The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sakurai, D.
Right arrow Articles by Tokunaga, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sakurai, D.
Right arrow Articles by Tokunaga, K.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
The Journal of Immunology, 2004, 173: 5801-5809.
Copyright © 2004 by The American Association of Immunologists

Crucial Role of Inhibitor of DNA Binding/Differentiation in the Vascular Endothelial Growth Factor-Induced Activation and Angiogenic Processes of Human Endothelial Cells1

Daisuke Sakurai*, Naoyuki Tsuchiya2,*, Akihiro Yamaguchi{dagger}, Yurai Okaji{ddagger}, Nelson H. Tsuno§, Tetsuji Kobata, Koki Takahashi§ and Katsushi Tokunaga*

Departments of * Human Genetics, {dagger} Allergy and Rheumatology, {ddagger} Surgical Oncology, and § Transfusion Medicine, Graduate School of Medicine, University of Tokyo, Tokyo, Japan; and Division of Immunology, Institute for Medical Science, Dokkyo University School of Medicine, Tochigi, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Angiogenesis plays a pivotal role in the aggressive proliferation of synovial cells in rheumatoid arthritis. We have previously reported the overexpression of inhibitor of DNA binding/differentiation (Id) in the endothelial cells within the synovial tissues of rheumatoid arthritis. In this study, we investigated the role of Id in inflammation and angiogenesis in an in vitro model using HUVECs. Vascular endothelial growth factor (VEGF) and TGF{beta} induced the expression of Id1 and Id3 in HUVECs. Forced expression of Id induced proliferative activity in HUVECs accompanied by down-regulation of p16INK4a. Overexpression of Id enhanced expression of ICAM-1 and E-selectin, and induced angiogenic processes such as transmigration, matrix metalloproteinase-2 and -9 expression, and tube formation. In contrast, knockdown of Id1 and Id3 with RNA interference abolished proliferation, activation, and angiogenic processes of HUVECs induced by VEGF. These results indicated that Id plays a crucial role in VEGF-induced signals of endothelial cells by causing activation and potentiation of angiogenic processes. Based on these findings, it was proposed that inhibition of expression and/or function of Id1 and Id3 may potentially be of therapeutic value for conditions associated with pathological angiogenesis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Angiogenesis (1), along with recruitment of inflammatory cells, production of proinflammatory cytokines (2), and aggressive proliferation of fibroblast-like synoviocytes (3), is critically involved in the process of chronic inflammation and joint destruction in rheumatoid arthritis (RA).3 In the previous study, through a comprehensive analysis of mRNA in the synovial tissues, we identified overexpression of inhibitor of DNA binding/differentiation (Id) family proteins, Id1 and Id3, and their localization to the endothelial cells, within the synovial tissues of RA (4).

The Id family consists of four members, Id1 to Id4, which contain helix-loop-helix (HLH) domains, but not DNA binding domains (5). Id proteins were originally identified as dominant-negative antagonists of the basic HLH transcription factors such as MyoD (5) as well as non-basic HLH proteins such as Rb (6), and have been known to play a crucial role in developmental processes (7, 8, 9, 10, 11). They are predominantly expressed in fetal tissues and in some transformed cells (12), and are down-regulated during differentiation (13, 14). Id also controls cell proliferation and the progression of cell cycle (15). Id has been shown to repress p16INK4a expression by directly inhibiting the binding of Ets1 and Ets2 transcription factors to p16INK4a promoter (16), and to prevent exit from the cell cycle. Expression of Id3 is regulated by Ras-ERK MAPK cascade (17) and Smad1/5 signaling (18).

A previously unsuspected role of Id was recently disclosed. Id1+/–Id3–/– mice were unable to support angiogenesis necessary for the progression of tumor xenografts (19), suggesting that Id1 and Id3 may also be required for the angiogenesis in adult tissues. We hypothesized that the localization of Id within the synovial endothelial cells in RA (4) may imply involvement of Id in the inflammation and angiogenesis typically observed in the synovial tissues of RA. If this is the case, Id can be an attractive target for the treatment not only of cancer, but also of RA, because expression of Id is usually weak in normal adult tissues, except for the proliferating cells (20).

In the present study, we examined whether the overexpression of Id alone can induce activation and angiogenesis in cultured human endothelial cells, and whether suppression of Id can inhibit activation and angiogenic processes of these cells induced by vascular endothelial growth factor (VEGF).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Monoclonal Abs

The mAbs used for flow cytometry were as follows: FITC-labeled anti-human {alpha}v integrin (Beckman Coulter, Fullerton, CA), PE-labeled anti-human ICAM-1 (Beckman Coulter), PE-labeled anti-human {beta}1 integrin (DakoCytomation, Carpinteria, CA), CyChrome-labeled anti-human E-selectin (BD Biosciences, San Jose, CA), and unlabeled anti-human {alpha}2 integrin (DakoCytomation). MsIgG1-RD1/MsIgG1-FITC (Beckman Coulter), IgG1-PE (Beckman Coulter), IgG1-CyChrome (BD Biosciences), and unlabeled IgG1 (DakoCytomation) were used as isotype controls.

Endothelial cell culture and transient transfection

Primary HUVECs were isolated as previously described (21) and cultured in MCDB151 medium (Sigma-Aldrich, St. Louis, MO) supplemented with 10% heat-denatured FBS (HyClone, Logan, UT), 500 µg/ml heparin (Sigma-Aldrich), and 2 ng/ml human acidic fibroblast growth factor (FGF; PeproTech, London, U.K.) in dishes treated with 0.1% gelatin (Wako Pure Chemical, Osaka, Japan). Cells were cultured at 37°C in an atmosphere of 5% CO2, and routinely passaged by trypsinization when achieving confluence. HUVECs used in all experiments were of up to seven passages.

Transfection was performed using Effectene Transfection Reagent (Qiagen, Hilden, Germany). Overexpression of ID genes in HUVECs was achieved using pBLAST49-hId1a(c) and pBLAST49-hId3(c) plasmid vectors (InvivoGen, San Diego, CA). pBLAST49-mcs (InvivoGen) was used as a negative control.

To knockdown ID1 and ID3, small hairpin RNAs (shRNAs) were designed. The sequences of ID1- and ID3 shRNAs were as follows: TCCCAAAGAATCATGAAAGTCGCCAGTTCAAGAGACTGGCGACTTTCATGATTCTTTT and TCGGATCCAACCTCACAGCACCTCACTTCTTCAAGAGAGAAGTGAGGTGCTGTGAGGTTTTTTTTGGAAAAGCTTGG, respectively, with 3' single-strand overhangs for ligation into RNA expression vectors (psiRNA-hH1 neo (InvivoGen) for Id1; pSilencer 2.0-U6 (Ambion, Austin, TX) for Id3) containing H1 or U6 RNA polymerase III promoter.

Transfection efficiency was examined using X-Gal staining assay (Gene Therapy Systems, San Diego, CA). LacZ expression vector was transfected into HUVECs under the same conditions in which Id3 transfectants and Id1/Id3 RNAi transfectants were generated. After incubation for 24 h, the cells were placed in the fixing buffer for 15 min at room temperature. Then, X-Gal staining solution was added to the dishes, and the cells were incubated for 10 h at 37°C. After incubation, stained and unstained cells were counted. The transfection efficiency was determined to be 62.6 ± 9.6%.

Endotoxin levels in the vector preparations were measured using endotoxin detection kit based on Limulus amebocyte lysate assay (Endospecy ES-50M; Seikagaku Corporation, Tokyo, Japan). Contamination of endotoxin was undetectable.

RT-PCR

Total RNA was isolated from the cells using RNeasy Mini kit (Qiagen), and was treated with DNase inhibitor (DNA-free (Ambion)). First-strand cDNAs were synthesized from RNA using ImProm-II reverse transcription system (Promega, Madison, WI). Quantitative RT-PCR was performed using a real-time RT-PCR machine (LightCycler), with LightCycler FastStart DNA Master SYBR Green I (Roche Diagnostics, Mannheim, Germany) and gene-specific primer sets. The data were analyzed by fit-points method using the LightCycler analysis software. {beta}-Actin or GAPDH were used to normalize total RNA levels. The assays were done in triplicate.

Induction of Id1 and Id3 in HUVECs after stimulation for 24 h by VEGF (20 ng/ml), TGF{beta} (0.5 ng/ml), TNF-{alpha} (20 ng/ml), or IL-1{beta} (1 ng/ml) (all from PeproTech) was examined by conventional RT-PCR. The PCR products were electrophoresed, stained with SYBR Gold (Molecular Probes, Eugene, OR), and relative mRNA levels were calculated from the band intensity using {beta}-actin as a reference.

Because the ordinary culture medium for HUVEC contained acidic FGF, the effect of basic FGF (bFGF; PeproTech) for the induction of Id1 and Id3 was examined under a different culture condition. HUVECs were cultured in serum-free medium (Human Endothelial-SFM; Invitrogen Life Technologies, Carlsbad, CA) supplemented with epidermal growth factor (10 ng/ml; Invitrogen Life Technologies) in accordance with the manufacturer’s instruction, in the presence or absence of bFGF (10 ng/ml). After 72 h, Id1 and Id3 mRNA levels were quantitated as described above.

The primer pairs used for RT-PCR were the following: Id1, 5'-AGCCAGTCCGCCAAGAATCAT-3' (forward), 5'-ACTCACTCCCCAGCATGAAG-3' (reverse); Id3, 5'-CTCCACGCTCTGAAAAGACC-3' (forward), 5'-ACTCAGATTAAGCCAGGTGGA-3' (reverse); p16INK4a, 5'-AGCCTTCGGCTGACTGGCTGG-3' (forward), 5'-GCAGTTAAGGGGGCACGAGTG-3' (reverse); ICAM-1, 5'-ACCTGGCAATGCCCAGACATCTGTGT-3' (forward), 5'-GTACACGGTGAGGAAGGTTTTAGCTGTTG-3' (reverse); E-selectin, 5'-AAAACTTCCATGAGGCCAAA-3' (forward), 5'-GCATTCCTCTCTTCCAGAGC-3' (reverse); matrix metalloproteinase (MMP)2, 5'-ATGACAGCTGCACCACTGAG-3' (forward), 5'-TGATGTCATCCTGGGACAGA-3' (reverse); and MMP9, 5'-GGCGCTCATGTACCCTATGT-3' (forward), 5'-CCCTCAGTGAAGCGGTACAT-3' (reverse).

Cell proliferation assay

The proliferative activity of HUVECs was measured using the WST-1 cell proliferation assay (Takara Bio, Otsu, Japan). Cells were cultured on gelatin-coated flat-bottom 96-well microtiter plate at 2 x 104 cells/well. After 24 h, 10 µl of WST-1 solution was added to each well, and the cells were incubated at 37°C in an atmosphere of 5% CO2 for 4 h. The supernatant solutions were transferred to a new 96-well plate, and the absorbance of each well was measured at 480 nm. Experiments were performed in triplicate, and the proliferative activity was calculated as the mean ± SD of the triplicate wells divided by that of the controls.

Apoptosis induction

Apoptosis was induced in Id1-, Id3-, or mock-transfected HUVECs by serum deprivation (22). After the cells were cultured without FBS for 48 h, apoptotic cells were detected with Annexin V-FITC staining (Annexin V-FITC kit; Beckman Coulter). Freshly split HUVECs with or without treatment with agonistic anti-Fas/CD95 Ab (7C11; Beckman Coulter) were used as positive and negative controls, respectively.

Flow cytometry

HUVECs were harvested by washing with 0.02% EDTA-PBS followed by treatment with trypsin-EDTA (InvivoGen), resuspended in PBS containing 0.1% BSA (Sigma-Aldrich) and 0.1% sodium azide, and incubated for 30 min with 50 ng/ml human {gamma}-globulin (Sigma-Aldrich) at room temperature, to block for nonspecific binding.

For direct immunofluorescence staining, the cells were incubated with fluorescence-labeled mAbs or the isotype-matched controls for 30 min on ice, and then washed three times using a washing buffer consisting of PBS containing 0.2% BSA and 0.1% sodium azide. For indirect immunofluorescence staining, the cells were incubated with unlabeled primary mAbs or the isotype-matched Abs for 30 min on ice, washed with washing buffer, and then incubated with PE-conjugated goat anti-mouse IgG (Beckman Coulter), followed by another washing in washing buffer. Fluorescence intensity was analyzed in the EPICS XL (Beckman Coulter) or in the FACSCalibur (BD Biosciences).

Transmigration assay

Transmigration assays were performed using 8-µm-pore Transwell chambers (Corning, Corning, NY). HUVECs harvested by trypsinization were resuspended in MCDB151 medium containing 0.2% BSA, and seeded at 1 x 104 cells per well on the gelatin-coated upper chambers. Lower chambers were filled with 600 µl of the same medium supplemented with 10% FBS without or with either VEGF (20 ng/ml) or IL-1{beta} (0.5 ng/ml). After incubation for 8 h at 37°C, 60 µl of 0.2% EDTA-PBS was added to the lower wells, and cells were harvested. The number of cells in the region corresponding to endothelial cells was counted in the EPICS, after acquiring cells in each sample for 50 s. The assays were done in triplicate.

Zymography

HUVECs were seeded on uncoated 100-mm dishes at 1 x 106 cells/well and were incubated with a 1:1 mixture of serum-free DMEM and F-12 Ham’s medium (Sigma-Aldrich) for 12 h at 37°C. Then, supernatants were collected and, after removal of cells by centrifugation, were concentrated using the Centricon YM-10 concentrator (Millipore, Bedford, MA). Samples were then diluted with the same volume of sample buffer, and the MMPs were separated in SDS-PAGE using 10% polyacrylamide gels containing 0.1% gelatin. The gels were then incubated in 6.25% Triton X-100 (Wako Pure Chemical) for 1 h to remove SDS, and then placed for overnight in an incubation buffer containing 5 mM CaCl2 and 1 µM ZnCl2 for development of enzyme activity. The gels were stained using Coomassie brilliant blue and destained in methanol/acetic acid. Gelatinase activity was detected as unstained bands.

In vitro tube formation

In vitro tube formation assay was performed using the Matrigel basement membrane matrix (BD Biosciences). Matrigel, kept on ice, was placed at 1 ml/well in six-well culture plates. The plates were then incubated at 37°C for 30 min to allow Matrigel to solidify. HUVECs were seeded at 5 x 104 cells per well on the top of the solidified Matrigel in the presence or absence of VEGF, and the plate was incubated at 37°C for 24 h. Tube formation on Matrigel was observed and analyzed under the microscope. The degree of angiogenesis was measured by multiplying the number of branch points by the total number of branches (23).

Statistics

Statistical significance was analyzed with Student’s unpaired t test using StatView for Windows, version 5.0 (SAS Institute, Cary, NC).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Induction of Id expression by VEGF and TGF{beta} in HUVECs

To gain insight into the significance of Id in relation to physiological endothelial cell activation and angiogenesis, we examined whether mRNA expression of Id1 and Id3 could be induced by known stimulators of endothelial cells such as VEGF, TGF{beta}, TNF-{alpha}, IL-1{beta}, and bFGF. Significant up-regulation was observed for Id1 and Id3 mRNA when stimulated with VEGF (20 ng/ml) or TGF{beta} (0.5 ng/ml) (Fig. 1a). In contrast, expression of Id was not induced by IL-1{beta}, TNF-{alpha}, or bFGF (Fig. 1, b and c).



View larger version (43K):
[in this window]
[in a new window]
 
FIGURE 1. Expression of ID1 and ID3 mRNA is induced in HUVECs by VEGF or TGF{beta}. a and b, Id1 and Id3 mRNA levels were measured in HUVECs with or without stimulation with VEGF (20 ng/ml), TGF{beta} (0.5 ng/ml) (a), TNF-{alpha} (20 ng/ml), or IL-1{beta} (1 ng/ml) (b) for 24 h. HUVECs transfected with ID1 (Id1-t) or ID3 (Id3-t) were used as the positivecontrols. c, In the case of bFGF, to exclude influence from acidic FGF contained in the ordinary culture medium, HUVECs were cultured in serum-free medium supplemented with epidermal growth factor for 72 h, in the presence or absence of bFGF (10 ng/ml). The densitometric intensity of each band was normalized to {beta}-actin, and intensities relative to the control cells are shown under each panel.

 
Induction of proliferation of HUVECs by overexpression of Id

Next, we asked whether overexpression of Id alone could induce activation and proliferation of HUVECs. To address this question, transient overexpression of Id1 or Id3 was induced in HUVECs by transfection (Fig. 2a). Proliferation was significantly enhanced in both transfectants as compared with mock transfectant, to levels similar to the proliferative activity of untransfected HUVECs when stimulated with VEGF (Fig. 2b).



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 2. Overexpression of ID1 or ID3 induces proliferation of HUVECs. a, pBLAST49-hId1a(c) (Id1-t), pBLAST49-hId3(c) (Id3-t), or pBLAST49-mcs (mock-t) vector was transfected into HUVECs. Total RNA was isolated from each transfectant, and Id1 or Id3 mRNA level was sequentially quantitated using real-time RT-PCR. b, Proliferation of HUVECs at 24 h after transfection. Id1-t and Id3-t exhibited significantly higher proliferation in the absence of VEGF, compared with mock transfectants. Proliferation of Id transfectants was comparable with that of untransfected HUVECs stimulated with 10 ng/ml VEGF. Proliferation was measured using WST-1 assay. c, p16INK4a mRNA levels of ID3 and mock transfectants were measured with real-time RT-PCR. p16INK4a mRNA expression was inversely correlated with Id3 mRNA shown in a. d, Apoptosis was induced in Id1, Id3, or mock transfectants by serum deprivation for 48 h, and the cells were stained with Annexin V-FITC. Freshly split HUVECs with or without treatment with agonistic anti-Fas/CD95 Ab (7C11) were used as positive and negative controls, respectively. Apoptosis induction was inhibited by overexpression of Id3, but not by Id1.

 
Id has been shown to regulate the cell cycle via transcriptional regulation of p16INK4a (16). In Id transfectants, the p16INK4a expression was found to be inversely correlated with expression level of ID mRNA (Fig. 2, a and c).

Id has also been shown to regulate apoptosis either positively or negatively, depending on the cell types (24, 25). The effect of Id overexpression on apoptosis was examined by serum starvation-induced apoptosis model. After the cells were cultured for 48 h without FBS, Id1 and mock transfectants exhibited comparable enhancement of annexin V binding compared with freshly split HUVEC. In contrast, annexin V binding was significantly inhibited in Id3 transfectants, suggesting that overexpression of Id3, but not Id1, inhibits HUVEC apoptosis induced by serum starvation (Fig. 2d).

Induction of activation markers in HUVECs by overexpression of Id

To examine whether Id overexpression alone can induce activation of HUVECs, we measured the expression levels of ICAM-1 (CD54) and E-selectin (CD62E) after transfection of Id1 or Id3 in the absence of VEGF. mRNA levels of ICAM-1 was significantly increased both in Id1 and Id3 transfectants (Fig. 3, a and c). Correspondingly, the cell surface expression of ICAM-1 was significantly up-regulated in Id1 transfectants (Fig. 3a) and, to a lesser extent, in Id3 transfectants (c). In contrast, mRNA level and surface expression of E-selectin was clearly up-regulated in Id3 transfectants (Fig. 3d) but not in Id1 transfectants (b). These results suggested that both Id1 and Id3 can induce activation of HUVEC, but their downstream pathways may not be identical.



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 3. Overexpression of Id1 or Id3 induces activation of HUVECs. a and b, mRNA levels and surface expression of ICAM-1 (a) and E-selectin (b) in Id1 transfectants at 24 h after transfection. c and d, Kinetics of ICAM-1 (c) and E-selectin (d) mRNA levels in Id3 transfectants (left) and surface expression at 24 h. Significant up-regulation of ICAM-1 was observed in both transfectants, whereas expression of E-selectin was up-regulated only in Id3 transfectants.

 
Induction of angiogenic processes by overexpression of Id

We next examined whether overexpression of Id in HUVECs can induce angiogenesis. Both Id1 and Id3 transfectants exhibited significant increase in the transmigration activity, especially when the cells were cultured with IL-1{beta} (0.5 ng/ml) or VEGF (20 ng/ml) (Fig. 4a).



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 4. Overexpression of Id1 or Id3 induces angiogenic properties in HUVECs. a, Transmigration assay. Id1-t and Id3-t demonstrated significant increase in the transmigration activity, especially when the cells were stimulated with IL-1{beta} (0.5 ng/ml) or VEGF (20 ng/ml). b, mRNA levels of MMP2 and MMP9. MMP2 and MMP9 expression was significantly increased in Id1-t and Id3-t. c, Zymography. Up-regulation of MMP2 and MMP9 activity was confirmed at the protein level.

 
MMP2 and MMP9 are MMPs relevant to angiogenic processes. Basal expression levels of MMP2 and MMP9 mRNA were significantly increased both in Id1 and Id3 transfectants, and were comparable to those of VEGF-stimulated mock transfectants (Fig. 4b). Zymography confirmed up-regulation of MMP2 and MMP9 enzymatic activities (Fig. 4c). In the transfectants, not only the total MMP2 and MMP9 expression levels, but also expression levels of the active forms of MMP2 and MMP9 were increased compared with mock transfectants. Furthermore, tube formation in the Matrigel assay was markedly enhanced both in Id1 and Id3 transfectants even in the absence of VEGF (Fig. 5). Taken together, these observations indicate that overexpression of Id alone can induce angiogenic processes in HUVECs.



View larger version (51K):
[in this window]
[in a new window]
 
FIGURE 5. Enhanced tube formation by overexpression of Id1 or Id3 in the Matrigel. a and b, Id1-t (a) and Id3-t (b) exhibited enhanced tube formation in the Matrigel in the absence of VEGF (original magnification, x100). c and d, The degree of tube formation in the transfectants at the basal level was comparable with mock transfectants cultured in the presence of VEGF (10 ng/ml).

 
Inhibition of VEGF-induced proliferation and activation of HUVECs by ID1 and ID3 shRNA

In the next sets of experiments, we addressed the question whether Id proteins are essential for proliferation, activation, and angiogenic processes of HUVECs induced by VEGF. To inhibit expression of Id1 and Id3, we used RNA interference (RNAi). HUVECs were doubly transfected with RNA expression vectors containing ID1 and ID3 shRNA at 0.125, 0.5, or 1 ng/ml. A dose-dependent inhibition of VEGF-induced Id3 (Fig. 6a) and Id1 (data not shown) expression was observed. Subsequent studies were conducted using 1 ng/ml ID1 and ID3 shRNA transfectants.



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 6. Silencing of Id1 and Id3 inhibits VEGF-induced proliferation and activation of HUVECs. a, HUVECs were transfected with ID1 and ID3 shRNA expression vectors at various concentrations or pSilencer alone (mock). After HUVECs were cultured for 24 h with or without VEGF (20 ng/ml), mRNA levels of ID3 and GAPDH were quantitated. Dose-dependent suppression of ID3 induction was observed. ID1 induction was also inhibited (data not shown). b, Reduced VEGF-induced proliferation of double-knockdown transfectants. Proliferation was analyzed using WST-1 at 24 h. VEGF-induced proliferation was significantly inhibited in Id1/Id3 double-knockdown transfectants. c–e, Inhibition of VEGF-induced activation of HUVECs by Id1/Id3 double knockdown. Surface expression of ICAM-1 (c), E-selectin (d), and {alpha}v integrin (e) was measured in mock transfectants with or without stimulation with VEGF (20 ng/ml), and ID1 and ID3 shRNA double transfectants stimulated with VEGF. Id1/Id3 double knockdown resulted in inhibition of VEGF-induced expression of ICAM-1, E-selectin, and {alpha}v integrin. f, ICAM-1 expression was modestly up-regulated at 24 h after IL-1{beta} treatment (1 ng/ml) in mock-t, which was not inhibited by knockdown of Id1/Id3. g, E-selectin expression was up-regulated at 5 h after TNF-{alpha} treatment (20 ng/ml) in mock-t, which was inhibited by silencing of Id1 and Id3. h and i, Surface expression of {alpha}2 (h) and {beta}1 (i) integrins in ID1, ID3 shRNA transfectants stimulated with VEGF (20 ng/ml). Both integrins were down-regulated.

 
Id1/Id3 double-knockdown transfectants exhibited significantly decreased proliferation when stimulated with VEGF (Fig. 6b). With respect to adhesion molecules, mock transfectants showed modest up-regulation of surface expression of ICAM-1 (Fig. 6c), E-selectin (d), and substantial up-regulation of {alpha}v integrin (e), when stimulated with VEGF. In ID1 and ID3 shRNA transfectants, up-regulation of these molecules were completely inhibited (Fig. 6, c–e). When HUVECs were treated with either ID1 or ID3 shRNA, VEGF-induced ICAM-1 expression was inhibited, but induction of E-selectin and {alpha}v integrin were not (data not shown).

We next tested whether Id1/Id3 knockdown also inhibits HUVEC activation by IL-1{beta} and TNF-{alpha}. IL-1{beta} modestly up-regulated ICAM-1 expression, which was not inhibited by knockdown of Id1 and Id3 (Fig. 6f). In contrast, TNF-{alpha}-induced up-regulation of E-selectin was inhibited by knockdown of Id1 and Id3 (Fig. 6g).

Inhibition of VEGF-induced angiogenesis by ID1 and ID3 shRNA

We next examined whether Id1/Id3 double knockdown can inhibit the VEGF-induced angiogenic processes of HUVECs. VEGF-induced transmigration activities were abolished in ID1 and ID3 shRNA transfectants (Fig. 7a). mRNA expression of MMP2, but not MMP9, was significantly decreased by Id1/Id3 knockdown, when HUVECs were cultured in the presence of VEGF (20 ng/ml) (Fig. 7b). VEGF-induced tube formation in Matrigel was markedly decreased in ID1 and ID3 shRNA transfected cells (Fig. 7, c and d). Such inhibition of the angiogenic processes was accompanied by a down-regulation of {alpha}2 and {beta}1 integrins in ID1 and ID3 shRNA transfectants (Fig. 6, h and i). Thus, these results indicate that the expression of Id plays a crucial role in the VEGF-induced angiogenic processes in HUVECs.



View larger version (51K):
[in this window]
[in a new window]
 
FIGURE 7. Silencing of Id1 and Id3 inhibits VEGF-induced angiogenic processes of HUVECs. a, Transmigration activity was significantly decreased in ID1 and ID3 shRNA transfectant after stimulation with VEGF (20 ng/ml) for 8 h. b, MMP mRNA expression in mock or ID1 and ID3 shRNA transfectants cultured for 8 h in the presence of VEGF (20 ng/ml). MMP2 mRNA expression was decreased in the double-knockdown cells, whereas MMP9 mRNA was not inhibited. c, Tube formation assay. Untransfected, mock-transfected, and ID1, ID3 shRNA double-transfected HUVECs were cultured in the presence of VEGF (20 ng/ml) for 24 h. Marked inhibition of tube formation was observed by Id1/Id3 double knockdown. Original magnification, x100. d, Quantitation of tube formation.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, we demonstrated that overexpression of Id alone can induce proliferation, activation, and angiogenic processes of HUVECs in the absence of VEGF, to levels similar to that of VEGF-stimulated untransfected HUVECs. Moreover, knockdown of ID1 and ID3 in HUVECs almost completely abolished the VEGF-induced proliferation, activation, and angiogenic processes. These findings indicate a crucial role for Id in some of the VEGF signaling pathways in HUVECs.

Using Id1+/–Id3–/– mice, it has been shown that Id expression is required to support angiogenesis in tumors (19), and that recruitment of VEGFR1+ myeloid cells and VEGFR2+ circulating endothelial precursor cells expressing Id is necessary for tumor growth (26). The new information presented in this study, including the requirement of Id also in human endothelial cells, up-regulation of ICAM-1 and E-selectin by forced expression of Id, and inhibition of endothelial cell activation and angiogenesis by double knockdown of Id1 and Id3, further emphasizes the crucial role of Id in endothelial cell activation and angiogenesis.

Previous reports demonstrated that Id controls the cell cycle in several ways (15), for example, by binding to Rb protein and blocking its tumor suppressor function (6, 12), or by inhibiting the binding of Ets1 and Ets2 transcription factors to p16INK4a promoter and repressing its expression (16). Our data suggested that at least the latter mechanism is operative in HUVECs. Id family proteins have been generally shown to promote apoptosis in a variety of conditions (24). However, in some settings, Id was shown to have antiapoptotic activity (25). Our present data suggested that overexpression of Id3, but not Id1, can protect HUVEC from apoptosis induced by serum starvation. In HUVECs, it was previously shown that VEGF prevents apoptosis induced by serum starvation (22). These results suggest that Id3 may mediate antiapoptotic effect induced by VEGF in HUVECs, and such an effect may also partly account for enhanced proliferation of Id3 transfectants.

As for ICAM-1 and E-selectin induction, it was recently demonstrated that VEGF induces these adhesion molecules in HUVECs through NF-{kappa}B (27), and that Id1 activates NF-{kappa}B transcription in prostate cancer cells (25). Our present data provide evidence that Id is involved in the signaling pathway that connects VEGF receptors and NF-{kappa}B activation in HUVECs. In our system, we have not distinguished contribution of each VEGFR for the induction of Id, which should be investigated in future studies. Although gene silencing of Id1 and Id3 efficiently inhibited ICAM-1 and E-selectin induction by VEGF and TNF-{alpha}, up-regulation of ICAM-1 by IL-1{beta} was not inhibited. Taken together with the lack of ID1 and ID3 mRNA induction after stimulation with IL-1{beta}, our results suggest that Id may not be involved in the IL-1{beta} pathway of HUVEC activation. In the case of TNF-{alpha} stimulation, because mRNA of ID was not up-regulated, the presence of basal level of Id may be necessary for the activation of HUVEC by TNF-{alpha}. The signaling pathways of VEGF, TNF-{alpha}, and IL-1{beta} in endothelial cells have not yet been fully delineated (28), and further studies are necessary to address the relationships of these pathways and Id.

When HUVECs were treated with VEGF or TGF{beta}, expression of Id was induced. Expression of Id3 has been shown to be induced by the Ras-ERK pathway in thymocytes (17), and through type I receptor of the TGF{beta} via Smad1/5 signaling in HUVECs (18), whereas Id1 expression was associated with Raf/MEK1/2 activation in a human prostatic cancer cell line (29) and Smad1/5 signaling in HUVECs (18). Induction of Id in HUVECs by VEGF is reasonable, because MAPK cascade exists in the downstream of VEGF signaling pathways (30). In contrast, stimulation with IL-1{beta}, TNF-{alpha}, or bFGF did not induce Id1 or Id3 in HUVECs, suggesting that Id may not be a ubiquitous mediator of inflammation, but more specifically associated with signaling pathways leading to angiogenesis.

For the knockdown experiments, we used double knockdown of Id1 and Id3, because knockdown of either one of them resulted in only partial inhibition of VEGF-induced activation or angiogenesis. Such results were expected, because it has been demonstrated that Id1 and Id3 have similar promoter region sequences, and exert overlapping biochemical functions; thus either one might be able to compensate the other, at least partially. In contrast, our results indicated that knockdown of both Id1 and Id3 was sufficient to abolish most of the angiogenic processes induced by VEGF in HUVECs, and Id2 and Id4 cannot compensate for the lack of Id1 and Id3. ID1 and ID3 shRNA sequences were designed from the 5' region specific to each gene. Because RNAi can block gene expression only when the shRNA sequence is highly matched with the target gene (31), Id2 and Id4 expression were not considered to be suppressed.

Although Id3 overexpression up-regulated MMP9, knockdown of Id did not inhibit VEGF-induced up-regulation of MMP9. This suggests the presence of other pathways that lead to MMP9 up-regulation. Nevertheless, Id knockdown resulted in marked inhibition of tube formation in Matrigel. Such discrepancy may be explained by reduced expression of {alpha}2 and {beta}1 integrins, whose ligands are collagen and laminin, the main components of basement membranes and also of Matrigel (32, 33). Thus, Id seems to be involved in multiple pathways leading to activation of endothelial cells and angiogenesis. Although the functions of Id1 and Id3 are substantially overlapping (11, 14), it is intriguing to delineate the pathways from each Id protein to a multitude of endothelial cell activation and angiogenic processes. Indeed, our observations indicated some notable differences between the effects of Id1 and Id3 overexpression; for example, Id1 overexpression failed to up-regulate E-selectin and to protect HUVEC from apoptosis induced by serum starvation. It has recently been reported that Id1 down-regulates expression of thrombospondin-1, a suppressor of angiogenesis (34). It is also of interest to examine whether all of the angiogenic processes associated with Id can be explained by down-regulation of thrombospondin-1. To gain further insights, DNA microarray analysis is underway.

In conclusion, we demonstrated that Id plays an indispensable role for the VEGF-induced activation and angiogenic processes of HUVECs. Based on the inhibition of endothelial cell activation and angiogenesis with RNAi, as well as the low expression of Id in most of the normal adult tissues, Id should be considered an attractive target for the development of new therapeutic approaches for disorders associated with excessive angiogenesis.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by Grant-in-Aid for Scientific Research on Priority Areas (C) "Medical Genome Science," and Grant-in-Aid for Scientific Research (B) from the Ministry of Education, Science, Sports and Culture of Japan, and by Health and Labour Sciences Research Grant for Research on Allergic Disease and Immunology from the Ministry of Health Labour and Welfare of Japan. Back

2 Address correspondence and reprint requests to Dr. Naoyuki Tsuchiya, Department of Human Genetics, Graduate School of Medicine, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo, Japan 113-0033. E-mail address: tsuchiya-tky{at}umin.ac.jp Back

3 Abbreviations used in this paper: RA, rheumatoid arthritis; Id, inhibitor of DNA binding/differentiation; HLH, helix-loop-helix; VEGF, vascular endothelial growth factor; FGF, fibroblast growth factor; bFGF, basic FGF; shRNA, small hairpin RNA; MMP, matrix metalloproteinase; RNAi, RNA interference. Back

Received for publication March 16, 2004. Accepted for publication August 26, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Koch, A. E.. 1998. Angiogenesis: implications for rheumatoid arthritis. Arthritis Rheum. 41:951.[Medline]
  2. Feldmann, M., F. M. Brennan, R. N. Maini. 1996. Rheumatoid arthritis. Cell 85:307.[Medline]
  3. Firestein, G. S.. 1996. Invasive fibroblast-like synoviocytes in rheumatoid arthritis: passive responders or transformed aggressors?. Arthritis Rheum. 39:1781.[Medline]
  4. Sakurai, D., A. Yamaguchi, N. Tsuchiya, K. Yamamoto, K. Tokunaga. 2001. Expression of ID family genes in the synovia from patients with rheumatoid arthritis. Biochem. Biophys. Res. Commun. 284:436.[Medline]
  5. Benezra, R., R. L. Davis, D. Lockshon, D. L. Turner, H. Weintraub. 1990. The protein Id: a negative regulator of helix-loop-helix DNA binding proteins. Cell 61:49.[Medline]
  6. Lasorella, A., M. Noseda, M. Beyna, Y. Yokota, A. Iavarone. 2002. Id2 is a retinoblastoma protein target and mediates signalling by Myc oncoproteins. Nature 407:592.
  7. Wilson, R. B., M. Kiledjian, C. P. Shen, R. Benezra, P. Zwollo, S. M. Dymecki, S. V. Desiderio, T. Kadesch. 1991. Repression of immunoglobulin enhancers by the helix-loop-helix protein Id: implications for B-lymphoid-cell development. Mol. Cell. Biol. 11:6185.[Abstract/Free Full Text]
  8. Sun, X. H., N. G. Copeland, N. A. Jenkins, D. Baltimore. 1991. Id proteins Id1 and Id2 selectively inhibit DNA binding by one class of helix-loop-helix proteins. Mol. Cell. Biol. 11:5603.[Abstract/Free Full Text]
  9. Hara, E., T. Yamaguchi, H. Nojima, T. Ide, J. Campisi, H. Okayama, K. Oda. 1994. Id-related genes encoding helix-loop-helix proteins are required for G1 progression and are repressed in senescent human fibroblasts. J. Biol. Chem. 269:2139.[Abstract/Free Full Text]
  10. Cooper, C. L., G. Brady, F. Bilia, N. N. Iscove, P. J. Quesenberry. 1997. Expression of the Id family helix-loop-helix regulators during growth and development in the hematopoietic system. Blood 89:3155.[Abstract/Free Full Text]
  11. Norton, J. D., R. W. Deed, G. Craggs, F. Sablitzky. 1998. Id helix-loop-helix proteins in cell growth and differentiation. Trends Cell Biol. 8:58.[Medline]
  12. Lasorella, A., T. Uo, A. Iavarone. 2001. Id proteins at the cross-road of development and cancer. Oncogene 20:8326.[Medline]
  13. Rivera, R., C. Murre. 2001. The regulation and function of the Id proteins in lymphocyte development. Oncogene 20:8308.[Medline]
  14. Yokota, Y.. 2001. Id and development. Oncogene 20:8290.[Medline]
  15. Zebedee, Z., E. Hara. 2001. Id proteins in cell cycle control and cellular senescence. Oncogene 20:8317.[Medline]
  16. Ohtani, N., Z. Zebedee, T. J. Huot, J. A. Stinson, M. Sugimoto, Y. Ohashi, A. D. Sharrocks, G. Peters, E. Hara. 2001. Opposing effects of Ets and Id proteins on p16INK4a expression during cellular senescence. Nature 409:1067.[Medline]
  17. Bain, G., C. B. Cravatt, C. Loomans, J. Alberola-Ila, S. M. Hedrick, C. Murre. 2001. Regulation of the helix-loop-helix proteins, E2A and Id3, by the Ras-ERK MAPK cascade. Nat. Immunol. 2:165.[Medline]
  18. Ota, T., M. Fujii, T. Sugizaki, M. Ishii, K. Miyazawa, H. Aburatani, K. Miyazono. 2002. Targets of transcriptional regulation by two distinct type I receptors for transforming growth factor-{beta} in human umbilical vein endothelial cells. J. Cell. Physiol. 193:299.[Medline]
  19. Lyden, D., A. Z. Young, D. Zagzag, W. Yan, W. Gerald, R. O’Reilly, B. L. Bader, R. O. Hynes, Y. Zhuang, K. Manova, R. Benezra. 1999. Id1 and Id3 are required for neurogenesis, angiogenesis and vascularization of tumour xenografts. Nature 401:670.[Medline]
  20. Coppé, J.-P., A. P. Smith, P.-Y. Desprez. 2003. Id proteins in epithelial cells. Exp. Cell Res. 285:131.[Medline]
  21. Jaffe, E. A., R. L. Nachman, C. G. Becker, C. R. Minick. 1973. Culture of human endothelial cells derived from umbilical veins: identification by morphologic and immunologic criteria. J. Clin. Invest. 52:2745.
  22. Yilmaz, A., S. Kliche, U. Mayr-Beyrle, G. Fellbrich, J. Waltenberger. 2003. p38 MAPK inhibition is critically involved in VEGFR-2-mediated endothelial cell survival. Biochem. Biophys. Res. Commun. 306:730.[Medline]
  23. Lakka, S. S., C. S. Gondi, N. Yanamandra, W. C. Olivero, D. H. Dinh, M. Gujrati, J. S. Rao. 2004. Inhibition of cathepsin B and MMP-9 gene expression in glioblastoma cell line via RNA interference reduces tumor cell invasion, tumor growth and angiogenesis. Oncogene 23:4681.[Medline]
  24. Sikder, H. A., M. K. Devlin, S. Dunlap, B. Ryu, R. M. Alani. 2003. Id proteins in cell growth and tumorigenesis. Cancer Cell 3:525.[Medline]
  25. Ling, M.-T., X. Wang, X.-S. Ouyang, K. Xu, S.-W. Tsao, Y.-C. Wong. 2003. Id-1 expression promotes cell survival through activation of NF-{kappa}B signaling pathway in prostate cancer cells. Oncogene 22:4498.[Medline]
  26. Lyden, D., K. Hattori, S. Dias, C. Costa, P. Blaikie, L. Butros, A. Chadburn, B. Heissig, W. Marks, L. Witte, et al 2001. Impaired recruitment of bone-marrow-derived endothelial and hematopoietic precursor cells blocks tumor angiogenesis and growth. Nat. Med. 7:1194.[Medline]
  27. Kim, I., S.-O. Moon, S. H. Kim, H. J. Kim, Y. S. Koh, G. Y. Koh. 2001. Vascular endothelial growth factor expression of intercellular adhesion molecule 1 (ICAM-1), vascular cell adhesion molecule 1 (VCAM-1), and E-selectin through nuclear factor-{kappa}B activation in endothelial cells. J. Biol. Chem. 276:7614.[Abstract/Free Full Text]
  28. Pober, J. S.. 2002. Endothelial activation: intracellular signaling pathways. Arthritis Res. 4:(Suppl. 3):S109.
  29. Ling, M. T., X. Wang, X. S. Ouyang, T. K. Lee, T. Y. Fan, K. Xu, S. W. Tsao, Y. C. Wong. 2002. Activation of MAPK signaling pathway is essential for Id-1 induced serum independent prostate cancer cell growth. Oncogene 21:8498.[Medline]
  30. Takahashi, T., H. Ueno, M. Shibuya. 1999. VEGF activates protein kinase C-dependent, but Ras-independent Raf-MEK-MAP kinase pathway for DNA synthesis in primary endothelial cells. Oncogene 18:2221.[Medline]
  31. Elbashir, S. M., W. Lendeckel, T. Tuschl. 2001. RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev. 15:188.[Abstract/Free Full Text]
  32. Dickeson, S. K., J. J. Walsh, S. A. Santoro. 1998. Binding of the {alpha}2 integrin I domain to extracellular matrix ligands: structural and mechanistic differences between collagen and laminin binding. Cell Adhes. Commun. 5:273.[Medline]
  33. Davis, G. E., C. W. Camarillo. 1995. Regulation of endothelial cell morphogenesis by integrins, mechanical forces, and matrix guidance pathways. Exp. Cell Res. 216:113.[Medline]
  34. Volpert, O. V., R. Pili, H. A. Sikder, T. Nelius, T. Zaichuk, C. Morris, C. B. Shiflett, M. K. Devlin, K. Conant, R. M. Alani. 2002. Id1 regulates angiogenesis through transcriptional repression of thrombospondin-1. Cancer Cell 2:473.[Medline]



This article has been cited by other articles:


Home page
BloodHome page
R. C. Doebele, F. T. Schulze-Hoepfner, J. Hong, A. Chlenski, B. D. Zeitlin, K. Goel, S. Gomes, Y. Liu, M. K. Abe, J. E. Nor, et al.
A novel interplay between Epac/Rap1 and mitogen-activated protein kinase kinase 5/extracellular signal-regulated kinase 5 (MEK5/ERK5) regulates thrombospondin to control angiogenesis
Blood, November 12, 2009; 114(20): 4592 - 4600.
[Abstract] [Full Text] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
D. Del Duca, G. Wong, P. Trieu, D. Rodaros, A. Kouremenos, A. Tadevosyan, G. Vaniotis, L. R. Villeneuve, C. I. Tchervenkov, S. Nattel, et al.
Association of neonatal hypoxia with lasting changes in left ventricular gene expression: An animal model
J. Thorac. Cardiovasc. Surg., September 1, 2009; 138(3): 538 - 546.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
R. Miller, V. Cirulli, G. R. Diaferia, S. Ninniri, G. Hardiman, B. E. Torbett, R. Benezra, and L. Crisa
Switching-On Survival and Repair Response Programs in Islet Transplants by Bone Marrow-Derived Vasculogenic Cells
Diabetes, September 1, 2008; 57(9): 2402 - 2412.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
I. Airoldi, C. Cocco, N. Giuliani, M. Ferrarini, S. Colla, E. Ognio, G. Taverniti, E. Di Carlo, G. Cutrona, V. Perfetti, et al.
Constitutive expression of IL-12R{beta}2 on human multiple myeloma cells delineates a novel therapeutic target
Blood, August 1, 2008; 112(3): 750 - 759.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
L. Kamalian, J. R. Gosney, S. S. Forootan, C. S. Foster, Z. Z. Bao, C. Beesley, and Y. Ke
Increased Expression of Id Family Proteins in Small Cell Lung Cancer and its Prognostic Significance
Clin. Cancer Res., April 15, 2008; 14(8): 2318 - 2325.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Nishiyama, K. Takaji, Y. Uchijima, Y. Kurihara, T. Asano, M. Yoshimura, H. Ogawa, and H. Kurihara
Protein Kinase A-regulated Nucleocytoplasmic Shuttling of Id1 during Angiogenesis
J. Biol. Chem., June 8, 2007; 282(23): 17200 - 17209.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Zwerts, F. Lupu, A. De Vriese, S. Pollefeyt, L. Moons, R. A. Altura, Y. Jiang, P. H. Maxwell, P. Hill, H. Oh, et al.
Lack of endothelial cell survivin causes embryonic defects in angiogenesis, cardiogenesis, and neural tube closure
Blood, June 1, 2007; 109(11): 4742 - 4752.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
H.-J. Kim, H. Chung, Y.-G. Yoo, H. Kim, J.-Y. Lee, M.-O. Lee, and G. Kong
Inhibitor of DNA Binding 1 Activates Vascular Endothelial Growth Factor through Enhancing the Stability and Activity of Hypoxia-Inducible Factor-1{alpha}
Mol. Cancer Res., April 1, 2007; 5(4): 321 - 329.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
D. S. Kim, J. A. Franklyn, K. Boelaert, M. C. Eggo, J. C. Watkinson, and C. J. McCabe
Pituitary Tumor Transforming Gene (PTTG) Stimulates Thyroid Cell Proliferation via a Vascular Endothelial Growth Factor/Kinase Insert Domain Receptor/Inhibitor of DNA Binding-3 Autocrine Pathway
J. Clin. Endocrinol. Metab., November 1, 2006; 91(11): 4603 - 4611.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
K. Nishiyama, K. Takaji, K. Kataoka, Y. Kurihara, M. Yoshimura, A. Kato, H. Ogawa, and H. Kurihara
Id1 Gene Transfer Confers Angiogenic Property on Fully Differentiated Endothelial Cells and Contributes to Therapeutic Angiogenesis
Circulation, November 1, 2005; 112(18): 2840 - 2850.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sakurai, D.
Right arrow Articles by Tokunaga, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sakurai, D.
Right arrow Articles by Tokunaga, K.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS