes in humans is hypothesized to result from nongenetic environmental factors (e.g., virus) operating in a genetically susceptible host (74, 75), but the nature of that genetic susceptibility, apart from MHC haplotype, is poorly understood. The present data suggest that genetically determined differences in innate immunity may be important. We have observed that innate immune system activation in the rat is not only virus-specific but also host strain-specific. BBDR and WF rats are MHC-identical, but only the former is readily susceptible to the induction of diabetes by poly(I:C) and regulatory T cell depletion (5). This susceptibility is in significant measure due to a genetic locus designated Iddm4 (76, 77, 78), and WF rats that are congenic for the Iddm4 locus become susceptible to diabetes induction. However, WF rats with the Iddm4 diabetes susceptibility locus are completely resistant to the expression of diabetes following infection with KRV (79). These genetic analyses suggest that additional genetic components must be involved, and the present data point to genes that regulate the innate immune response as strong candidates. We observed that induction of IL-12 p40 by KRV infection in WF rats is decreased relative to that induced in BBDR rats. Genetic variation in the ability of strains of rats to produce IFN in response to poly(I:C) is not a new observation (80), and ongoing studies in our laboratories are investigating the contribution of the host strain innate immune response in the pathogenesis of diabetes. We have observed in preliminary studies that the LEW.1WR1 rat is even more susceptible than the BBDR rat to the induction of autoimmune diabetes in response to viral infection (50), and it will be of interest to compare the innate immune responses of these two strains.
The downstream mechanisms by which cytokines and chemokines associated with innate immune activation facilitate the induction of virus-induced diabetes are not clear. We observed high levels of IL-12 p40 in sera of KRV-infected animals whereas levels of IL-12 p70 were undetectable. The reason for this discordance is unclear, but it suggests that the IL-12 p40 is not part of an IL-12 p70 complex. Accordingly, the IL-12 p40 present in the sera of infected rats may be present as a homodimer. Interestingly, it has been suggested that, in the mouse, IL-12 p40 homodimers may have anti-inflammatory activity and act as an antagonist of IL-12 p70 (81). Previous reports have suggested that IL-12 p40 and IFN-
participate in the pathogenesis of autoimmune diabetes in humans (82), NOD mice (82, 83, 84), and BBDR rats (85). IL-12 p40 and IFN-
participate in the induction and differentiation of pathogenic islet-reactive Th1 T cells, and administration of IL-12 to NOD mice accelerates diabetes onset (83). IFN-
has both pathogenic (84, 86) and protective roles in the development of diabetes in the NOD mouse (84). As pointed out above, however, the response of NOD mice to infection or purposive activation of innate immunity prevents diabetes. Whether IL-12 p40 and IFN-
have comparable effects in the BBDR rat is not known.
The role of IP-10 is similarly unproven, but speculatively it could contribute to the pathogenesis of virus-induced diabetes in BBDR rats by attracting autoreactive T cells to inflamed pancreatic lymph nodes. IP-10 levels are increased in humans with type 1 diabetes (87), and it is up-regulated in islet-reactive Th1 but not Th2 cells in NOD mice (87, 88). High levels of IP-10 can be induced in many cell types, including B cells, dendritic cells, and macrophages after stimulation with IFN-
, IFN-
, IFN-
(89), TLR ligation (89, 90) or viral infection (91, 92, 93). The level of IP-10 expression in some diseases correlates with the extent of T lymphocyte infiltration into sites of inflammation; in the case of autoimmune diabetes, up-regulation of this chemokine could lead to the recruitment of T cells to the inflamed islets (87, 94).
In summary, our data document a strong linkage between innate immune system activation and viral induction of diabetes in BBDR rats. This linkage appears to be both virus-specific and host strain-dependent. The data suggest possible mechanisms by which a nongenetic environmental factor could act in a genetically susceptible host to induce the expression of autoimmunity. Speculatively, the data also suggest that concurrent activation of the innate immune system activation by different TLR ligands (e.g., bacterial infection in temporal proximity to viral infection) could determine whether type 1 diabetes develops in an individual with a genetic makeup that confers both a high risk MHC haplotype and a robust innate immune response.
| Acknowledgments |
|---|
| Footnotes |
|---|
1 This work was supported in part by National Institutes of Health Grants DK49106, DK36024, and DK25306, Diabetes and Endocrinology Research Center Grant DK32520 from the National Institutes of Health, and a grant from the Iacocca Foundation. The contents of this publication are solely the responsibility of the authors and do not necessarily represent the official views of the National Institutes of Health. ![]()
2 Address correspondence and reprint requests to Dr. Aldo A. Rossini, Diabetes Division, University of Massachusetts Medical School, Two Biotech, Suite 218, 373 Plantation Street, Worcester, MA 01605. E-mail address: aldo.rossini{at}umassmed.edu ![]()
3 Abbreviations used in this paper: KRV, Kilham rat virus; PAMP, pathogen-associated molecular pattern; DC, dendritic cell; VV, vaccinia virus; PGN, peptidoglycan; MLN, mesenteric lymph node; IP-10, IFN-
-inducible protein-10; EAE, experimental autoimmune encephalitis. ![]()
Received for publication June 30, 2004. Accepted for publication October 4, 2004.
| References |
|---|
|
|
|---|
cell reactive T cells in NOD mice. J. Exp. Med. 196:369.
B by Toll-like receptor 3. Nature 413:732.[Medline]
-deficient nonobese diabetic mice, revealing pathogenic and protective effects of IL-12-induced IFN-
. J. Immunol. 170:5491.
and IL-12 p40 mRNA increase with age in both diabetic and insulin treated nondiabetic BB rats. J. Immunol. 156:1315.[Abstract]
. J. Autoimmun. 4:237.[Medline]
-inducible chemokine IP-10/CXCL10 are augmented in both newly diagnosed type I diabetes mellitus patients and subjects at risk of developing the disease. Diabetologia 45:1107.[Medline]
-inducible protein-10 production is regulated by plasmacytoid dendritic cell-derived IFN-
. J. Immunol. 170:4061.
-inducible protein 10 (IP-10; CXCL10)-deficient mice reveal a role for IP-10 in effector T cell generation and trafficking. J. Immunol. 168:3195.Related articles in The JI:
This article has been cited by other articles:
![]() |
P. CHOPRA, P. DIIORIO, S. C. PINO, S. B. WILSON, N. E. PHILLIPS, J. P. MORDES, A. A. ROSSINI, D. L. GREINER, L. D. SHULTZ, and R. BORTELL Failure of {alpha}-Galactosylceramide to Prevent Diabetes in Virus-inducible Models of Type 1 Diabetes in the Rat In Vivo, March 1, 2009; 23(2): 195 - 201. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. B. Ganesh, D. M. Cheatem, J. R. Sheng, C. Vasu, and B. S. Prabhakar GM-CSF-induced CD11c+CD8a--dendritic cells facilitate Foxp3+ and IL-10+ regulatory T cell expansion resulting in suppression of autoimmune thyroiditis Int. Immunol., March 1, 2009; 21(3): 269 - 282. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Filippi and M. G. von Herrath Viral Trigger for Type 1 Diabetes: Pros and Cons Diabetes, November 1, 2008; 57(11): 2863 - 2871. [Full Text] [PDF] |
||||
![]() |
X. Huang, D. J. Moore, R. J. Ketchum, C. S. Nunemaker, B. Kovatchev, A. L. McCall, and K. L. Brayman Resolving the Conundrum of Islet Transplantation by Linking Metabolic Dysregulation, Inflammation, and Immune Regulation Endocr. Rev., August 1, 2008; 29(5): 603 - 630. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhao, K. D. Kim, X. Yang, S. Auh, Y.-X. Fu, and H. Tang From the Cover: Hyper innate responses in neonates lead to increased morbidity and mortality after infection PNAS, May 27, 2008; 105(21): 7528 - 7533. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. D. McCall, N. Harii, C. J. Lewis, R. Malgor, W. Bae Kim, M. Saji, A. D. Kohn, R. T. Moon, and L. D. Kohn High Basal Levels of Functional Toll-Like Receptor 3 (TLR3) and Noncanonical Wnt5a Are Expressed in Papillary Thyroid Cancer and Are Coordinately Decreased by Phenylmethimazole Together with Cell Proliferation and Migration Endocrinology, September 1, 2007; 148(9): 4226 - 4237. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Zipris, E. Lien, A. Nair, J. X. Xie, D. L. Greiner, J. P. Mordes, and A. A. Rossini TLR9-Signaling Pathways Are Involved in Kilham Rat Virus-Induced Autoimmune Diabetes in the Biobreeding Diabetes-Resistant Rat J. Immunol., January 15, 2007; 178(2): 693 - 701. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Roelofs, W. C. Boelens, L. A. B. Joosten, S. Abdollahi-Roodsaz, J. Geurts, L. U. Wunderink, B. W. Schreurs, W. B. van den Berg, and T. R. D. J. Radstake Identification of Small Heat Shock Protein B8 (HSP22) as a Novel TLR4 Ligand and Potential Involvement in the Pathogenesis of Rheumatoid Arthritis. J. Immunol., June 1, 2006; 176(11): 7021 - 7027. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Fujinami, M. G. von Herrath, U. Christen, and J. L. Whitton Molecular Mimicry, Bystander Activation, or Viral Persistence: Infections and Autoimmune Disease Clin. Microbiol. Rev., January 1, 2006; 19(1): 80 - 94. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Rasschaert, L. Ladriere, M. Urbain, Z. Dogusan, B. Katabua, S. Sato, S. Akira, C. Gysemans, C. Mathieu, and D. L. Eizirik Toll-like Receptor 3 and STAT-1 Contribute to Double-stranded RNA+ Interferon-{gamma}-induced Apoptosis in Primary Pancreatic {beta}-Cells J. Biol. Chem., October 7, 2005; 280(40): 33984 - 33991. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |