|
|
||||||||
B Regulates Expression of the MHC Class I-Related Chain A Gene in Activated T Lymphocytes1

* Laboratorio de Inmunogenética, Hospital de Clínicas "José de San Martín", and Departamento de Microbiología, Facultad de Medicina, Universidad de Buenos Aires (UBA), and
Instituto de Investigaciones Médicas "Alfredo Lanari", Buenos Aires, Argentina
| Abstract |
|---|
|
|
|---|

T lymphocytes, CD8+ 
T lymphocytes, and NK cells. Although MICA is not expressed on resting lymphocytes, we demonstrated that it is induced on activated T cells. Because NF-
B is actively involved in T cell activation, and is constitutively activated in many tumors, here we investigated whether NF-
B may modulate MICA expression. Treatment with the NF-
B inhibitor sulfasalazine (Sz) resulted in a dose-dependent inhibition of MICA expression in anti-CD3- and anti-CD28/PMA-activated T lymphocytes, as assessed by Western blot and RT-PCR analysis. Moreover, Sz also down-regulated MICA expression on epithelial tumor HeLa cells. MICA expression was accompanied by a Sz-sensitive I
B
degradation. EMSA with nuclear extracts from anti-CD3- and anti-CD28/PMA-stimulated T lymphocytes demonstrated the binding of a potential NF-
B family transcription factor to a MICA gene intron 1-derived oligonucleotide that contains a putative
B binding site. Supershift assays demonstrated the presence of p65(RelA)/p50 heterodimers and p50/p50 homodimers in the NF-
B complexes bound to the
B-MICA oligonucleotide. Transient transfection of HeLa cells with p65(RelA) up-regulated MICA expression, as assessed by Western blot and flow cytometry analysis. Hence, we conclude that NF-
B regulates MICA expression on activated T lymphocytes and HeLa tumor cells, by binding to a specific sequence in the long intron 1 of the MICA gene. This constitutes the first description of a transcription factor that regulates MICA gene expression. | Introduction |
|---|
|
|
|---|
65 kDa molecule not associated with
2-microglobulin, which exhibits a restricted pattern of expression (2, 4, 5, 6). MICA is a cell stress responsive gene that is up-regulated or induced in different cells in response to heat shock (2, 7), oxidative stress (8), and infection (9, 10). MICA expression has also been demonstrated on different tumor cells (2, 4, 6, 7, 11, 12, 13, 14). This up-regulated expression signals for recognition of MICA by its ligand, the lectin-like NKG2D molecule that is expressed by 
T lymphocytes, peripheral blood CD8+ 
T lymphocytes, and NK cells (15, 16). Upon engagement of NKG2D, a cytotoxic response is delivered to MICA-expressing cells, which has been suggested to contribute to the elimination of stressed cells (7, 9, 10, 11, 12, 13, 14). Although MICA is not expressed on resting T and B lymphocytes (4), we demonstrated that this molecule is induced on CD4+ and CD8+ T cells activated by allogeneic PBMCs. In addition, we also observed that MICA is induced upon stimulation of T cells with anti-CD3 mAb or anti-CD28 mAb plus PMA (17), through multiple and simultaneous intracellular pathways that involve activation of Lck and Fyn kinases, and signaling through MEK1/ERK, p38 MAPK, calcineurin, Jak/STATs, and the p70S6 kinase (18). However, the biological consequences of the up-regulated expression of MICA on activated T cells still remain to be elucidated.
T cell activation requires engagement of the TCR/CD3 complex and costimulation through CD28, which leads to activation of transcription factors such as AP-1, NF-AT, and NF-
B that induce cytokine gene expression (19, 20, 21). In this process, NF-
B plays a critical role, being transiently activated upon TCR engagement (20, 21).
NF-
B/Rel is a family of homo- or heterodimeric transcription factors whose activation is mostly regulated via shuttling from the cytoplasm to the nucleus in response to cell stimulation. Mammals express five NF-
B/Rel proteins: RelA (p65), RelB, c-Rel, p50, and p52. The dimers are usually held in the cytoplasm as inactive precursors by interactions with specific inhibitors, the I
B
,
, and
proteins (22, 23). Upon stimulation of T cells by CD3 or CD28 cross-linking, the DNA-binding activity of NF-
B is rapidly promoted after phosphorylation by the I
B-kinase (IKK) and ubiquitin-dependent degradation of the I
B proteins (21).
Despite the emerging understanding in the immunobiology of MICA, evidence about transcriptional regulation that modulates expression of this stress-inducible molecule is still lacking. Because NF-
B plays a pivotal role during T cell activation (21), MICA is induced on activated T lymphocytes (17), and NF-
B is constitutively expressed in different tumors (24, 25, 26, 27) where MICA is also overexpressed (2, 4, 6, 7, 11, 12, 13, 14), in the present study, we investigated the involvement of this transcription factor in MICA gene expression. For this purpose, we used different experimental strategies such as: 1) sulfasalazine (Sz), an inhibitor of NF-
B activation (28, 29), 2) gel shift and supershift assays, and 3) transient transfection experiments. We observed that expression of MICA was strongly inhibited by Sz in anti-CD3- and anti-CD28 plus PMA-activated T lymphocytes. This effect was accompanied by inhibition of the NF-
B p65/p50 heterodimer and the p50/p50 homodimer DNA binding to a putative NF-
B DNA binding site located in the first intron of the MICA gene. In addition, Sz down-regulated MICA gene expression in the epithelial tumor HeLa cell line, but transient transfection of this cell line with p65(RelA) induced up-regulated expression of MICA. Our findings point to a direct involvement of NF-
B in MICA expression on activated T lymphocytes and in HeLa tumor cells, by binding to a specific sequence located in the long intron 1 of the MICA gene. To the best of our knowledge, this is the first demonstration of the involvement of a transcription factor involved in the regulation of MICA gene expression.
| Materials and Methods |
|---|
|
|
|---|
Sz was purchased from Sigma-Aldrich (St. Louis, MO), dissolved in DMSO at 500 mM, and used at 0.5, 1, 2, and 5 mM. Stimulating mouse anti-human CD3 mAb (clone SK7) and stimulating mouse anti-human CD28 mAb (clone L293) were obtained from BD Biosciences (San José, CA). Anti-I
B
, anti-p65(RelA), and anti-p50, as well as TransCruz Gel Supershift Ab against p65(RelA), p50, and p52 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). PMA was purchased from Sigma-Aldrich. For Western blot analysis of MICA expression, rabbit polyclonal Ab were used, the reactivity of which has been previously established (4, 5, 17, 30).
Cell line
The HeLa human epithelial cell line was obtained from the American Type Culture Collection (ATCC, Manassas, VA). Cells were cultured in 10% FBS (NatoCor, Córdoba, Argentina) in DMEM (Sigma-Aldrich) supplemented with sodium pyruvate (Sigma-Aldrich), glutamine (Sigma-Aldrich), and penicillin/streptomycin (Sigma-Aldrich).
Isolation of PBMC
PBMCs were isolated from healthy human volunteers by Ficoll-Paque Plus (Amersham Biosciences, Uppsala, Sweden) gradient centrifugation, washed with RPMI 1640 (Sigma-Aldrich), and resuspended in RPMI 1640 supplemented with 10% heat-inactivated FCS (NatoCor), sodium pyruvate, glutamine, and penicillin-streptomycin.
Stimulation of cells and treatment with Sz
HeLa cells were cultured in the presence of different concentrations of Sz for 72 h at 37°C in 24-well plates. PBMC were preincubated with different concentrations of Sz for 30 min at 37°C, stimulated with anti-CD3 mAb (25 ng/ml), anti-CD28 mAb (0.5 µg/ml) plus submitogenic doses of PMA (0.5 ng/ml), or with mitogenic doses of PMA alone (10 ng/ml), and cultured for 72 h in 96-well, "U"-bottom plates. Control experiments were performed by stimulating PBMCs with an isotype-matched negative control mAb (31). In some experiments, Sz was added to stimulated cells after 24 or 48 h of cell culture. Cells were then harvested and processed for proliferation assays, Western blot analysis, RT-PCR, and flow cytometry.
Proliferation assay
PBMC were pulsed with 1 µCi/well [methyl-3H]thymidine (New England Nuclear, Boston, MA) during the last 18 h of cell culture, and harvested on glass fiber filters using a Packard Filtermate cell harvester (Packard Instrument, La Grange, IL). Incorporated radioactivity was measured in a liquid scintillation beta counter (Packard Instrument). Results are expressed as mean cpm of triplicate wells ± SD.
SDS-PAGE and Western blot
Cells were lysed with 1% CHAPS (Sigma-Aldrich) in 150 mM NaCl, 50 mM Tris-HCl, pH 7.4 (TBS) in the presence of a protease inhibitor mixture (Sigma-Aldrich). After a 1 h incubation on ice, lysates were centrifuged 10 min at 12,000 rpm at 4°C. Supernatants ("whole cell lysate") were collected and stored at 20°C. Alternatively, cells were resuspended in 10 mM Tris-HCl pH 6.7, 0.2 mM MgCl2, in the presence of a protease inhibitor mixture (Sigma-Aldrich), and lysed by forced passage through a fine needle. Lysates were centrifuged 10 min at 1,500 rpm at 4°C. Cell pellets were resuspended in 20 mM Tris-HCl, pH 6.7, 70 mM NaCl, 1 mM EDTA, 10% glycerol, 1% Triton X-100, 0.5% Nonidet P-40 in the presence of a protease inhibitor mixture (Sigma-Aldrich), and centrifuged 5 min at 12,000 rpm at 4°C. Supernatants of this second centrifugation ("nuclear extracts") and whole cell lysates were used for Western blot analysis. Protein concentration of cell lysates was measured with the Micro BCA kit (Pierce, Rockford, IL).
