| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Division of Host Defense, Center for Neural Disease and Cancer, and
Division of Respiratory Diseases, Department of Internal Medicine, Nagoya University Graduate School of Medicine, Nagoya, Japan;
Division of Host Defense, Research Center for Prevention of Infectious Diseases, Medical Institute of Bioregulation, Kyushu University, Fukuoka, Japan; and
Division of Biochemistry and Molecular Dentistry, Department of Developmental Medicine, Graduate School of Medical and Dental Sciences, Kagoshima University, Kagoshima, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
chain and STAT6 for signaling, IL-13 shares some biological activities with IL-4, such as the promotion of human B cell growth and the switching of B cells to the IgE isotype (5). Furthermore, it has been shown that IL-13 is a critical mediator in experimental models of allergic asthma (6, 7). Thus, IL-13 is considered to be the key modulator in the pathogenesis of Th2-induced allergic inflammation (8). Although the mechanisms that regulate IL-13 production in T cells or mast cells remain largely unknown, it has been reported that GATA-3 plays an important role in IL-13 production in T cells (9). GATA-3 has been reported to be involved in the chromatin remodeling of Th2 cytokine genes and the improvement in the accessibility of transcriptional factors to promoter regions of Th2 cytokines (10). Furthermore, it has recently been reported that GATA-3 binding sites in the proximal IL-13 promoter are necessary for cell type-specific expression of IL-13 (11). However, the mechanisms that activate IL-13 transcription immediately in response to stimulation are still underexplored. Although rapid phosphorylation of GATA proteins after various types of stimulation has been reported, the role of these phosphorylations in transcriptional regulation is still controversial (12, 13). Furthermore, almost nothing is known about the regulation of IL-13 gene in mast cells. Mast cells have high expression levels of GATA-1 and GATA-2 but little expression of GATA-3, and the roles of GATA-1 and GATA-2 in IL-13 transcription have not been explored (14, 15).
GATA proteins are tissue-restricted transcription factors that bind a WGATAR DNA motif through a zinc-finger DNA-binding domain. Based on sequence homology and expression patterns, GATA proteins have been divided into two subfamilies, GATA-1–3 and GATA-4–6 (16). The former family is prominently expressed in hemopoietic stem cells, and the latter family is expressed in various mesoderm- and endoderm-derived tissues (17). GATA-1 and GATA-2 are expressed in mast cells, erythroblasts, and megakaryocytes (14, 18), and are instrumental for tissue-specific gene expression. Genes that are selectively expressed in mast cells and whose expression depends on GATA proteins include those encoding carboxypeptidase A, several mast cell-specific proteases and the IgE receptor - and 
-chains (14, 19, 20, 21). Furthermore, GATA-1 and -2 play important roles in the transcription of Th2 cytokine genes such as IL-4 and IL-5 in mast cells (22, 23).
Several observations suggest that AP-1, which is a dimeric complex of a Jun family protein and a Fos family protein, may functionally interact with GATA proteins. First, GATA and AP-1 sites are found in close association in the core hypersensitivity sites of the globin locus control region and in a number of erythroid promoters (24, 25). Second, a number of experiments have indicated that GATA sites in conjunction with an AP-1 site constitute an active promoter, whereas GATA sites in conjunction with a TATA box alone do not form an active promoter (25, 26). In the promoter of the endothelin-1 gene, the Jun/Fos heterodimer was found to cooperate with GATA-2 in the activation of transcription (27). Moreover, the IL-5 promoter has been shown to require both AP-1 and GATA elements for its activity in T cells (28).
In our present study, we have investigated the promoter region necessary for IL-13 transcription and found that AP-1 and GATA binding sites are indispensable for IL-13 transcription. We focused on the functional interaction between GATA and AP-1 in the IL-13 promoter context. Transfection experiments revealed that GATA-1 and GATA-2 proteins are able to associate with AP-1 proteins. We also found that overexpression of GATA-1 induced excess binding of AP-1 to the IL-13 promoter as well as a significant increase in IL-13 production.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RPMI 1640 medium and FCS were purchased from Sigma-Aldrich (St. Louis, MO). LPS from Escherichia coli serotype 055:B5, the mouse monoclonal anti-DNP Ab, the DNP-human serum albumin, ionomycin, and PMA were obtained from Sigma-Aldrich. Anti-histone H3 Ab, anti-Myc mAb, anti-Flag M2 mAb, anti-Jun polyclonal Ab, anti-fos polyclonal Ab, anti-GATA-1 mAb, and anti-GATA-2 mAb were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).
Cells
The MC/9 mouse mast cell line was cultured as previously described (29). The PT18 mouse mast cell line was kindly provided from Dr. K. Okumura (Juntendo University, Tokyo, Japan). The P815 mouse mastcytoma cells were obtained from Cell Resource Center for Biomedical Research (Tohoku University, Sendai, Japan). These cells were grown in RPMI 1640 with 10% FCS. Bone marrow-derived mast cells (BMMCs)3 were derived from femoral bone marrow cells of 6-wk-old BALB/c mice. After 3 wk of culture with 10% WEHI-3-conditioned medium, the cells were harvested for the experiments and consisted of >98% mast cells assessed by toluidine blue staining.
A human embryonic kidney cell line, HEK 293T, was maintained in DMEM with 10% FCS. Cells were washed twice and incubated in fresh culture medium for 6 h and stimulated with PMA (10 ng/ml) plus ionomycin (1 µg/ml) or LPS (1 µg/ml) unless otherwise indicated. For the cross-linking of Fc
RI on mast cells, cells were sensitized by incubation for 2 h with 1 µg/ml anti-DNP IgE in RPMI 1640 containing 10% FCS, washed, incubated (2 x 106 cells/ml) for 6 h in RPMI 1640 containing 10% FCS, and stimulated with 10 ng/ml DNP-human serum albumin.
IL-13 promoter constructs
DNA fragments of the murine IL-13 promoter were amplified by PCR using the primers: senses CGGGGTACCGGGGTAGGGGAGCTGAATAG (pGL3–2024), CGGGGTACCGCTGTCATGTTTTCCCCAGT (pGL3–1253), CGGGGTACCGAGTTCAAGCTGCCCACTG (pGL3–705), CGGGGTACCATAGTGTGGTTGGAAGTGGC (pGL3–560), CGGGGTACCGAAAGGAAGGAAGGGAGGAA (pGL3–428), CGGGGTACCGTGTCAAGGGGTCAGCATT (pGL3–322), CGGGGTACCTCTTTCCTTTAGCGGCCAC (pGL3–156), CGGGGTACCAAGATGAGTAAAGATGTGG (pGL3–106), CGGGGTACCGATGTGGTTTTCAGATA (pGL3–94), CGGGGTACCGTGAGGCGTCATCACTTTGG (pGL3–51), and an antisense TCCGCTCGAGTGAGAGAACCAGGGAGCTGT. All PCR products were then cloned into a pGEMTeasy vector (Promega, Madison, WI) and digested with XhoI and KpnI, and the inserts were subcloned into a pGL3-basic vector (Promega). The mutations of the promoter region between –106 and –94 were prepared by ligating two PCR products amplified by primers: sense CGGGGTACCGAGTTCAAGCTGCCCACTG, antisense GCTAGCATTTTTTTTTTTCTTTTTTGG (Mut1) or GCTAGCATCTTGAATTTTTTTTTTTCTTTTTTGG (Mut2), and sense GCTAGCTGAGTAAAGATGTGGTTTTC (Mut1) or GCTAGCAGATGTGGTTTTCAGATAATGCCC (Mut2) and antisense TCCGCTCGAGTGAGAGAACCAGGGAGCTGT; after NheI digestion. The ligated DNA fragment was cloned into a pGL3 luciferase vector.
Mammalian expression plasmids.
The expression plasmids for the Myc-tagged mouse GATA-1 and GATA-2 were prepared by cloning the mouse GATA-1 or GATA-2 cDNAs inserted into pBluescript KS (+) vectors. A series of mouse GATA-1 deletion mutants was prepared by PCR from pEFBOS-Myc GATA-1 as the template using the sense primers: ACGCGTATGGAGGGAATTCCTGGGG (
1–86), ACGCGTCCATTGGCCCCTTGTGAG (N and N + C), ACGCGTCCCATGGATTTTCCTGGTC (C), GGCGCGCCTTGTCAGCAAACGGGCAGGC (N + C + NF) and antisense primers: ACGCGTTCAAGAACTGAGTGGGGC (1–86 and N), GGCGCGCCCCCCGCTTCTTTTTCCCTTT (C, N + C, and N + C + NF); after MluI or AscI digestion, PCR products were cloned into the pEFBOS-Flag or pEFBOS-Myc vector. NF and CF plasmids were prepared by ligating two PCR products amplified by primers: sense ACGCGTCCCATGGATTTTCCTGGTC, antisense CTCGAGACAAGGGGCCAATGGCAGGC (NF) CTCGAGGCTGCCCGTTTGCTGACAAT (CF), and sense CTCGAGATTGTCAGCAAACGGGCAGG (N) CTCGAGAAGCTCCATCAGGTGAACCG (C), antisense ACGCGTTCAAGAACTGAGTGGGGC; after XhoI digestion. The ligated DNA fragment was cloned into pEFBOS-Myc vector. The expression plasmid for mouse c-jun (pEFBOS-Flag-c-jun) and N-terminal deletion mutants (pEFBOS-Myc-DN-c-jun) were prepared by RT-PCR using the sense primer: ACGCGTATGACTGCAAAGATGGAAAC (c-jun), ACGCGTAGCCAGAACACGCTTCCCAGT (DN-c-jun), and antisense primer: ACGCGTTCAAAACGTTTGCAACTGCT. PCR products, digested with MluI, were subcloned into the pEFBOS-Flag or pEFBOS-Myc vector. All plasmid constructs were verified by restriction enzyme mapping and nucleotide sequencing. pAP-1 Luc, which is designed for monitoring induction of AP-1, were purchased from BD Clontech (Palo Alto, CA).
Transfection and luciferase assay
Cells were transiently transfected with 3.5 µg of IL-13 promoter/luciferase plasmid and 0.1 µg of pRL/SV40 (an internal control) by DMRIE-C Reagent (Invitrogen Life Technologies, Carlsbad, CA) according to the manufacturer’s instructions. When indicated, cells were cotransfected with the indicated amount of GATA or c-jun expression vector or an empty vector with 1 µg of the IL-13 promoter/luciferase plasmid. Forty-eight hours after the transfection, the cells were stimulated for 12 h. The luciferase activity was measured by using the Dual-Luciferase Reporter Assay System (Toyo Ink, Tokyo, Japan) according to the manufacturer’s instructions. HEK293T cells were transiently transfected with a combination of expression plasmids (2 µg total/plate) by LipofectAMINE (Invitrogen Life Technologies) according to the manufacturer’s instructions.
Immunoblotting, immunoprecipitation, and DNA-binding protein purification
Nuclear and cytoplasmic lysate preparation, immunoblotting, and immunoprecipitation were performed as previously described (30, 31). AP-1 and associating proteins were harvested using a DNA-binding protein purification kit (Roche, Basel, Switzerland) according to the manufacturer’s instruction. The kit contains magnetic particles coupled to a double-stranded oligonucleotide. To this tethered oligonucleotide, double-stranded oligonucleotides containing the sequence for AP-1-binding were ligated. The sequences of oligonucleotides are as follows: sense CTAGTGATGAGTCAGCCGGAT (AP-1), GCTTACAATGAAGGCTTACAATGAAG (scramble), and antisense ATCCGGCTGACTCATCACTAG (AP-1), CTTCATTGTAAGCCTTCATTGTAAGC (scramble). Nuclear extracts were applied to the magnetic particles, and the oligo-particle complex captured the AP-1 protein. Separation of the bound protein from the supernatant was performed with a magnetic separator and washing steps. The purified proteins were eluted with a buffer of high ionic strength.
EMSA
Nuclear extracts were prepared as previously described (30). The double-strand DNA fragment carrying the region between –108 and –94 of the mouse IL-13 gene 5' upstream region was prepared by annealing two oligonucleotides: sense TTCAAGATGAGTAAA and antisense TTTACTCATCTTGAA, followed by 32P labeling by T4 nucleotide kinase. The sequences of mutated version were as follows: sense TGCTAGCTGAGTAAA (Mut1), TTCAAGATGGCTAGC (Mut2), and antisense TTTACTCAGCTAGCA (Mut1), GCTAGCCATCTTGAA (Mut2). Nuclear extracts (5 µg of total protein) were incubated with the 32P-labeled double-stranded probe. For competition assays, nuclear extracts were incubated with a 50-fold molar excess of the unlabeled probe before the addition of the 32P-labeled probe. For the supershift experiment, 1 µg of the indicated Ab was incubated with nuclear extracts for 2 h before the binding reaction. Samples were run on a 5% nondenaturing polyacrylamide gel in Tris/glycine/EDTA buffer. The gel was dried and visualized by autoradiography.
Chromatin immunoprecipitation (ChIP) assay
A ChIP assay was performed as previously described (32). The chromatin, sheared by sonication was immunoprecipitated with anti-fos Ab overnight at 4°C. Harvested DNAs were PCR amplified in a final volume of 50 µl containing 2.5 mmol/L magnesium dichloride, 2.5 U (AmpliTaq; PerkinElmer, Wellesley, MA), and 1 µmol/L-specific primers. The IL-13 promoter-specific primers are as follows (–156 to +52): sense, AAGATGAGTAAAGATGTGG; antisense, TGAGAGAACCAGGGAGCTGT. The downstream of IL-13 promoter-specific primers are as follows (+2943 to +3138): sense, ATGAGTCTGTCAGTGTCCCG; antisense, CCGTGGCAGACAGGAGTGTT. PCR conditions are as follows: 94°C for 5 min; 94°C for 45 s; 60°C for 45 s; 72°C for 45 s; and 72°C for 7 min. PCR was done for 27 cycles. Five microliters of each PCR product were run on a 2% agarose gel for UV visualization. For each reaction, 1% of cross-link released chromatin was saved and used as input control.
Cytokine ELISA
The cell-free culture supernatants were measured for the concentration of IL-13 (BD Pharmingen, San Diego, CA) by ELISA according to the manufacturer’s instructions.
Generation of stable transfectants
P815 cells were transfected with 3 µg of pEFBOS-Myc-GATA-1 vector along with 1 µg of pCDNA3 plasmid (Invitrogen Life Technologies). Transfectants were selected with G418 (0.8 µg/ml). After 4 wk, resistant clones were screened for the right-sized protein expression by Western blotting.
Statistical analysis
The statistical significance of the data was determined by the Student’s t test. A p value of <0.05 was taken as significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To investigate the mechanism of IL-13 transcription in mast cells, we examined three well-established mast cell lines, MC/9 cells, PT18 cells, and P815 cells. These cell lines were stimulated with LPS, IgE cross-linking, or PMA/ionomycin, and we confirmed that MC/9 cells, as well as BMMCs, produced IL-13 in response to all of these three stimulations, and that PT18 and P815 cells responded only to stimulation by PMA/ionomycin (Fig. 1A).
|
As shown in Fig. 1B, the highest induction was obtained with pGL3–2024 for PMA/ionomycin treatment. Four shorter constructs (1253, 705, 560, and 428) showed similar induction levels for PMA/ionomycin treatment. However, further deletion down to 322 caused a reduction in activity, and responsiveness was abrogated when the construct was deleted down to –51. Next, we made two constructs (–106 and –94) and examined the promoter activities of constructs shorter than –428 after PMA/ionomycin stimulation in PT18 cells. As shown in Fig. 1C, responsiveness was abrogated when the construct was deleted down to –94 (pGL3–94).
These constructs were also transfected into MC/9 cells and P815 cells. As shown in Fig. 1D, the results of MC/9 cells stimulated with PMA/ionomycin were similar to those of PT18 cells. The degree of response to this treatment was reduced with the reduction in the length of the construct, and was abrogated when the construct was shortened down to –94. In the case of stimulation by IgE cross-linking and LPS, the responsiveness of luciferase activity was maintained until the construct was shortened to –106 but was abrogated at –94. The high degree of inducibility through PMA/ionomycin stimulations and low degree of inducibility through IgE cross-linking and LPS stimulations were considered to reflect the production levels of IL-13, as shown in Fig. 1A. The luciferase activities of P815 cells were similar to those of PT18 cells and MC/9 cells. As shown in Fig. 1E, responsiveness was abrogated when the construct was deleted down to –94 (pGL3–94). These findings suggest that the fragment from –106 to the +62 fragment contains the minimal murine IL-13 promoter, and that the promoter region between –106 and –94 plays an important role in the induction of IL-13 promoter activity in mast cells.
The role of the promoter region between –106 and –94 in murine IL-13 gene expression in mast cells
A search in the nucleotide sequence upstream of the transcriptional start sites for the potential binding sites of transcriptional factors was conducted using TRANSFAC (http://www.motif.genome.ad.jp; cutoff score = 80), and GATA and AP-1 binding sites were found in the region between –106 and –94. To confirm that the promoter region between –106 and –94 is functionally involved in IL-13 transcription, we made two constructs based on the pGL-705 construct, which we designated Mut1 and Mut2, and compared their activities with the activity of pGL-705. The TRANSFAC program predicted that Mut1 would show a reduced GATA binding potential as the score is reduced from 84 to 68, but would show an increased AP-1-binding potential as the score is slightly raised from 82 to 85. In the case of Mut2, the program predicted reduced AP-1-binding potential (the score was reduced from 82 to 55) and increased GATA-binding potential (the score was raised from 84 to 90). As shown in Fig. 2B, each mutant construct showed a significant reduction of promoter activity in response to PMA/ionomycin in both PT18 and MC/9 cells. A reduction of promoter activity was also confirmed in P815 cells (Fig. 2B). These findings indicate the functional involvement of GATA or AP-1 in the IL-13 promoter region between –106 and –94.
|
EMSA was conducted to determine whether protein-DNA binding within the region between –106 and –94 is involved in the activation of the IL-13 promoter. Nuclear extracts prepared from PT18 cells stimulated with PMA/ionomycin or not were incubated with a 32P-labeled probe spanning the IL-13 promoter region between –108 and –94. EMSA revealed the presence of two protein complexes binding to the probe (Fig. 3A). While the faster complex appeared constitutively, the slower one appeared after PMA/ionomycin stimulation. These two complexes were also observed in BMMCs and MC/9 cells, which were stimulated with LPS, IgE cross-linking, or PMA/ionomycin (Fig. 3A).
|
To further confirm the components of these two protein-DNA complexes, Abs against GATA and AP-1 were added in the EMSAs. It has been reported that mast cells show high expression of GATA-1 and GATA-2, but not GATA-3 (14, 15). We also confirmed by Northern blotting that PT18 cells and MC/9 cells express GATA-1 and GATA-2 but not GATA-3 (data not shown). As shown in Fig. 3C, a combination of Abs against AP-1 subunits (at Fos and at Jun) efficiently abrogated or supershifted the inducible slower complexes. In contrast, a combination of Abs against GATA-1 and GATA-2 efficiently abrogated both the faster migrations and the slower migrations. These findings demonstrate that Jun/Fos complexes constitute the slower migrations and GATA-1 and GATA-2 account for both the slower and the faster migrations. Taken together, these findings indicate that GATA-1 and GATA-2 bind to the region between –106 and –94 constitutively, and AP-1 binds only after stimulation.
AP-1 activities are indispensable for the activation of the IL-13 promoter
To investigate the role of AP-1 in IL-13 transcription in mast cells, we transfected an expression plasmid encoding an N-terminally truncated form of c-jun (DN-c-jun), which has been reported to work in a dominant-negative fashion (33). We confirmed that DN-c-jun inhibits AP-1 activity in PT18 cells in a dose-dependent manner (Fig. 4A). We then transiently transfected pGL-106 with DN-c-jun or control vector into PT18 cells and stimulated the cells with PMA/ionomycin for 12 h. As shown in Fig. 4B, the induction of luciferase activity was significantly reduced by DN-c-jun. These findings suggest that AP-1 activity plays a critical role in the transcriptional activation of the IL-13 gene.
|
As shown in Fig. 3, not only AP-1 but also GATA-1 and GATA-2 bind to the region between –106 and –94 in the IL-13 promoter that is involved in transactivation of the IL-13 gene. To examine the ability of GATA-1 and GATA-2 to transactivate the IL-13 promoter, GATA-1 or GATA-2 expression plasmids were transfected in combination with pGL-106, and luciferase activity was measured after various stimulations. In MC/9 cells stimulated with IgE cross-linking or PMA/ionomycin, both GATA-1 and GATA-2 transactivated the IL-13 promoter in a dose-dependent manner. Basal luciferase activity was also up-regulated by overexpression of either GATA-1 or GATA-2. Similar results were obtained with P815 cells (Fig. 4C).
To further confirm the role of GATA in IL-13 transcription, PT18 cells were transfected with pGL-705 or Mut 2, which are described above and in Fig. 2, along with various amounts of GATA-1 or -2 expression plasmids and stimulated with PMA/ionomycin. Mut2 showed mild reduction of GATA-binding potential but great reduction of AP-1-binding potential to the region between –106 and –94 in the IL-13 promoter (Fig. 3B). As shown in Fig. 4D, GATA-1 and GATA-2 promoted IL-13 transcription in a dose-dependent manner (pGL-705), but when mutations were introduced into the region between –106 and –94 in the IL-13 promoter (Mut2), the transactivation of the IL-13 gene by GATA proteins was abrogated. These findings indicate the possible involvement of AP-1 in IL-13 transactivation by GATA.
Next, we transfected DN-c-jun into PT18 cells and evaluated the role of AP-1 in IL-13 transactivation by GATA. As shown in Fig. 4E, DN-c-jun clearly inhibited the transactivation of pGL-106 by GATA proteins in PT18 cells. These findings indicate that AP-1 is indispensable for the transactivation of the IL-13 gene induced by GATA proteins.
GATA-1 and GATA-2 associate with AP-1
It has been reported that the cooperativeness between GATA-2 and AP-1 synergistically increases the transcriptional activity of the endothelin-1 gene in endothelial cells (27). The authors demonstrated that GATA-2 and AP-1 bind into complexes in endothelial cells and HEK293 cells. However, the nature of this cooperativeness in the transcriptional activity of the IL-13 promoter in mast cells has not been explored. Moreover, it is not clear whether GATA-1 interacts with AP-1. To elucidate these points, GATA-1 or GATA-2 N-terminally tagged with Myc, and c-jun N-terminally tagged with Flag were expressed in HEK293T cells, and immunoprecipitation analyses were performed. In this cell line, GATA proteins exist constitutively in the nucleus, whereas c-jun proteins translocate into the nucleus from the cytoplasm only after stimulation (data not shown). The cells were stimulated with PMA/ionomycin and nuclear lysates were harvested. As shown in Fig. 5A, we found that c-jun was coprecipitated with GATA-1 or GATA-2 after PMA/ionomycin stimulations.
|
GATA-1 interacts with AP-1 through its N-terminal region, C-terminal region, and N-finger domain
To identify the AP-1-binding domain of GATA, we expressed several deletion mutants of GATA-1 in combination with Flag-tagged c-jun in HEK293T cells for coprecipitation assays. Although GATA proteins interact with other proteins through their N-terminal zinc finger or C-terminal zinc finger (16, 34), it has recently been reported that physical interaction is mediated through the N-terminal region or the C-terminal region of GATA (35). As shown in Fig. 6A, Flag-tagged c-jun was coprecipitated with all of the GATA deletion mutants: 1–86 (87–413), N (194–413), NF (1–199 and 249–413), CF (1–251 and 287–413), and C (1–318). These results suggest that at least two domains of GATA-1 are required for the interaction with c-jun.
|
N + C (194–318), and N + C + NF (250–318), and expressed them in combination with the wild-type c-jun for coprecipitation assays in HEK293T cells. As shown in Fig. 6B, Flag-tagged c-jun was coprecipitated with C, N, and N + C. However, no coprecipitation was detected for N + C + NF, suggesting that all of these sites are essential for GATA-1 to associate with c-jun.
To confirm the importance of the interaction between GATA and c-jun, we transfected N + C + NF in PT18 cells along with pGL-705 and performed luciferase assays. Transfection of this GATA deletion mutant reduced the transactivation of IL-13 by PMA/ionomycin significantly (Fig. 6C). These results indicate the importance of the interaction between GATA and AP-1 in IL-13 transcription.
Overexpression of GATA-1 promotes IL-13 production in vivo
To examine the ability of GATA-1 to promote the production of IL-13 in vivo, we transfected a Myc-tagged GATA-1 expression vector into P815 cells. Two clones stably expressing GATA-1 were isolated for analysis. As shown in Fig. 7A, one clone (designated 01) showed significant expression of Myc-tagged GATA-1, whereas the other clone (designated 02) showed only moderate expression. We then stimulated these cells with PMA/ionomycin and examined the production of IL-13 in culture supernatant. As shown in Fig. 7B, 01 cells showed significant IL-13 production and 02 cells showed moderate IL-13 production, whereas control cells produced much less IL-13.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In the present study, we have shown that both AP-1 and GATA account for the transactivation of the IL-13 gene and that AP-1 is indispensable for the transactivation of the IL-13 gene induced by GATA proteins (Fig. 4). Furthermore, overexpression of GATA-1 induced a significant amount of IL-13 production and significant binding of AP-1 to the IL-13 promoter (Fig. 7). These results indicate that activation of AP-1 is the key regulator of IL-13 transcription and that GATA proteins promote the binding of AP-1 to the IL-13 promoter in mast cells.
We have shown that GATA-1 and GATA-2 bind into complexes with AP-1 and that transfection of the deletion mutant of GATA-1 which results in the loss of association with c-jun (N + C + NF) significantly reduced the transactivation of the IL-13 gene in mast cells (Figs. 5 and 6). These results indicate the importance of physical interaction between GATA and AP-1 in IL-13 transcription. However, recently it has been reported that both GATA-1 and GATA-2 regulate the histone acetylation pattern of chromatin, which is thought to improve the accessibility of other transcriptional factors (38, 39). Although the DNase hypersensitivity pattern of the IL-13 gene in mast cells is unknown, it is possible that GATA proteins improve the binding of AP-1 to the IL-13 promoter through modifying chromatin, in addition to direct interaction.
Various GATA-interacting proteins, including DNA-binding factors and general transcription activators and repressors, have been described (16). Most physical interactions are mediated by either the N-terminal zinc finger or the C-terminal zinc finger (16, 34). However, it has recently been reported that the N-terminal region (between residues 146 and 215) of GATA-3 interacts with smad-3 (35). Furthermore, it has quite recently been reported that the N-terminal region of GATA-4 interacts with c-fos (40). We have shown that GATA-1 interacts through its N-terminal, C-terminal, and N-finger domains with c-jun and that disruption of any single domain of GATA-1 dose not result in loss of the interaction with c-jun. Thus, GATA proteins interact with AP-1 through multiple domains. AP-1 consists of two subunits formed either by the heterodimerization of a Fos family protein with a Jun family protein or the homodimerization of Jun family members (41, 42). In the present study, although GATA and c-jun were overexpressed in HEK293T cells for the examination of the interaction between AP-1 and GATA, some overexpressed c-jun proteins probably bound endogenous Fos family proteins and acted as AP-1. In addition to direct binding, c-jun might bind to GATA proteins through Fos family proteins or other unknown proteins, and this might be the reason why GATA proteins interact with AP-1 through multiple domains.
The roles of AP-1 and GATA in Th2 cytokine production in T cells have been described in detail. P1, an element of the IL-4 promoter that binds AP-1, is important for Th2-restricted IL-4 expression (43). The IL-5 promoter has been shown to require both AP-1 and GATA elements for its activity in T cells (28). Among the GATA family proteins, GATA-3 plays a central role in Th2 cytokine production in T cells (9). Similarly to GATA-3, JunB, a component of AP-1, stimulates the expression of multiple Th2 cytokine genes (44). In mast cells, GATA-1 and GATA-2 play important roles in the transcription of both IL-4 and IL-5 (22, 23). Furthermore, the activation of JNK plays an important role in Th2 cytokine production in mast cells (36, 45), and it is well known that JNK activates AP-1 through the phosphorylation of c-jun (46). Similarly to GATA and AP-1, the NF-AT has been reported to play an important role in Th2 cytokine productions in mast cells. The transcription of IL-4 in mast cells is dependent on an NF-AT site in the murine IL-4 gene (47). The transcription of IL-5 in mast cells is also dependent on NF-AT (23). In the murine IL-13 promoter, there is an NF-AT-like binding site between –216 and –227 bp and, as shown in Fig. 1, a reduction of IL-13 promoter activity was observed between pGL-322 and pGL-156. Furthermore, it has been reported that NF-AT acts in collaboration with both AP-1 and GATA (23, 48). In the present study, we have demonstrated that the interaction between AP-1 and GATA has a critical role in the production of IL-13 in mast cells. This interaction might play an essential role in Th2 cytokine production.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
1 This work was supported in part by grants from the Japanese Society for the Promotion of Science and Japanese Allergy Foundation. 
2 Address correspondence and reprint requests to Dr. Akio Masuda, Division of Host Defense, Center for Neural Disease and Cancer, Nagoya University Graduate School of Medicine, 65, Tsurumai-cho, Showa-ku, Nagoya 466-8550, Japan. E-mail address: amasuda{at}med.nagoya-u.ac.jp
3 Abbreviations used in this paper: BMMC, bone marrow-derived mast cell; ChIP, chromatin immunoprecipitation.
Received for publication March 25, 2004. Accepted for publication August 20, 2004.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RI -chain gene expression by GATA-1 via four GATA motifs in the promoter. J. Immunol. 170:334.-chain gene. J. Immunol. 163:623.-globin dominant control region function as an inducible enhancer in erythroid cells. Genes Dev. 4:993. regulation of GATA target genes. Curr. Biol. 12:35.[Medline]
Related articles in The JI:
This article has been cited by other articles:
|
|
 |
|
  L.-Q. Qiu, P. Cresswell, and K.-C. Chin Viperin is required for optimal Th2 responses and T-cell receptor-mediated activation of NF-{kappa}B and AP-1 Blood, April 9, 2009; 113(15): 3520 - 3529. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Bian, A. Masuda, T. Matsuura, M. Ito, K. Okushin, A. G. Engel, and K. Ohno Tannic acid facilitates expression of the polypyrimidine tract binding protein and alleviates deleterious inclusion of CHRNA1 exon P3A due to an hnRNP H-disrupting mutation in congenital myasthenic syndrome Hum. Mol. Genet., April 1, 2009; 18(7): 1229 - 1237. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Masuda, X.-M. Shen, M. Ito, T. Matsuura, A. G. Engel, and K. Ohno hnRNP H enhances skipping of a nonfunctional exon P3A in CHRNA1 and a mutation disrupting its binding causes congenital myasthenic syndrome Hum. Mol. Genet., December 15, 2008; 17(24): 4022 - 4035. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Lampronti, M. T.H. Khan, M. Borgatti, N. Bianchi, and R. Gambari Inhibitory Effects of Bangladeshi Medicinal Plant Extracts on Interactions between Transcription Factors and Target DNA Sequences Evid. Based Complement. Altern. Med., September 1, 2008; 5(3): 303 - 312. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Yagi, S. Tanaka, Y. Motomura, and M. Kubo Regulation of the Il4 Gene Is Independently Controlled by Proximal and Distal 3' Enhancers in Mast Cells and Basophils Mol. Cell. Biol., December 1, 2007; 27(23): 8087 - 8097. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W.-H. Leung and S. Bolland The Inositol 5'-Phosphatase SHIP-2 Negatively Regulates IgE-Induced Mast Cell Degranulation and Cytokine Production J. Immunol., July 1, 2007; 179(1): 95 - 102. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. G. Bert, B. V. Johnson, E. W. Baxter, and P. N. Cockerill A Modular Enhancer Is Differentially Regulated by GATA and NFAT Elements That Direct Different Tissue-Specific Patterns of Nucleosome Positioning and Inducible Chromatin Remodeling Mol. Cell. Biol., April 15, 2007; 27(8): 2870 - 2885. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Masuda, K. Hashimoto, T. Yokoi, T. Doi, T. Kodama, H. Kume, K. Ohno, and T. Matsuguchi Essential Role of GATA Transcriptional Factors in the Activation of Mast Cells J. Immunol., January 1, 2007; 178(1): 360 - 368. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. S. Sundrud, S. E. VanCompernolle, K. A. Eger, T. C. Bruno, A. Subramaniam, S. Mummidi, S. K. Ahuja, and D. Unutmaz Transcription factor GATA-1 potently represses the expression of the HIV-1 coreceptor CCR5 in human T cells and dendritic cells Blood, November 15, 2005; 106(10): 3440 - 3448. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
, Unstimulated, and, 
, stimulated conditions. A typical result of at least three independent experiments is shown. The result in C was confirmed in transfections using two independent preparations of each construct.