SDS-PAGE and Western blot analysis were performed as previously described (17). Five to 20 µg of proteins were loaded onto the gels, depending on the experiment, and were transferred to polyvinylidene difluoride membranes (Amersham Biosciences). Equal loading was confirmed by Ponceau S staining. Membranes were incubated with a pool of anti-MICA sera nos. 620 and 621 diluted 1/5000, anti-I
B
rabbit polyclonal Ab (0.1 µg/ml), anti-p65(RelA) rabbit polyclonal Ab (0.2 µg/ml), or anti-p50 rabbit polyclonal Ab (0.4 µg/ml). Bound Ab were detected using peroxidase-labeled anti-rabbit IgG (Bio-Rad, Hercules, CA) and chemiluminescent detection on Kodak BioMax films (Rochester, NY). No bands were observed when Western blots were incubated with normal rabbit sera.
In some experiments, lysates of PBMCs stimulated with anti-CD3 mAb were precleared with protein A-purified normal rabbit IgG or with protein A-purified anti-MICA IgG no. 622 (4, 5, 30) for 1 h at 4°C, and protein A-Sepharose (Sigma-Aldrich) for an additional hour at 4°C. Precleared lysates were then analyzed for MICA expression by Western blot analysis using a pool of the anti-MICA sera nos. 620 and 621 (4, 5, 30).
RT-PCR and hybridization
RNA was extracted from resting and anti-CD3 mAb and anti-CD28 mAb plus PMA-stimulated T cells, either incubated or not with Sz, using TRIzol (Invitrogen Life Technologies, Carlsbad, CA) reagent. Retrotranscription, PCR, and hybridization with a 32P-labeled MICA-specific probe were performed as previously described (17). Briefly, cDNA was obtained using the Advantage RT-for-PCR kit (BD Clontech, Palo Alto, CA), using oligo (dT)18 primer and Moloney murine leukemia virus retrotranscriptase. PCRs were normalized with
-actin, using the 5' primer TGACGGGGTCACCCACACTGTGCCCATCTA and the 3' primer CTAGAAGCATTTGCGGTGGACGATGGAGGG. PCRs were run in a PTC-100 thermocycler (MJ Research, Watertown, MA), with 2 mM MgCl2 and 0.5 U of Taq polymerase (Invitrogen Life Technologies) per tube. PCR conditions were as follows: 94°C for 5 min, 66°C 5 min, 62°C 2.5 min, 30 cycles at 94°C for 1 min, 66°C for 1 min, and 72°C 1 min, and final extension at 72°C for 5 min. MICA exons 23 were amplified by PCR using the primers MA109C (GAGCCCCACAGTCTTCGTTAT) and MA173 (CCTGACGTTCATGGCCAA). PCRs were performed with 1.5 mM MgCl2 and 0.5 U of Taq polymerase per tube. PCR conditions were as follows: 94°C for 3 min, 55°C 2 min, 72°C 5 min, 36 cycles at 94°C for 1 min, 55°C for 1 min, and 72°C 2 min, and final extension at 72°C for 15 min. PCR products were separated by electrophoresis on 1.5% agarose gels, blotted onto N+-Hybond membranes (Amersham Biosciences), and hybridized with a 32P-labeled MICA-specific probe (ACAGGGAACGGAAAGGACC). After washing at 58°C, membranes were air-dried and exposed to Kodak X-OMAT XK1 films.
EMSA and supershift assays
EMSAs were performed as previously described (32). Nuclear extracts were obtained from PBMCs stimulated for 72 h with anti-CD3 mAb or anti-CD28 mAb plus PMA, in the absence or in the presence of Sz. Cells were lysed with 10 mM HEPES, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT, and 0.1% Nonidet P-40. After centrifugation, nuclear pellets were extracted with 20 mM HEPES, 1.5 mM MgCl2, 0.42 mM NaCl, 0.5 mM DTT, 0.5 mM PMSF, 25% glycerol, and 0.2 mM EDTA. The soluble fraction was mixed with 10 mM Tris-HCl, 80 mM KCl, 10% glycerol, and 1 mM DTT, pH 7.5. Double-stranded oligonucleotides containing the putative
B sequence of the first intron of the MICA gene (GenBank accession number X92841, 5'-GAGTAGGGGCCCTCCTTTCT-3',
B-MICA) or the NF-
B consensus oligonucleotide corresponding to the NF-
B binding site located in the enhancer of the Ig
L chain gene (AGTTGAGGGGACTTTCCCAGGC,
B-cons; Santa Cruz Biotechnology) were labeled with 32P-ATP and used for binding reactions. The putative
B-MICA sequence was selected according to the consensus
B-binding motif (22, 33). Five micrograms of each nuclear extract were incubated in 20 µl of buffer containing 100 ng of poly(dI-dC). After incubation for 20 min at room temperature with labeled oligonucleotides, DNA-protein complexes were resolved on a 6% nondenaturing polyacrylamide gel with 0.25x TBE buffer. Gels were dried and autoradiography at 70°C was performed. For competition experiments, a 100- or 200-fold excess of unlabeled
B-cons oligonucleotide or nonspecific competitor corresponding to the CCAAT box located in the enhancer of the fibronectin gene (GATCCCGGAGCCCGGGCCAATCGGCGCA, CCAAT oligonucleotide) were added to the reaction mixture. For supershift assays, nuclear extracts were preincubated with 1 µl of TransCruz Gel Supershift Abs against p65(RelA), p50, or p52, for 1 h at room temperature before the addition of the end-labeled
B-MICA oligonucleotide.
Transfections
The expression vector CMV-Rel-A encoding human p65(RelA) was kindly provided by Dr. J. DiDonato (Department of Cancer Biology, Lerner Research Institute, Cleveland Clinic, Cleveland, OH). Transient transfection experiments of HeLa cells were performed using Lipofectamine 2000 (Invitrogen Life Technologies), following the instructions provided by the manufacturer. Transfected cells were cultured for 48 h, harvested, and used for analysis of MICA expression by Western blot. Mock-transfected cells (transfected with empty vector) were also analyzed.
Flow cytometry
Cell surface MICA expression was analyzed by flow cytometry with the anti-MICA mAb D7 produced in our laboratory (M. B. Fuertes, L. L. Molinero, and N. W. Zwirner, unpublished observations). Briefly, the mAb (IgG2b,
) was produced from spleen cells of a BALB/c mouse immunized with recombinant soluble MICA protein (30), following standard procedures for immunization and hybridoma production (34). An isotype-matched mAb (31) was used as negative control.
| Results |
|---|
|
|
|---|
B in the expression of MICA using Sz, a specific IKK inhibitor (28, 29), gel shift and supershift assays, and transient transfection experiments. Analysis by flow cytometry showed that Sz did not induce apoptosis at the concentrations used in our experiments (data not shown).
First, PBMCs were activated with anti-CD3 mAb or anti-CD28 mAb plus PMA in the presence of different concentrations of Sz (Fig. 1). A profound dose-dependent inhibitory effect of the proliferative response (Fig. 1A) and MICA expression (Fig. 1B) was observed. Maximal inhibitory effect was achieved with 0.5 mM Sz. Inhibition was also observed on PBMCs stimulated with mitogenic doses of PMA (Fig. 1, A and C), which indicates that activation of a member of the protein kinase C (PKC) family of kinases (most likely PKC-
) might be an important intermediary in activation-induced expression of MICA. To establish the specificity of the band detected in the Western blots, preclearing experiments were performed as described in Materials and Methods. In these experiments (Fig. 1D), we observed that preclearing lysates of anti-CD3 mAb-stimulated PBMCs with protein A-purified normal rabbit IgG (lane 1) did not prevent the detection of the band detected in the Western blots shown in Fig. 1, B and C. Conversely, preclearing the lysates with a protein A-purified rabbit anti-MICA IgG raised against a peptide spanning aa 140160 of the MICA molecule reduced the intensity of the band detected in the Western blots in >80% (lane 2). To investigate whether Sz exerts its effect through inhibition of MICA gene transcription, mRNA levels in resting and activated cells were investigated by RT-PCR and hybridization with a MICA-specific, 32P-labeled probe (Fig. 1E). In these experiments, low levels of MICA mRNA were detected in anti-CD3- and anti-CD28/PMA-stimulated T cells cultured in the presence of Sz. Taken together, these results indicate that inhibition of MICA protein expression in activated T lymphocytes is induced by Sz at the transcriptional level, most likely by inhibition of a transcription factor of the NF-
B family.
|
B is a critical transcription factor turned on during T cell activation, we performed a kinetic analysis of I
B
degradation by Western blot (Fig. 2A). We observed that 30 min after activation, T cells rapidly degraded I
B
, an effect commonly accompanied by a release of biologically active NF-
B to the nucleus. After 2 h, I
B
levels increased, but after 6 h of activation, I
B
was found to be degraded again. Basal levels were reached after 24 h of stimulation. At 72 h of activation, I
B
levels dropped again. This behavior might indicate that different waves of active NF-
B could be released in the cytoplasm and translocated to the nucleus. In agreement with these results, a kinetic analysis of p65(RelA) and p50 confirmed that they could be detected in nuclear extracts from anti-CD3 mAb and anti-CD28 mAb plus PMA-stimulated T cells soon after activation (from 30 min to 6 h) and after 72 h of stimulation (Fig. 2B). This indicates that the two major components of NF-
B are present in the nucleus of T cells stimulated for 72 h with either anti-CD3 mAb or anti-CD28 mAb plus PMA. As expected, Sz prevented I
B
degradation in a dose-dependent manner (Fig. 2C) and nuclear translocation of p65(RelA) (Fig. 2D). Together, these results confirm that Sz inhibits I
B
degradation, preventing nuclear translocation of p65(RelA) in T lymphocytes.
|
B activation, we activated PBMCs and treated the cells with Sz after different periods of culture (Fig. 3). Inhibition of MICA expression was observed regardless of the time of Sz addition, which indicates a direct effect of NF-
B on MICA gene expression, instead of an indirect effect through activation of other transcription factors.
|
B binding site located in intron 1, spanning the positions 582591 (Fig. 4). Gel shift assays performed with a synthetic, double-stranded oligonucleotide corresponding to position 577596 of the MICA gene (
B-MICA), and nuclear extracts from T lymphocytes stimulated for 72 h with anti-CD3 mAb or anti-CD28 mAb plus PMA, demonstrated a retardation in the electrophoretic mobility of the 32P-labeled synthetic oligonucleotide due to binding of a NF (Fig. 5A). Initially, one specific band was detected with nuclear extracts from cells stimulated with anti-CD3 mAb, while two specific bands were detected with nuclear extracts from cells stimulated with anti-CD28 mAb plus PMA. These bands are indicated by arrows in Fig. 5A), and were sensitive to Sz inhibition. Because the DNA-binding activity of these complexes was inhibited by competition with a consensus NF-
B double-stranded, unlabeled oligonucleotide (
B-cons), but not by an unrelated double-stranded unlabeled oligonucleotide (CCAAT, Fig. 5, B and C), we conclude that the putative transcription factor responsible for the altered electrophoretic mobility of the 32P-labeled
B-MICA oligonucleotide is a member of the NF-
B family of transcription factors. Also, in Fig. 5B we noted that the band shown in Fig. 5A, which was detected with nuclear extracts from cells stimulated with anti-CD3 mAb appears to be composed by two bands that were not completely resolved in the gels shown in Fig. 5A. These bands are now indicated by two separate arrows in Fig. 5B.
|
|
B complexes observed in Fig. 5, we performed gel supershift assays using anti-p65(RelA) or anti-p50 Ab and nuclear extracts from T cells stimulated with anti-CD3 mAb (Fig. 6A). Also, we performed gel supershift assays using anti-p65(RelA), anti-p50, or anti-p52 Ab, and nuclear extracts from T cells stimulated with anti-CD28 mAb plus PMA (Fig. 6B). In both cases, the slower migrating complexes observed in Fig. 5 were supershifted with anti-p65(RelA) and anti-p50-anti Ab, suggesting that they are mainly composed of p65/p50 heterodimers. Conversely, the faster migrating band was supershifted only by anti-p50 Ab, suggesting that these complexes are p50 homodimers. The anti-p52 Ab had no effect on the electrophoretic mobility of the
B-MICA probe when nuclear extracts from T cells stimulated with anti-CD3 mAb (not shown) or with anti-CD28 mAb plus PMA (Fig. 6B) were used. These results demonstrate that p65/p50 heterodimers and p50/p50 homodimers are components of the NF-
B complexes that bind to the
B-MICA intron 1-derived sequence in activated T cells.
|
B also regulates MICA expression in tumor cells. The inhibition of MICA expression was also observed at the cell surface when MICA expression was assessed by flow cytometry (Fig. 7B). To directly address the involvement of NF-
B in MICA expression, we investigated whether p65(RelA) overexpression could affect MICA levels. For this purpose, we transiently transfected HeLa cells with a plasmid encoding p65(RelA), and analyzed MICA protein levels by Western blot (Fig. 7C). We observed an up-regulation of MICA protein levels when compared with cells transfected with control plasmid. These results indicate that overexpression of p65(RelA) is sufficient to drive up-regulation of MICA expression.
|
| Discussion |
|---|
|
|
|---|
B in activation-induced expression of MICA in T lymphocytes. Moreover, we extended the study to the HeLa tumor epithelial cell line to validate the results obtained with primary lymphocytes, using a transient transfection approach. First, we used the NF-
B-specific inhibitor Sz (28) to address its effect on MICA expression. This compound has a demonstrated inhibitory effect on the IKK
and IKK
kinases (29). Our results indicate that a member of the NF-
B family of transcription factors might be critical for activation-induced MICA gene expression (Fig. 1).
Although different PKC family members can be activated by PMA (35), only PKC-
has been shown to be rapidly recruited to the site of TCR clustering (36) and coupled to NF-
B activation in T cells (37, 38, 39). Also, PKC-
synergizes with calcineurin to activate the IL-2 promoter in T cells (40). As we have demonstrated that MICA expression in T cells can be triggered by CD3 microaggregation (Ref. 17 and Fig. 1), that this process involves IL-2 dependent signaling routes (18), and that MICA expression is regulated by NF-
B, we can speculate that this isoform of PKC might be a major intermediate in PMA-induced MICA expression in T lymphocytes (Fig. 1).
Analysis of I
B
in whole cell lysates, and p65(RelA) and p50 in nuclear extracts of activated T cells demonstrated that different waves of activation of this transcription factor are triggered during T cell activation (Fig. 2). The rapid but transient decrease in I
B
that we observed in our experiments is most likely due to resynthesis of this protein induced by release of biologically active NF-
B (41, 42). In concordance, it has been demonstrated that in T cells, NF-
B is activated by CD3 engagement but once the cells are induced to express the high affinity IL-2 receptor and to secrete IL-2, this cytokine induces a second wave of I
B
degradation and NF-
B activation (19, 20, 21). Hence, the observed biphasic degradation of I
B
might be due to a first signaling route induced by CD3 engagement or activation through CD28, and a second signaling route induced by IL-2. Degradation of I
B
was accompanied by nuclear mobilization of p65 and p50 (Fig. 2), which coincides with the plateau of MICA expression (17).
Thereafter, we investigated whether NF-
B regulates MICA expression directly or through an indirect mechanism, inducing other transcription factors which in turn could bind to the MICA gene. Because we observed inhibition of MICA expression regardless of the time of Sz addition to the cultures (i.e., NF-
B inhibition, Fig. 3), we conclude that NF-
B activity regulates activation-induced expression of MICA on T lymphocytes through a mechanism that involves direct binding to a putative regulatory
B site located in the MICA gene.
To investigate this hypothesis, we searched for putative
B-binding sites in the MICA gene, and found a
B site located in intron 1, spanning positions 582591 (Fig. 4). EMSA using double-stranded, synthetic oligonucleotide carrying this
B-MICA site demonstrated the presence of one or more transcription factors of the NF-
B family in nuclear extracts from T cells stimulated with anti-CD3 mAb or anti-CD28 mAb plus PMA (Fig. 5). Gel supershift assays provided straightforward evidence demonstrating that p65(RelA)/p50 heterodimers and p50/p50 homodimers constitute these T cell NF-
B complexes that bind to the
B-MICA sequence (Fig. 6). It has been demonstrated that p65/p50 heterodimers, but not p50/p50 homodimers, are transcriptional activators due to the presence of a transactivating domain in the p65 molecule (22, 43). Consequently, one of the NF-
B complexes that binds to the MICA gene sequence used in our experiments has a demonstrated transcriptional promoting activity, and the balance between p65/p50 heterodimers and p50/p50 homodimers ultimately determines the nature and level of the target gene expression (44). However, under certain conditions an increased production of p50/p50 does not lead to transcriptional silencing but to transcriptional activation through different mechanisms that involve Bcl-3 (45, 46, 47). Besides, our findings confirm that activation-induced expression of MICA in T cells is regulated by NF-
B p65/p50 heterodimers and p50/p50 homodimers.
In addition to its pivotal role in immune response and inflammation, NF-
B regulates the expression of genes that control cell cycle (48) and cancer development (27, 49, 50). Because MICA was demonstrated to be expressed in different tumor cells (2, 4, 6, 7, 11, 12, 13, 14), we wondered whether inhibition of NF-
B in tumor cells using Sz may induce a similar effect on MICA expression as described for T lymphocytes (Fig. 7). From these experiments, we conclude that this transcription factor also modulates MICA expression in the epithelial tumor HeLa cell line. This conclusion was reinforced by transient transfection with p65(RelA).
Our results provide the first evidence of a transcription factor that regulates MICA gene expression. The regulation of MICA expression in proliferating T lymphocytes and HeLa tumor cells by NF-
B might be connected to the process of cell activation and neotransformation, two cellular processes coincidentally regulated by the same transcription factor (20, 21, 51). In turn, expression of MICA on T lymphocytes during the course of an immune response might allow the establishment of a cross-talk with cells expressing NKG2D. In this sense, it has been recently demonstrated that NK cells are abundant in T cell areas of secondary lymphoid organs (52, 53), where they interact with dendritic cells (54, 55). It is likely that NK cells also interact with activated T cells bearing NKG2D ligands on their surface. This interaction may regulate secretion of cytokines by T lymphocytes and NK cells, and/or trigger the cytolysis of MICA-expressing T cells contributing to shut-off immune effector functions in peripheral tissues. Accordingly, mitogen-activated lymphoblasts can be destroyed by NK cells in a NKG2D-dependent manner (14), although formal proof of the involvement of MICA in this process has not yet been provided. Hence, the NF-
B-dependent regulation of MICA expression on activated T lymphocytes might constitute a novel mechanism of regulation of T cell functions during an ongoing immune response, revealing a potential target for immune intervention to modulate its expression in pathological disorders.
In summary, the unusually long first intron of the MICA gene contains a NF-
B-binding site that binds p65 (RelA)/p50 heterodimers and p50/p50 homodimers of the NF-
B transcription factor family. These NF-
B complexes play an important role in the regulated expression of the stress/activation-inducible MICA molecule. These findings may be of potential relevance in designing strategies to modulate NKG2D-mediated cytotoxicity or cytokine secretion by NK cells, 
V
1 T cells, or 
CD8+ T cells in pathological situations.
| Footnotes |
|---|
1 This work was supported by grants from Agencia Nacional de Promoción Científica y Tecnológica (ANPCYT), UBA, Consejo Nacional de Investigaciones Científicas y Técnicas de Argentina (CONICET), and Fundación Antorchas (to N.W.Z.). L.L.M. and M.B.F. are postgraduate fellows of CONICET. M.V.G. is a fellow of UBA. G.A.R., L.F., M.A.C., and N.W.Z. are members of the Researcher Career of CONICET. ![]()
2 Address correspondence and reprint requests to Dr. Norberto W. Zwirner, Laboratorio de Inmunogenética, Hospital de Clínicas "José de San Martín", Avenida Córdoba 2351, 3er piso., C1120AAF Buenos Aires, Argentina. E-mail address: nwz{at}sinectis.com.ar ![]()
3 Abbreviations used in this paper: MICA, MHC class I-related chain A; IKK, I
B kinase; Sz, sulfasalazine; PKC, protein kinase C. ![]()
Received for publication October 31, 2003. Accepted for publication August 30, 2004.
| References |
|---|
|
|
|---|

T cells of MICA and MICB. Proc. Natl. Acad. Sci. USA 96:6879.
T cells. Science 279:1737.
T cells by NKG2D via engagement by MIC induced on virus-infected cells. Nat. Immunol. 2:255.[Medline]
2V
2 T cells enhances their antigen-dependent effector function. Immunity 15:83.[Medline]
B and Rel proteins: evolutionary conserved mediators of immune response. Annu. Rev. Immunol. 16:225.[Medline]
B transcription factors. Oncogene 18:6910.[Medline]
B/I
B signal transduction in the generation and treatment of human cancer. Cancer Lett. 181:1.[Medline]
B, chemokine gene transcription and tumor growth. Nat. Rev. Immunol. 2:664.[Medline]
B as a target for cancer drug development. Leukemia 16:1053.[Medline]
B in cancer: from innocent bystander to major culprit. Nat. Rev. Cancer 2:301.[Medline]
B. J. Clin. Invest. 101:1163.[Medline]
B activity by sulfasalazine is mediated by direct inhibition of I
B kinases
and
. Gastroenterology 119:1209.[Medline]
priming increases glucocorticoid inhibition of TNF-
-induced cytotoxicity/apoptosis. J. Clin. Invest. 98:1409.[Medline]
B/Rel DNA-binding motifs: interaction of both subunits of NF-
B with DNA is required for transcriptional activation. Mol. Cell. Biol. 12:4412.
during T-cell activation. Nature 385:83.[Medline]
B by functional cooperation between Vav and PKC
in T lymphocytes. J. Biol. Chem. 275:24547.
is required for TCR-induced NF-
B activation in mature but not immature T lymphocytes. Nature 404:402.[Medline]
demonstrates cell-type selective function. Eur. J. Immunol. 30:3645.[Medline]
to activate JNK and IL-2 promoter in T lymphocytes. EMBO J. 17:3101.[Medline]
B controls expression of inhibitor I
B
: evidence for an inducible autoregulatory pathway. Science 259:1912.
B-NF-
B signaling module: temporal control and selective gene activation. Science 298:1241.
B functions as a potent transcriptional activator and a target for v-Rel-mediated repression. Proc. Natl. Acad. Sci. USA 89:1875.
B homodimer) acts as a repressor of H-2Kb gene expression in metastatic tumor cells. J. Exp. Med. 177:1651.
B motifs via association with DNA-binding p50B homodimers. Cell 72:729.[Medline]
B proteins, has distinct specificity towards the Rel family of proteins. Oncogene 8:2067.[Medline]
B-inducible BCL-3 expression is an autoregulatory loop controlling nuclear p50/NF-
B1 residence. J. Biol. Chem. 276:32080.
B genes and activity in human cancer. Oncogene 18:6938.[Medline]
B. J. Clin. Invest. 107:241.[Medline]
This article has been cited by other articles:
![]() |
J. E. Butler, M. B. Moore, S. R. Presnell, H.-W. Chan, N. J. Chalupny, and C. T. Lutz Proteasome Regulation of ULBP1 Transcription J. Immunol., May 15, 2009; 182(10): 6600 - 6609. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Yadav, J. Ngolab, R. S.-H. Lim, S. Krishnamurthy, and J. D. Bui Cutting Edge: Down-Regulation of MHC Class I-Related Chain A on Tumor Cells by IFN-{gamma}-Induced MicroRNA J. Immunol., January 1, 2009; 182(1): 39 - 43. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Fuertes, M. V. Girart, L. L. Molinero, C. I. Domaica, L. E. Rossi, M. M. Barrio, J. Mordoh, G. A. Rabinovich, and N. W. Zwirner Intracellular Retention of the NKG2D Ligand MHC Class I Chain-Related Gene A in Human Melanomas Confers Immune Privilege and Prevents NK Cell-Mediated Cytotoxicity J. Immunol., April 1, 2008; 180(7): 4606 - 4614. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Tiruppathi, J. Shimizu, K. Miyawaki-Shimizu, S. M. Vogel, A. M. Bair, R. D. Minshall, D. Predescu, and A. B. Malik Role of NF-{kappa}B-dependent Caveolin-1 Expression in the Mechanism of Increased Endothelial Permeability Induced by Lipopolysaccharide J. Biol. Chem., February 15, 2008; 283(7): 4210 - 4218. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Andresen, H. Jensen, M. T. Pedersen, K. A. Hansen, and S. Skov Molecular Regulation of MHC Class I Chain-Related Protein A Expression after HDAC-Inhibitor Treatment of Jurkat T Cells J. Immunol., December 15, 2007; 179(12): 8235 - 8242. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Liu, L. Ye, G. J. Christianson, J.-Q. Yang, D. C. Roopenian, and X. Zhu NF-{kappa}B Signaling Regulates Functional Expression of the MHC Class I-Related Neonatal Fc Receptor for IgG via Intronic Binding Sequences J. Immunol., September 1, 2007; 179(5): 2999 - 3011. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Qian, K. S. Tan, S.-J. Wei, H.-M. Wu, Z. Xu, B. Wilson, R.-B. Lu, J.-S. Hong, and P. M. Flood Microglia-Mediated Neurotoxicity Is Inhibited by Morphine through an Opioid Receptor-Independent Reduction of NADPH Oxidase Activity J. Immunol., July 15, 2007; 179(2): 1198 - 1209. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Cerboni, A. Zingoni, M. Cippitelli, M. Piccoli, L. Frati, and A. Santoni Antigen-activated human T lymphocytes express cell-surface NKG2D ligands via an ATM/ATR-dependent mechanism and become susceptible to autologous NK- cell lysis Blood, July 15, 2007; 110(2): 606 - 615. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zeold, M. Doleschall, M. C. Haffner, L. P. Capelo, J. Menyhert, Z. Liposits, W. S. da Silva, A. C. Bianco, I. Kacskovics, C. Fekete, et al. Characterization of the Nuclear Factor-{kappa}B Responsiveness of the Human dio2 Gene Endocrinology, September 1, 2006; 147(9): 4419 - 4429. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Mincheva-Nilsson, O. Nagaeva, T. Chen, U. Stendahl, J. Antsiferova, I. Mogren, J. Hernestal, and V. Baranov Placenta-Derived Soluble MHC Class I Chain-Related Molecules Down-Regulate NKG2D Receptor on Peripheral Blood Mononuclear Cells during Human Pregnancy: A Possible Novel Immune Escape Mechanism for Fetal Survival J. Immunol., March 15, 2006; 176(6): 3585 - 3592. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Maasho, J. Opoku-Anane, A. I. Marusina, J. E. Coligan, and F. Borrego Cutting Edge: NKG2D Is a Costimulatory Receptor for Human Naive CD8+ T Cells J. Immunol., April 15, 2005; 174(8): 4480 - 4484. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |