The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kuo, T. C.
Right arrow Articles by Calame, K. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kuo, T. C.
Right arrow Articles by Calame, K. L.
The Journal of Immunology, 2004, 173: 5556-5563.
Copyright © 2004 by The American Association of Immunologists

B Lymphocyte-Induced Maturation Protein (Blimp)-1, IFN Regulatory Factor (IRF)-1, and IRF-2 Can Bind to the Same Regulatory Sites1

Tracy C. Kuo* and Kathryn L. Calame2,*,{dagger}

Departments of * Microbiology and {dagger} Biochemistry and Molecular Biophysics, College of Physicians and Surgeons, Columbia University, New York, NY 10032


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The transcriptional repressor B lymphocyte-induced maturation protein-1 (Blimp-1) is expressed in some differentiated cells and is required for terminal differentiation of B cells. To facilitate identification of Blimp-1 target genes, we have determined the optimal DNA recognition sequence for Blimp-1. The consensus is very similar to a subset of sites recognized by IFN regulatory factors (IRFs) that contain the sequence GAAAG. By binding competition and determination of equilibrium dissociation constants, we show that Blimp-1, IRF-1, and IRF-2 have similar binding affinities for functionally important regulatory sites containing this sequence. However, Blimp-1 does not bind to all IRF sites, and specifically does not recognize IRF-4/PU.1 or IRF-8 sites lacking the GAAAG sequence. Chromatin immunoprecipitation studies showed that Blimp-1, IRF-1, and IRF-2 all bind the IFN-{beta} promoter in vivo, as predicted by the in vitro binding parameters, and in cotransfections Blimp-1 inhibits IRF-1-dependent activation of the IFN-{beta} promoter. Thus, our data suggest that Blimp-1 competes in vivo with a subset of IRF proteins and help predict the sites and IRF family members that may be affected.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Blymphocyte-induced maturation protein-1 (Blimp-1)3 is a transcriptional repressor containing five Kruppel-type zinc fingers that confer sequence-specific DNA binding. It was originally cloned based on: 1) its ability to bind and repress the human IFN-{beta} promoter in vitro (1), and 2) its induction during differentiation of the B cell lymphoma 1 lymphoma and its ability to drive B cell lymphoma 1 differentiation (2). Blimp-1 is induced upon terminal differentiation of B cells to plasma cells and is sufficient to drive plasmacytic differentiation of activated B cells (3, 4). In addition to its importance in plasmacytic differentiation, Blimp-1 also plays a role in myeloid differentiation (5). In adult mice, Blimp-1 expression appears to be limited to terminally differentiated cells, although expression is not limited to the hemopoietic lineages (D. Chang and K. Calame, unpublished observations).

Conditional deletion of prdm1, the gene encoding Blimp-1, in B cells demonstrated that Blimp-1 is required for plasmacytic differentiation (6). These mice had significantly decreased Ig serum in response to both T-dependent and T-independent Ags. During plasmacytic differentiation, Blimp-1 regulates the expression of >250 genes (7). However, only a few direct targets, in which Blimp-1 binding and repression have been demonstrated, are known. These include c-myc (8), whose repression is important for cessation of cell cycle; CIITA (4), whose repression is important for extinction of class II MHC on plasma cells; Pax-5 (9), whose repression is required for plasmacytic differentiation; and Spi-B and Id3 (7), involved in BCR signaling.

Blimp-1 binding sites in known direct target genes all share similar sequences; however, a consensus binding sequence has not been identified. The two initial target sequences shown to be bound by Blimp-1 in vitro were the human IFN-{beta} site, positive regulatory domain I (PRDI) (1), and the c-myc site, plasmacytoma repressor factor (8). Other target genes have binding sites with similar sequences to these two sites (see Fig. 4). Interestingly, all five functional Blimp-1 binding sites have similarity with binding sites for a family of transcription factors called IFN regulatory factors (IRFs) (see Fig. 4).



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 4. Comparison of Blimp-1 and IRF target sequences. Previously defined Blimp-1 binding sites from all six known target genes are listed in the top group, and selected IRF binding sites from established target genes are listed in the lower group. Only IRFs that have been shown to have roles in hemopoietic development are listed with an example of each of their targets. The consensus for Blimp-1 determined in this study is shown, along with an IRF consensus sequence (11 ). We have chosen to show a dimer of the IRF core motif; however, members of the IRF family could bind to single, double, or multiple repeats of this core. Bolded and dotted nucleotides indicate identity to the consensus. The boxed nucleotides represent the most conserved nucleotides of the Blimp-1 consensus. Eleven and 12 bp of the targets are shown to compare with the 11-bp Blimp-1 consensus and 12-bp IRF-E (IFN regulatory factor element), respectively.

 
IRFs play a role in antiviral responses, immune responses, and hemopoietic development (10). The family consists of nine members that share homology in their N-terminal domain, which confers binding to DNA, but diverges in their C-terminal regions. Many names have been given to the specific DNA element that IRFs bind, including: 1) the IFN-stimulated response element, A/GNGAAANNGAAACT, found in most IFN-inducible promoters; 2) IFN consensus sequence, GAAAG/CT/C, found in the MHC class I promoter; and 3) the IRF element or PRD, G(A)AAAG/CT/CGAAAG/CT/C, in the IFN-{beta} promoter (11). These binding sites are related to one another and to Blimp-1 sites.

Although IRFs are important in antiviral responses, they are also important in hemopoietic cells. IRF-1, IRF-2, and IRF-3 are constitutively expressed at low levels in most cell types (12, 13), while IRF-4 (PU.1 interaction partner, lymphoid-specific IRF, NF enhancer motif 5) (14), IRF-7 (15), and IRF-8 (IFN consensus sequence binding protein) (16) are expressed primarily in hemopoietic cells. Gene targeting of IRF-4 and IRF-8 has established their importance in lymphocyte and macrophage maturation, respectively (17, 18). Mice deficient in IRF-2, but not mice deficient in IRF-1, exhibit defects in B cell development (19). However, mice expressing an IRF-1 transgene driven by Eµ have decreased B cells (20). IRF-1 and IRF-2 also affect cell proliferation: IRF-1 is a negative regulator of cell proliferation, and IRF-2 antagonizes IRF-1 (12). Blocking and overexpression studies have established an important role for IRF-7 in monocyte/macrophage differentiation (21). IRF-5 and IRF-6 are not well characterized; however, IRF-5 is primarily expressed in lymphoid tissues and PBLs (22).

The overlapping expression profiles of both Blimp-1 and IRF proteins and the apparent similarity of IRF and Blimp-1 binding sites prompted a more careful study of their binding capabilities. We have determined the consensus binding sequence for Blimp-1 and found it to be similar to a subset of previously determined consensus sequences for IRF proteins. We have also determined equilibrium dissociation constants (Kd) for Blimp-1 and IRF proteins using functional binding sites on known target genes. In vitro binding studies, cotransfections, and in vivo chromatin immunoprecipitation (ChIP) assays show overlapping binding of Blimp-1, IRF-1, and IRF-2 on sites containing a GAAAG sequence and functional competition between Blimp-1 and IRF-1. However, Blimp-1 does not compete with IRF proteins binding to IRF-4/PU.1 or IRF-8 sites lacking the GAAAG sequence. Thus, the transcription of genes containing GAAAG in their Blimp-1/IRF sites can potentially be regulated by the relative nuclear concentrations of Blimp-1, IRF-1, and IRF-2.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of rBlimp-1

Full-length murine Blimp-1 cDNA was amplified by PCR with the primers: 5'-NdeI-TACCCATATGAGAGAGGCTTATCTC and 3'-XhoI-TCCACTCGAGAGGATCCATCGGTTC from PSK-Blimp-1 (8). This fragment was ligated into the NdeI and XhoI sites of the expression vector PTYB2 (IMPACT T7 System; New England Biolabs, Beverly, MA). The purification of rBlimp-1 protein was performed, as described in the IMPACT T7 manual, with the following modifications. Bacterial cultures were grown at 25°C. The cleavage buffer contained 400 mM NaCl, 50 mM Tris (pH 7.5), 0.2 mM EGTA, and 0.2 mM EDTA. The presence of Blimp-1 protein in each fraction was determined by EMSA.

Random oligonucleotide selection

Random oligonucleotide selection with bacterially produced Blimp-1 was performed, as described (23), with modifications. A pool of 50-bp degenerate oligonucleotides, containing a 20-bp core of random nucleotides flanked by 15 bp of known sequences with restriction sites, was made double stranded by extension using the N20R oligonucleotides for 1 min at 94°C, 1 min at 40°C, and 20 min at 72°C. The sequence of the random oligonucleotide used was N20S-AGACGGATCCATTGCA-(N)20-CTGTAGGAATTCGGA, and the primers used for amplification were N20R-TCCGAATTCCTACAG and N20B-AGACGGATCCATTGCA. The double-stranded N20S oligonucleotides were EtOH precipitated and digested with BamHI and EcoRI to obtain 5' overhangs for fill in by Klenow with {alpha}-dCTP. Initially, 500 ng of the radiolabeled N20S (each oligonucleotide was calculated to be represented at least eight times) was incubated with Blimp-1 (amount determined by doing EMSA and calculating the amount necessary to bind 5% of radiolabeled c-myc probe) for 30 min on ice in binding buffer containing 10 mM Tris (pH 7.5), 1 mM DTT, 1 mM EDTA, 0.3 mM ZnCl2,1 µg of poly(dI-dC), and 5% glycerol in a final volume of 50 µl. EMSA was performed in 1.5-mm-thick 6% acrylamide gel. The shifted complex was excised from the gel and eluted from the acrylamide. The selected pool of DNA was extracted with phenol-chloroform and precipitated with ethanol in the presence of glyco-blue (Ambion, Austin, TX). The DNA pellet was resuspended in water. PCR was performed to amplify the retrieved pool using the buffer conditions suggested by Sigma-Aldrich (St. Louis, MO), along with the primers listed above, N20B and N20R. The amplification protocol for the PCR was: an initial denaturation at 94°C for 3 min, followed by 45 s at 94°C, 1 min at 50°C, and 30 s at 72°C for 25 cycles, and a final extension at 72°C for 10 min. The cycle described above was repeated two more times. Following the third round, a fraction of the purified product from the PCR was T-A cloned into pGEM vector (Promega, Madison, WI).

Following the ligation, the vector was cut with NcoI and NotI to ensure single inserts of the correct size. Fifty-one clones with correct inserts were picked and sequenced using the fmol DNA Cycle Sequencing System (Promega).

Relative affinity of selected oligonucleotides

The oligonucleotides of the clones used for competition EMSA were obtained from Invitrogen Life Technologies (Carlsbad, CA) and annealed to become double stranded. All of the oligonucleotides were designed so that they contained the flanking sequences of the binding site in the c-myc gene (CGCGTACAGAAAGGGAAAGGACTAG) and so that they only differed in the 12-bp recognition sequence. All of the clones for competition listed in Fig. 2A had the following flanking sequences: upper strand-CGCGTACAG-(12 nucleotides of the binding sequence)-CTAG and lower strand-GCTAG-(12 nucleotides of the binding sequence)-CTGTA. Following annealing of the two oligonucleotides, each annealed product was run on a 20% acrylamide gel to check the concentration of the annealed products. Each binding reaction contained 0.025 pmol labeled c-myc gene oligonucleotides and 7.5 µg of nuclear protein from P3X nuclear extracts in the presence of increasing molar fold excess (3.125x, 6.25x, 12.5x, and 25x) of the cold oligonucleotides. All binding reactions with P3X contained the binding buffer described above (2). The gels were dried and quantified using a phosphor imager (ImageQuant; Amersham Pharmacia Biotech, Piscataway, NJ).



View larger version (68K):
[in this window]
[in a new window]
 
FIGURE 2. Consensus binding sequence for Blimp-1. A, Fifty-one selected clones were sequenced, and 18 different sequences were obtained; two sequences that did not align are not shown. The sequences were aligned, and similar sequences are enclosed by the box. The frequency in which each oligonucleotide sequence was obtained is indicated at the right. Clone 1 was isolated with the highest frequency. The affinity of the sites, as determined by cold competition EMSA, shown in Fig. 3A, is indicated as high (H), medium (M), or low (L) affinity sites, respectively. B, The consensus of the 16 aligned sequences was calculated by the number of times a particular nucleotide appears in each column of the 12-bp alignment. In determining the consensus, the frequency with which each sequence was isolated was taken into account. When one base occurred 90% or more, alternate bases are not listed in the consensus. The consensus appears at the bottom of each column. C, Using only the sequences that were high and medium affinity Blimp-1 sites (A), the number of times each nucleotide is represented at each position was recalculated, resulting in an 11-bp consensus. The frequency that each oligonucleotide was represented was not considered; the derived consensus appears at the bottom of each column.

 
Competitive EMSA with Blimp-1 and IRF binding sites was performed, as described above. The oligonucleotides used were: PRDI (AAGGGAGAAGTGAAAGTGGGAAATT), Pax-5 (TCGGAGAGCGATTCACTTTCCAAAA), CIITA (CAGTCCACAGTAAGGAAGTGAAATTAATTT), Spi-B (GCTCCCCTACTTTCCCTGCCTCCCCCA), Id3 (CTGCTTAGACCTCCCTTTCCCTCCTTCTTCTGCAATCTCA), IRF-1 site inducible NO synthase (iNOS) (GTCAATATTTCACTTTCATAATGG), IRF-2 site histone H4 (GGCGCGCTTTCGGTTTTCAATCGGT), IRF-4 site Ig {lambda} (GATAAAAGGAAGTGAAACCAAG), IRF-8 site MHCI (GGTCCTCAGTTTCACTTCTGCA), and nonspecific (CCTTGCCACATGACCTGCTT).

Determination of equilibrium dissociation constants

Kd were determined using EMSA. Various labeled oligonucleotide concentrations (5 x 10–1 to 2 x 10–8 M) were mixed with a fixed amount of rBlimp-1, IRF-1, IRF-2, or IRF-4/PU.1 (protein concentration was determined arbitrarily for each protein to achieve saturation of binding) in a 20 µl vol using the binding buffer: 100 mM Tris (pH 7.4), 500 mM NaCl, 10 mM EDTA, and 50% glycerol. Blimp-1-binding reactions were incubated on ice for 30 min, and the IRF-binding reactions at room temperature for 20 min. The shifted bands were quantified by phosphor imager. The ratio of bound DNA/free DNA against bound DNA was plotted, and the Kd were determined from the equation, Kd = –1/slope. IRF-1 and IRF-2 plasmids were generously provided by D. Thanos (Columbia University), PU.1 plasmid by K. Ozato (National Institutes of Health, Bethesda, MD), and IRF-4 from A. Pernis (Columbia University).

ChIP

ChIP were conducted, as described previously (24, 25). A total of 20 µg of chromatin from HeLa cells was used for each immunoprecipitation using 5 µg of IRF-1 (Santa Cruz Biotechnology, Santa Cruz, CA; sc-13041), IRF-2 (Santa Cruz Biotechnology; sc-498), and 20 µl of rabbit antiserum to the C-terminal region (aa 740–856) of Blimp-1. HeLa cells were infected with Sendai virus (SPAFAS) for 2 h in serum-free medium and then replaced with serum-containing medium for another 4 or 22 h. DNA was resuspended in 100 µl, and input samples represent 1% of total DNA. Input samples were diluted 1/4, and immunoprecipitation fractions were diluted 1/2. PCR conditions were specific to each primer set, but the general conditions were as follows: 94°C (3 min), 94°C (30 s), 55°C (CSF-1), or 65°C (IFN-{beta}) (30 s), 72°C (30 s), 72°C (10 min) for 30–35 cycles. All PCR were amplified in 50 µl reactions, and the products were ran on 1.5% agarose gels, transferred to nylon membranes, and hybridized with 32P-labeled internal oligonucleotides. The primer sets used were: IFN-{beta} (5'-GCTTTCCTTTGCTTTCTCCCAAGTC-3' and 5'-CCTTTCTCCATGGGTATGGCC-3') and CSF-1 (5'-CTCTTCCTCCTGATAGCTCCATGA-3' and 5'-CACTATGTTAGCCAGGATGGTCTC-3'). Internal oligonucleotide for hybridization was IFN-{beta} (5'-TTCCCACTTTCACTTCTCCC-3').

Immunoprecipitation and immunoblot analysis

Whole cell extracts were prepared from HeLa cells infected with Sendai virus for 0, 6, and 24 h, as described above. A total of 60 µg of cell extracts was separated on SDS-PAGE, transferred onto membranes, and incubated with anti-IRF-1 (1/500; Santa Cruz Biotechnology) or IRF-2 (1/500; Santa Cruz Biotechnology). Blimp-1 was immunoprecipitated using a rabbit polyclonal Ab (1/100) from 1000 µg of cell extracts for 1 h at room temperature. A total of 20 µl of protein A-Sepharose beads was added and incubated for another 30 min at room temperature. Precipitates were washed four times and eluted by boiling the beads in SDS sample buffer.

Transfection and luciferase assay

Transient transfections of NIH/3T3 cells and luciferase assay were performed, as previously described (26). Plasmids used for transfections were: IRF-1, Blimp-1, and p{beta}Lux (gifts from K. Ozato (National Institutes of Health), M. Davis (Stanford University, Stanford, CA), and B. Sherry (North Carolina State University, Raleigh, NC), respectively).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Determination of a consensus Blimp-1 binding sequence

A consensus binding site would facilitate identification of Blimp-1 target genes and help understand whether DNA recognition by Blimp-1 and IRF proteins may overlap. Therefore, full-length rBlimp-1 protein was used in a binding selection protocol to recover Blimp-1 binding sites from a pool of random oligonucleotides. Bacterially expressed Blimp-1 was purified using the IMPACT T7 system (see Materials and Methods). In an EMSA using an oligonucleotide probe containing the c-myc binding site, this protein showed a single complex with DNA (Fig. 1, lane 6). The binding specificity of the recombinant protein (Fig. 1, lanes 6–10) was similar to that of endogenous Blimp-1 (Fig. 1, lanes 1–5) (8). rBlimp-1 was allowed to bind a pool of 50-bp oligonucleotides containing 20 bp of random sequences flanked by known sequences, containing restriction sites for both amplification and cloning. The bound oligonucleotides were selected using a preparative EMSA, and selected oligonucleotides were amplified by PCR. Bound oligonucleotides were enriched by three rounds of binding and amplification. Following amplification of the third round, the selected oligonucleotides were cloned and sequenced.



View larger version (60K):
[in this window]
[in a new window]
 
FIGURE 1. Recombinant and endogenous Blimp-1 bind to the same DNA sequence. Endogenous (lanes 1–5) or recombinant (lanes 6–10) Blimp-1 was incubated with 32P-labeled oligonucleotides containing the Blimp-1 binding site in the c-myc gene, in the presence of specific (c-myc) or nonspecific (N.S.) unlabeled competitor oligonucleotides. A single DNA-protein complex was seen using both types of Blimp-1. In the presence of 3.125x and 25x molar fold excess of the specific competitor, the rBlimp-1 complex was ablated similarly to the endogenous Blimp-1 complex (lanes 7 and 8 vs lanes 2 and 3, respectively). Neither Blimp-1 complex was affected by nonspecific competitor (lanes 4 and 5, endogenous Blimp-1 vs lanes 9 and 10, rBlimp-1). N is a nonspecific complex.

 
The sequences of 51 cloned oligonucleotides were determined and aligned (Fig. 2A). Among the 51 clones, there were 18 different sequences, including two sequences that did not align with the other oligonucleotides (data not shown). One sequence, represented by clone 1, was obtained most often. The frequency of each sequence was considered in determining the consensus sequence. The two nonaligned sequences were not included. The alignment of 16 different sequences revealed a 12-bp consensus binding site for Blimp-1 (Fig. 2B). This is similar to a 10-bp consensus sequence obtained using a recombinant fusion protein containing GST and the Blimp-1 zinc finger domain in a similar selection (data not shown). The high conservation of GAAAG at positions 6–10 emphasizes the importance of these five nucleotides for recognition by Blimp-1. The variability of the residues in positions 1–4 suggests that more flexibility is allowed in this region for Blimp-1 binding.

The affinity of Blimp-1 binding to selected oligonucleotides was determined in an EMSA using endogenous Blimp-1 from nuclear extracts of plasmacytoma P3X, a probe containing the c-myc site and different oligonucleotides as cold competitors. Unlabeled oligonucleotide competitors were added in increasing molar excess (Fig. 3). The relative affinity of Blimp-1 for each oligonucleotide was calculated from the ratio of the oligonucleotide required to compete half of the bound complex relative to the c-myc oligonucleotide required to compete half of the complex, X50/c-myc50. Thus, ratios under 1 are sequences for which Blimp-1 has a higher affinity than for the c-myc sequence; ratios greater than 1 are sequences for which Blimp-1 has a lower affinity than for the c-myc sequence. High affinity binding sites were defined as sequences having a X50/c-myc50 ratio lower than 1.5, medium affinity as a ratio between 1.5 and 2, and low affinity as a ratio above 2. Nine sequences were high affinity binding sites, two were medium, and five were low affinity sites (Fig. 2A). However, the oligonucleotide selected with the highest frequency (clone 1) was not bound with higher affinity than the other high affinity sites. Sequences containing the GAAAG motif were better competitors than ones that did not. All the lower affinity binding sites lacked the GAAAG motif. This further confirms the importance of the GAAAG motif. There can be variability in the 5' portion, but certain nucleotides are favored, such as AG at positions 2 and 3.



View larger version (59K):
[in this window]
[in a new window]
 
FIGURE 3. Affinity of selected oligonucleotide sequences determined by binding competition. A, All 16 oligonucleotides were tested for their ability to compete for Blimp-1 binding in cold competition EMSA. Endogenous Blimp-1 bound to a 32P-labeled oligonucleotide representing the Blimp-1 site in the c-myc gene was challenged with 3.125x, 6.25x, 12.5x, and 25x molar excess of each oligonucleotide. Self competition with the c-myc sequence and the nonspecific sequence, C2, is also shown. The affinity of each site was determined by calculating the ratio of the concentration of competitor oligonucleotide required to block 50% of Blimp-1 binding over the concentration of c-myc sequence required to block 50% of Blimp-1 binding (X50/c-myc50). Values greater than 1 represent lower affinity binding sites compared with the c-myc gene, and values <1 represent a higher affinity binding site compared with the c-myc gene. We defined high affinity sites as sites with X50/c-myc50 below 1.5, medium affinity sites as ratios between 1.5 and 2, and low affinity sites as ratios above 2. Among the 16 sequences, 9 are high, 2 are medium, and 5 are low affinity sites. The indicated high and medium affinity sites were used to redetermine the consensus for Blimp-1 (Fig. 2C). B, The data for representative clones are plotted as the ratio of the c-myc gene retarded against the molar fold excess of the competitor. Illustrated are the representative curves for self competition: high (clones 1, 2, and 15), medium (clone 13), and low affinity (clone 10) sites.

 
A consensus binding sequence was reformulated, using only high and medium affinity sequences. Also, because clone 1 sequence was not the highest affinity site, we suspected that its high representation might be due to a cloning artifact, and therefore, we did not take frequency into account. Using this approach, the consensus was found to be an 11-bp sequence (Fig. 2C), which is very similar to the previously determined consensus (Fig. 2B), except for the difference in the first position. Therefore, we are confident (A/C)AG(T/C)GAAAG(T/C)(G/T) represents a good consensus binding sequence for Blimp-1. A comparison of this consensus to known Blimp-1 sites is shown in Fig. 4. We note that the PRDI site in the IFN-{beta} promoter fits the consensus sequence perfectly.

Comparison of Blimp-1 and IRF binding sites

Structural studies on the DNA binding domains of IRF-1 and IRF-2 indicate their recognition sequences to be GAAA and AANNGAAA (in which N can be any nucleotide), respectively (27, 28). Oligonucleotide selections for IRF-1 and IRF-2 have determined their consensus sequence to be (G/C)(A)AAA(N)2–3AAA(G/C)(T/C) (29). The secondary structure of the DNA binding domain of other IRF family members is similar to that of IRF-1 and IRF-2, suggesting that all the family members recognize similar DNA sequences (30). The IRFs bind to a core sequence GAAANT/C, as monomers, dimers, or multimers (10). IRF-1, IRF-2, and IRF-8 bind either GAAAGT/C or GAAACT/C, while IRF-7 prefers GAAAGT/C, and IRF-3 and IRF-4 prefer GAAACT/C. Because the Blimp-1 consensus binding site (Figs. 2C and 4) closely resembles that subset of IRF binding sites containing GAAAGT/C, the possibility that Blimp-1 and IRF proteins could bind similar targets was explored.

Cold oligonucleotide competitions in an EMSA were used to examine the ability of Blimp-1 to bind known IRF sites. Representative IRF binding sites were selected, choosing sites bound by IRFs that are known to play a role in hemopoietic cells. Binding sites in target genes regulated by IRF-1 (iNOS) (31), IRF-2 (histone H4) (32), IRF-4/PU.1 (Ig-{lambda}) (14), and IRF-8 (MHCI) (33) were selected. Their sequences are listed in Fig. 4. We note that the IRF-1 and IRF-2 sites chosen contain the GAAAGT/C motif, while the IRF-8 site chosen does not.

The relative binding affinity of Blimp-1 for these sites was determined in an EMSA using nuclear extract from P3X cells and the c-myc probe in the presence of cold competitors (Fig. 5A). The X50/c-myc50 ratio for the IRF sites was calculated and is shown in Fig. 5B. As discussed earlier, ratios under 1 indicate sequences for which Blimp-1 has a higher affinity than for the c-myc sequence; ratios greater than 1 indicate sequences for which Blimp-1 has a lower affinity than for the c-myc sequence.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 5. Affinity of Blimp-1 binding to IRF sites determined by competition binding. A, Oligonucleotides representing functional IRF-1, IRF-2, IRF-4/PU.1, and IRF-8 binding sites were used as cold competitors to challenge the Blimp-1/c-myc gene complex. Illustrated is a plot of the ratio of Blimp-1/c-myc complex vs the molar fold excess of each competitor, as described for Fig. 3A. B, The relative affinities of the sites were also determined as a ratio of X50/c-myc50, indicated on the right. For the Blimp-1 target sites tested, there are IRF sites with similar or better affinities, specifically IRF-1 (1.53 ± 0.03) and IRF-2 (0.99 ± 0.12) sites. However, the IRF-4 and IRF-8 sites tested are low affinity sites.

 
Blimp-1 binds IRF-1 and IRF-2 sites in the IFN-{beta} and histone H4 genes with affinity similar to that for the c-myc site (Fig. 5B). However, Blimp-1 binds to the IRF-1 site in the iNOS gene, with a lower affinity (ratio of 1.53 ± 0.03). Blimp-1 binds with much lower affinity to the IRF-4/PU.1 site in Ig-{lambda} and the IRF-8 site in a MHCI gene, ratios of 6.8 and 6.5, respectively. This is probably due to that fact that the GAAAG motif is not present in either site.

The affinity of Blimp-1 for its previously identified sites in target genes for Blimp-1 and IRF proteins was also studied using this approach (sequences in Fig. 4). Blimp-1 binds its sites in the Pax-5 and Spi-B genes with similar relative affinity as that for the IRF-1 site in iNOS (X50/c-myc50 = 1.77 ± 0.17 and 1.37 ± 0.16 vs 1.53 ± 0.03). The Spi-B gene site has the closest match to the consensus, containing the GAAAG motif and the two nucleotides, A and G, in positions 2 and 3 that were consistently seen in the high affinity sites selected by Blimp-1 binding (Fig. 2A). Both the Pax-5 and the iNOS sites lack the A and G in positions 2 and 3 and had lower affinities. The Blimp-1 sites identified in Id3 and CIITA are bound with lower relative affinity compared with IRF-1 and IRF-2 sites. The CIITA site does not contain the GAAAG motif, consistent with low binding affinity. The Id3 site contains this motif, but still has a relatively low binding affinity, showing that other parts of the binding site can also affect affinity. However, in the sites that do not contain the GAAAG motif, GAAAT (in the CIITA, for example) is a higher affinity binding site than GAAAC in Ig-{lambda} and MHCI (2.47 ± 0.15 vs 6.8 and 6.5, respectively). Thus, Blimp-1 binds a subset of IRF sites, particularly those identified as IRF-1 or IRF-2 sites, with affinity comparable to or greater than its affinity for known Blimp-1 sites.

Similar dissociation constant shared between Blimp-1 and IRFs

Equilibrium dissociation constants (Kd) for Blimp-1 and various IRF proteins binding to representative sites were determined using EMSA (Fig. 6B). 32P-labeled oligonucleotides (5 x 10–11 to 2 x 10–8 M) were incubated with a constant amount of rBlimp-1, IRF-1, IRF-2, or IRF-4/PU.1 (14). DNA bound to protein was separated from the free probe by electrophoresis, and the amount of free and bound DNA was quantified to generate a binding isotherm. A Scatchard plot was used to calculate the Kd as –1/slope (Fig. 6A). The Kd of Blimp-1 binding to the c-myc site was found to be 1.93 ± 0.35 nM. Kd for IRF-1 and IRF-2 binding to the c-myc site were found to be 2.09 ± 0.64 nM and ~3.0 nM, respectively, comparable to the affinity of Blimp-1 (Fig. 6B). No stable complex was observed with IRF-4/PU.1 binding to the c-myc site, consistent with data in Fig. 5.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 6. Determination of Kd for Blimp-1 and IRF proteins binding to previously identified Blimp-1 and IRF sites. A, Measurement of the affinity of rBlimp-1 binding to its site on the c-myc gene. EMSA was performed with an increasing molar amount of the c-myc gene in the presence of constant amount of rBlimp-1. The smaller graph represents the amount of 32P-labeled c-myc gene bound by Blimp-1 against unbound (free) labeled c-myc gene. As illustrated, the reactions have reached saturation for Blimp-1 binding. The larger graph is a Scatchard plot of the ratio of bound c-myc gene over free c-myc gene against bound c-myc gene. The equilibrium dissociation constant, Kd, for Blimp-1 binding to the c-myc gene is determined by Kd = –1/slope. B, Equilibrium dissociation constants for Blimp-1 and IRF at Blimp-1 (c-myc gene), IRF-1/IRF-2/Blimp-1 (IFN-{beta}), and IRF-4 (Ig-{lambda}) sites. For protein-site combinations that were repeated three or more times, SDs are included. For combinations that were only repeated twice, averages of two values are given: IRF-2/c-myc (2.4 and 3.6 nM) and IRF-2/IFN-{beta} (1.36 and 2.27 nM).

 
The Kd for Blimp-1 and IRF proteins at IRF sites were also determined (Fig. 6B). At the IFN-{beta} site, IRF-1 and IRF-2 bind with a Kd of 1.53 ± 0.61 nM and ~1.82 nM, respectively, which are both very similar to the affinity of Blimp-1 at this site, 1.74 ± 0.28 nM. Blimp-1 bound the IRF-4/PU.1 site in the Ig-{lambda} gene poorly, and a Kd could not be determined; however, IRF-4/PU.1 bound the site with a Kd of 2.87 ± 0.87 nM, which is similar to a previously determined Kd for its binding to this site (34). Thus, the equilibrium dissociation constants confirm that Blimp-1, IRF-1, and IRF-2, but not IRF-4/PU.1, bind with similar affinity to a subset of functionally important sites.

Blimp-1 binds IRF-1/2 sites in vivo and competes functionally with IRF-1

To explore the functional consequences of our in vitro binding studies, we asked whether Blimp-1 binds in vivo to sites predicted by our Kd determinations and whether Blimp-1 can compete functionally with IRF-1. As a model to study potential binding competition among IRF-1, IRF-2, and Blimp-1 in vivo, we chose virus-induced transcription of the IFN-{beta} gene, which has received extensive studies. IRF-1, IRF-2, and Blimp-1 bind in vitro to the PRDI site of the IFN-{beta} promoter (1, 35), and IRF-1 and IRF-2 have been shown to bind the IFN-{beta} promoter in vivo following virus infection (24, 36, 37, 38, 39, 40, 41, 42, 43). Although the roles of IRF-1, IRF-2, and Blimp-1 in the regulation of the IFN-{beta} gene have not been clearly established, IFN-{beta} is the only gene in which all three proteins are known to bind in vitro and in which IRF1 and IRF-2 are known to bind in vivo, providing a good setting for our experiment.

We determined whether Blimp-1, like IRF-1 and IRF-2, also binds the IFN-{beta} promoter in vivo (Fig. 7) by using ChIP. HeLa cells were treated with Sendai virus to induce IFN-{beta} transcription. In this system, IRF-1 is induced rapidly, binding peaks at 6 h, and decreases to become undetectable by 24 h (41). IRF-2 is constitutively expressed and is induced by IRF-1 following virus infection (44, 45). IRF-2 is more stable than IRF-1 (12) and remains elevated 24 h postinfection. Blimp-1 is also induced 6 h postinfection (1). The induction of these proteins was confirmed in our cells by immunoblots (Fig. 7A). IRF-1, IRF-2, and Blimp-1 were immunoprecipitated from HeLa cell chromatin at 0, 6, and 24 h postinfection. Primers were designed to amplify the region of the IFN-{beta} promoter spanning PRDIII-I and, as a negative control, a region of CSF-1, an unrelated gene not regulated by any of the proteins. IRF-1 showed significantly increased binding, and IRF-2 showed modestly increased binding to the IFN-{beta} promoter at 6 h, as previously reported (24, 36, 41). At 24 h, IRF-1 binding was not detected, and IRF-2 was low and variable in different experiments. There was a relatively low amount of Blimp-1 bound before virus treatment, which increased at 6 h and remained elevated at 24 h. Thus, Blimp-1 does bind in vivo to the IFN-{beta} promoter in the PRDIII-I region, and the amount of binding in vivo increases at 6 h postinfection in accordance with the increase in Blimp-1 protein. Interestingly, Blimp-1 remained bound to a greater extent at 24 h postinfection, although the total protein levels decreased.



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 7. Blimp-1, IRF-1, and IRF-2 bind the IFN-{beta} promoter in vivo. A, Whole cell extracts of HeLa cells were harvested 0, 6, and 24 h postinfection with Sendai virus. A total of 500 µg of whole cell extracts was electrophoresed in 8% SDS-PAGE and Western blotted with Abs to IRF-1, IRF-2, and actin. A total of 1000 µg of whole cell extracts was immunoprecipitated with Blimp-1 Ab and then separated, as described above. B, ChIP assay from HeLa cells using Abs to IRF-1, IRF-2, and Blimp-1 at 0, 6, and 24 h postinfection with Sendai virus. The region encompassing the PRDIII-I site was amplified by PCR (2-fold dilutions), and input DNA were also amplified (4-fold dilutions) as a control for equivalence of the starting material. Amplification of an unrelated gene, CSF-1, was used as a negative control. The data shown are representative of three experiments. C, NIH/3T3 cells were transiently transfected with the IFN-{beta} reporter construct p{beta}Lux alone, with IRF-1 plasmid and increasing amount of Blimp-1 plasmid. Luciferase activity was measured 24 h posttransfection. Each bar shows the mean of three wells. The data shown are representative of three experiments.

 
Cotransfections using a reporter dependent on the IFN-{beta} promoter were performed to assess the functional consequences of Blimp-1 binding. Regulation of the endogenous IFN-{beta} gene is complex and involves many factors (36, 41); however, studies have shown that IRF-1 binding alone is capable of inducing a reporter dependent on the IFN-{beta} promoter (46). Thus, we examined the effects of Blimp-1 on IRF-1-dependent activation of the IFN-{beta} promoter. Cotransfection of an IRF-1 expression plasmid caused an ~14x induction of transcription. When the amount of IRF-1 expression plasmid was kept constant and increasing amounts of Blimp-1 expression plasmid were included, greater than 75% of the IRF-1-dependent activation was lost, and this repression was dependent on the amount of Blimp-1 expression plasmid added. Thus, in this assay, Blimp-1 can compete effectively with IRF-1 on the IFN-{beta} promoter. Taken together, these data provide evidence that Blimp-1 binds in vivo to sites in which IRF proteins, including IRF-1 and IRF-2, bind, and that Blimp-1 can compete functionally with IRF-1.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of the Blimp-1 consensus binding sequence

A nonbiased selection was used to identify a consensus binding sequence for full-length Blimp-1. The same protocol selected a nearly identical consensus for a truncated protein containing the Blimp-1 zinc finger domains fused to GST, consistent with the understanding that the zinc finger domains confer sequence-specific DNA recognition (47). In both determinations, the GAAAG motif was invariant, emphasizing its importance for Blimp-1 binding to DNA. The consensus matches closely with known Blimp-1 binding sites on previously identified target genes (Fig. 4). However, a functionally important Blimp-1 binding site in one well-established target gene, CIITA (Fig. 5), is a relatively low affinity site that does not contain a perfect GAAAG motif. Thus, low affinity sites that do not completely match the consensus can mediate Blimp-1 repression in vivo. This consensus binding site will be helpful for future studies to identify genes that are direct targets of Blimp-1 by identifying potential binding sites. Indeed, we used this consensus to identify Blimp-1 binding sites in the Spi-B and Id3 genes, which were found by microarray studies to be repressed in response to Blimp-1 (7).

The Blimp-1 binding consensus is closely related to the binding consensus for IRF proteins. Indeed, the Blimp-1 consensus is identical with the PRDI site in the IFN-{beta} promoter, in which Blimp-1 has been shown to bind in vitro (1). IRF-1 and IRF-2 are known to bind this site to induce IFN-{beta} transcription in response to virus infection (35, 48). Our competition studies show that Blimp-1 also binds to other sites originally identified as IRF-1 or IRF-2 sites. However, Blimp-1 cannot bind all IRF sites. Specifically, we have shown that it does not bind to the IRF4/PU.1 or IRF-8 sites tested (Figs. 5B and 6B).

IRF family proteins bind to two variations of the core IRF consensus sequence: GAAAGT/C and GAAACT/C. IRF-1 and IRF-2 can bind either sequence, while IRF-7 prefers GAAAGT/C and IRF-3 prefers GAAACT/C (49, 50, 51). IRF-4 and IRF-8 bind DNA as complexes with other proteins, often ets family proteins (14, 52, 53, 54). IRF-4/PU.1 preferentially binds elements containing GAAACT/C (34, 53). Most, but not all identified IRF-8 sites also contain GAAACT/C (40, 41). We showed that Blimp-1 preferentially binds to sequences containing GAAAGT/C. It binds well to IRF-1 and IRF-2 sites containing GAAAGT/C, but does not bind IRF-4 or IRF-8 sites lacking it. Based on this information, we predict that Blimp-1 will bind to many IRF sites containing GAAAGT/C and may interfere with IRF-1, IRF-2, IRF-7, or IRF-8 at those sites. It is unlikely to interfere with the binding of IRF-3 and IRF-4 or of IRF-1, IRF-2, and IRF-8 on sites lacking GAAAGT/C. However, these predictions, based on in vitro binding constants, cannot take into account the complexity of the nucleus in vivo. Proteins bound at adjacent sites or protein modifications, associations, or sequestration may alter the relative binding affinity of Blimp-1 or IRF proteins in vivo.

Blimp-1, IRF-1, and IRF-2 as competitors

Kd for Blimp-1 and IRF proteins binding to functionally important sites were determined. Interestingly, Blimp-1, IRF-1, and IRF-2 have similar Kd for previously identified Blimp-1 and IRF binding sites containing GAAAG. Thus, in cells in which more than one of these proteins is present, competition for binding sites containing GAAAG is a possibility. It is also likely that small differences in the Kd (Fig. 6B) or in protein concentrations could affect competition for binding in vivo.

ChIP analyses demonstrated binding of endogenous Blimp-1, as well as IRF-1 and IRF-2, to the IFN-{beta} promoter following Sendai virus infection of HeLa cells (Fig. 7). Furthermore, in cotransfection assays, Blimp-1 was able to compete functionally for IRF-1-dependent activation of the IFN-{beta} promoter (Fig. 7C). These results provide evidence that binding competition between IRF-1, IRF-2, and Blimp-1 may be important in vivo, but the role of these three proteins in the regulation of the IFN-{beta} remains to be clarified. In general, protein concentration and Kd are predicted to be important variables in determining site occupation, but other variables may also play a role, including: 1) cofactors or adjacently bound proteins that alter affinity; 2) posttranslational modifications that alter the affinity; or 3) sequestration of particular proteins away from certain genes. One of these factors may explain the persistent binding of Blimp-1 to the IFN-{beta} promoter in vivo 24 h postinfection, despite decreased total protein.

Blimp-1, IRF-1, and IRF-2 (10, 11, 12, 30) may interact in the context of plasmacytic differentiation, in which a role for Blimp-1 is well documented (55, 56). IRF-1 and IRF-2 levels remain constant during B cell development (57), while Blimp-1 is induced during terminal differentiation to plasma cells (2, 6, 7, 8, 58). Thus, delicate regulation of target genes in which all three proteins can bind could be achieved by changes in relative protein concentrations during induction of Blimp-1 and subtle differences in binding affinities for specific sites. Interestingly, although IRF-4 is highly expressed in plasma cells (14, 17, 53), our data suggest that IRF-4 and Blimp-1 do not recognize the same sites, and therefore, are unlikely to compete for regulation of any genes.

The in vitro (Figs. 3, 5, and 6) and in vivo (Fig. 7) data showing that Blimp-1, IRF-1, and IRF-2 can bind the same sites also provide a molecular mechanism to explain a previously confusing observation in mice expressing a truncated form of Blimp-1 in their B cells (59). The truncated protein binds DNA, but cannot repress transcription, and was designed as a binding site competitor of Blimp-1. However, the mice have abnormalities in peripheral B cell development before the stage when Blimp-1 has been detected. Based on the data presented in this work, this developmental block is probably caused by interference with binding of IRF1/2 to genes they regulate in maturing B cells. Consistent with this suggestion, IRF-2–/– mice have defective B lymphopoiesis (19), demonstrating a requirement for IRF-2 in B cell development. IRF-1 and IRF-2 target genes in B cells are not completely defined, but may include c-myc, p21 (60, 61), or c-myb (62).

In summary, our studies have identified IRF-1 and IRF-2 as proteins that can compete with Blimp-1 for binding in vitro, and have provided evidence that these three proteins can bind in vivo and functionally compete in the IFN-{beta} promoter. This gives a basis for future studies to identify other genes in which regulation may be finely tuned by differential occupation of sites recognized by IRF proteins and Blimp-1.


    Acknowledgments
 
We thank D. Thanos, K. Ozato, A. Pernis, and B. Sherry for providing reagents. We also thank Dr. Kate Senger from the Thanos laboratory for advice with expression of recombinant proteins and determination of the equilibrium dissociation constants. We are grateful to the members of the Calame laboratory for helpful discussions.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grants RO1AI43576 (to K.L.C.) and RO1AI07161 (to T.C.K.). Back

2 Address correspondence and reprint requests to Dr. Kathryn L. Calame, Department of Microbiology, Hammer Health Science Center 1202, College of Physicians and Surgeons, Columbia University, 701 West 168th Street, New York, NY 10032. E-mail address: klc1{at}columbia.edu Back

3 Abbreviations used in this paper: Blimp, B lymphocyte-induced maturation protein; ChIP, chromatin immunoprecipitation; iNOS, inducible NO synthase; IRF, IFN regulatory factor; PRD, positive regulatory domain. Back

Received for publication February 3, 2004. Accepted for publication August 19, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Keller, A. D., T. Maniatis. 1991. Identification and characterization of a novel repressor of {beta}-interferon gene expression. Genes Dev. 5:868.[Abstract/Free Full Text]
  2. Turner, C. A., Jr, D. H. Mack, M. M. Davis. 1994. Blimp-1, a novel zinc finger-containing protein that can drive the maturation of B lymphocytes into immunoglobulin-secreting cells. Cell 77:297.[Medline]
  3. Schliephake, D. E., A. Schimpl. 1996. Blimp-1 overcomes the block in IgM secretion in lipopolysaccharide/anti-µ F(ab')2-co-stimulated B lymphocytes. Eur. J. Immunol. 26:268.[Medline]
  4. Piskurich, J. F., K. I. Lin, Y. Lin, Y. Wang, J. P. Ting, K. Calame. 2000. BLIMP-I mediates extinction of major histocompatibility class II transactivator expression in plasma cells. Nat. Immunol. 1:526.[Medline]
  5. Chang, D. H., C. Angelin-Duclos, K. Calame. 2000. BLIMP-1: trigger for differentiation of myeloid lineage. Nat. Immunol. 1:169.[Medline]
  6. Shapiro-Shelef, M., K. I. Lin, L. J. McHeyzer-Williams, J. Liao, M. G. McHeyzer-Williams, K. Calame. 2003. Blimp-1 is required for the formation of immunoglobulin secreting plasma cells and pre-plasma memory B cells. Immunity 19:607.[Medline]
  7. Shaffer, A. L., K. I. Lin, T. C. Kuo, X. Yu, E. M. Hurt, A. Rosenwald, J. M. Giltnane, L. Yang, H. Zhao, K. Calame, L. M. Staudt. 2002. Blimp-1 orchestrates plasma cell differentiation by extinguishing the mature B cell gene expression program. Immunity 17:51.[Medline]
  8. Lin, Y., K. Wong, K. Calame. 1997. Repression of c-myc transcription by Blimp-1, an inducer of terminal B cell differentiation. Science 276:596.[Abstract/Free Full Text]
  9. Lin, K. I., C. Angelin-Duclos, T. C. Kuo, K. Calame. 2002. Blimp-1-dependent repression of Pax-5 is required for differentiation of B cells to immunoglobulin M-secreting plasma cells. Mol. Cell. Biol. 22:4771.[Abstract/Free Full Text]
  10. Nguyen, H., J. Hiscott, P. M. Pitha. 1997. The growing family of interferon regulatory factors. Cytokine Growth Factor Rev. 8:293.[Medline]
  11. Mamane, Y., C. Heylbroeck, P. Genin, M. Algarte, M. J. Servant, C. LePage, C. DeLuca, H. Kwon, R. Lin, J. Hiscott. 1999. Interferon regulatory factors: the next generation. Gene 237:1.[Medline]
  12. Taniguchi, T.. 1997. Transcription factors IRF-1 and IRF-2: linking the immune responses and tumor suppression. J. Cell. Physiol. 173:128.[Medline]
  13. Sato, M., H. Suemori, N. Hata, M. Asagiri, K. Ogasawara, K. Nakao, T. Nakaya, M. Katsuki, S. Noguchi, N. Tanaka, T. Taniguchi. 2000. Distinct and essential roles of transcription factors IRF-3 and IRF-7 in response to viruses for IFN-{alpha}/{beta} gene induction. Immunity 13:539.[Medline]
  14. Eisenbeis, C. F., H. Singh, U. Storb. 1995. Pip, a novel IRF family member, is a lymphoid-specific, PU.1-dependent transcriptional activator. Genes Dev. 9:1377.[Abstract/Free Full Text]
  15. Zhang, L., J. S. Pagano. 1997. IRF-7, a new interferon regulatory factor associated with Epstein-Barr virus latency. Mol. Cell. Biol. 17:5748.[Abstract]
  16. Tamura, T., K. Ozato. 2002. ICSBP/IRF-8: its regulatory roles in the development of myeloid cells. J. Interferon Cytokine Res. 22:145.[Medline]
  17. Mittrucker, H. W., T. Matsuyama, A. Grossman, T. M. Kundig, J. Potter, A. Shahinian, A. Wakeham, B. Patterson, P. S. Ohashi, T. W. Mak. 1997. Requirement for the transcription factor LSIRF/IRF4 for mature B and T lymphocyte function. Science 275:540.[Abstract/Free Full Text]
  18. Tamura, T., T. Nagamura-Inoue, Z. Shmeltzer, T. Kuwata, K. Ozato. 2000. ICSBP directs bipotential myeloid progenitor cells to differentiate into mature macrophages. Immunity 13:155.[Medline]
  19. Matsuyama, T., T. Kimura, M. Kitagawa, K. Pfeffer, T. Kawakami, N. Watanabe, T. M. Kundig, R. Amakawa, K. Kishihara, A. Wakeham, et al 1993. Targeted disruption of IRF-1 or IRF-2 results in abnormal type I IFN gene induction and aberrant lymphocyte development. Cell 75:83.[Medline]
  20. Yamada, G., M. Ogawa, K. Akagi, H. Miyamoto, N. Nakano, S. Itoh, J. Miyazaki, S. Nishikawa, K. Yamamura, T. Taniguchi. 1991. Specific depletion of the B-cell population induced by aberrant expression of human interferon regulatory factor 1 gene in transgenic mice. Proc. Natl. Acad. Sci. USA 88:532.[Abstract/Free Full Text]
  21. Lu, R., P. M. Pitha. 2001. Monocyte differentiation to macrophage requires interferon regulatory factor 7. J. Biol. Chem. 276:45491.[Abstract/Free Full Text]
  22. Barnes, B. J., P. A. Moore, P. M. Pitha. 2001. Virus-specific activation of a novel interferon regulatory factor, IRF-5, results in the induction of distinct interferon {alpha} genes. J. Biol. Chem. 276:23382.[Abstract/Free Full Text]
  23. Perkins, A. S., R. Fishel, N. A. Jenkins, N. G. Copeland. 1991. Evi-1, a murine zinc finger proto-oncogene, encodes a sequence-specific DNA-binding protein. Mol. Cell. Biol. 11:2665.[Abstract/Free Full Text]
  24. Senger, K., M. Merika, T. Agalioti, J. Yie, C. R. Escalante, G. Chen, A. K. Aggarwal, D. Thanos. 2000. Gene repression by coactivator repulsion. Mol. Cell 6:931.[Medline]
  25. Yu, J., C. Angelin-Duclos, J. Greenwood, J. Liao, K. Calame. 2000. Transcriptional repression by blimp-1 (PRDI-BF1) involves recruitment of histone deacetylase. Mol. Cell. Biol. 20:2592.[Abstract/Free Full Text]
  26. Tunyaplin, C., M. A. Shapiro, K. L. Calame. 2000. Characterization of the B lymphocyte-induced maturation protein-1 (Blimp-1) gene, mRNA isoforms and basal promoter. Nucleic Acids Res. 28:4846.[Abstract/Free Full Text]
  27. Escalante, C. R., J. Yie, D. Thanos, A. K. Aggarwal. 1998. Structure of IRF-1 with bound DNA reveals determinants of interferon regulation. Nature 391:103.[Medline]
  28. Fujii, Y., T. Shimizu, M. Kusumoto, Y. Kyogoku, T. Taniguchi, T. Hakoshima. 1999. Crystal structure of an IRF-DNA complex reveals novel DNA recognition and cooperative binding to a tandem repeat of core sequences. EMBO J. 18:5028.[Medline]
  29. Tanaka, N., T. Kawakami, T. Taniguchi. 1993. Recognition DNA sequences of interferon regulatory factor 1 (IRF-1) and IRF-2, regulators of cell growth and the interferon system. Mol. Cell. Biol. 13:4531.[Abstract/Free Full Text]
  30. Taniguchi, T., K. Ogasawara, A. Takaoka, N. Tanaka. 2001. IRF family of transcription factors as regulators of host defense. Annu. Rev. Immunol. 19:623.[Medline]
  31. Kamijo, R., H. Harada, T. Matsuyama, M. Bosland, J. Gerecitano, D. Shapiro, J. Le, S. I. Koh, T. Kimura, S. J. Green, et al 1994. Requirement for transcription factor IRF-1 in NO synthase induction in macrophages. Science 263:1612.[Abstract/Free Full Text]
  32. Vaughan, P. S., F. Aziz, A. J. van Wijnen, S. Wu, H. Harada, T. Taniguchi, K. J. Soprano, J. L. Stein, G. S. Stein. 1995. Activation of a cell-cycle-regulated histone gene by the oncogenic transcription factor IRF-2. Nature 377:362.[Medline]
  33. Driggers, P. H., D. L. Ennist, S. L. Gleason, W. H. Mak, M. S. Marks, B. Z. Levi, J. R. Flanagan, E. Appella, K. Ozato. 1990. An interferon {gamma}-regulated protein that binds the interferon-inducible enhancer element of major histocompatibility complex class I genes. Proc. Natl. Acad. Sci. USA 87:3743.[Abstract/Free Full Text]
  34. Brass, A. L., A. Q. Zhu, H. Singh. 1999. Assembly requirements of PU. 1-Pip (IRF-4) activator complexes: inhibiting function in vivo using fused dimers. EMBO J. 18:977.[Medline]
  35. Harada, H., T. Fujita, M. Miyamoto, Y. Kimura, M. Maruyama, A. Furia, T. Miyata, T. Taniguchi. 1989. Structurally similar but functionally distinct factors, IRF-1 and IRF- 2, bind to the same regulatory elements of IFN and IFN-inducible genes. Cell 58:729.[Medline]
  36. Lomvardas, S., D. Thanos. 2002. Modifying gene expression programs by altering core promoter chromatin architecture. Cell 110:261.[Medline]
  37. Lomvardas, S., D. Thanos. 2001. Nucleosome sliding via TBP DNA binding in vivo. Cell 106:685.[Medline]
  38. Agalioti, T., G. Chen, D. Thanos. 2002. Deciphering the transcriptional histone acetylation code for a human gene. Cell 111:381.[Medline]
  39. Agalioti, T., S. Lomvardas, B. Parekh, J. Yie, T. Maniatis, D. Thanos. 2000. Ordered recruitment of chromatin modifying and general transcription factors to the IFN-{beta} promoter. Cell 103:667.[Medline]
  40. Munshi, N., Y. Yie, M. Merika, K. Senger, S. Lomvardas, T. Agalioti, D. Thanos. 1999. The IFN-{beta} enhancer: a paradigm for understanding activation and repression of inducible gene expression. Cold Spring Harbor Symp. Quant. Biol. 64:149.[Medline]
  41. Munshi, N., T. Agalioti, S. Lomvardas, M. Merika, G. Chen, D. Thanos. 2001. Coordination of a transcriptional switch by HMGI(Y) acetylation. Science 293:1133.[Abstract/Free Full Text]
  42. Parekh, B. S., T. Maniatis. 1999. Virus infection leads to localized hyperacetylation of histones H3 and H4 at the IFN-{beta} promoter. Mol. Cell 3:125.[Medline]
  43. Wathelet, M. G., C. H. Lin, B. S. Parekh, L. V. Ronco, P. M. Howley, T. Maniatis. 1998. Virus infection induces the assembly of coordinately activated transcription factors on the IFN-{beta} enhancer in vivo. Mol. Cell 1:507.[Medline]
  44. Harada, H., E. Takahashi, S. Itoh, K. Harada, T. A. Hori, T. Taniguchi. 1994. Structure and regulation of the human interferon regulatory factor 1 (IRF-1) and IRF-2 genes: implications for a gene network in the interferon system. Mol. Cell. Biol. 14:1500.[Abstract/Free Full Text]
  45. Cha, Y., A. B. Deisseroth. 1994. Human interferon regulatory factor 2 gene: intron-exon organization and functional analysis of 5'-flanking region. J. Biol. Chem. 269:5279.[Abstract/Free Full Text]
  46. Falvo, J. V., B. S. Parekh, C. H. Lin, E. Fraenkel, T. Maniatis. 2000. Assembly of a functional {beta} interferon enhanceosome is dependent on ATF-2-c-jun heterodimer orientation. Mol. Cell. Biol. 20:4814.[Abstract/Free Full Text]
  47. Keller, A. D., T. Maniatis. 1992. Only two of the five zinc fingers of the eukaryotic transcriptional repressor PRDI-BF1 are required for sequence-specific DNA binding. Mol. Cell. Biol. 12:1940.[Abstract/Free Full Text]
  48. Miyamoto, M., T. Fujita, Y. Kimura, M. Maruyama, H. Harada, Y. Sudo, T. Miyata, T. Taniguchi. 1988. Regulated expression of a gene encoding a nuclear factor, IRF-1, that specifically binds to IFN-{beta} gene regulatory elements. Cell 54:903.[Medline]
  49. Gongora, C., G. Degols, L. Espert, T. D. Hua, N. Mechti. 2000. A unique ISRE, in the TATA-less human Isg20 promoter, confers IRF-1-mediated responsiveness to both interferon type I and type II. Nucleic Acids Res. 28:2333.[Abstract/Free Full Text]
  50. Arons, E., V. Kunin, C. Schechter, R. Ehrlich. 2001. Organization and functional analysis of the mouse transporter associated with antigen processing 2 promoter. J. Immunol. 166:3942.[Abstract/Free Full Text]
  51. Morin, P., J. Braganca, M. T. Bandu, R. Lin, J. Hiscott, J. Doly, A. Civas. 2002. Preferential binding sites for interferon regulatory factors 3 and 7 involved in interferon-A gene transcription. J. Mol. Biol. 316:1009.[Medline]
  52. Marecki, S., C. J. Riendeau, M. D. Liang, M. J. Fenton. 2001. PU.1 and multiple IFN regulatory factor proteins synergize to mediate transcriptional activation of the human IL-1{beta} gene. J. Immunol. 166:6829.[Abstract/Free Full Text]
  53. Marecki, S., M. J. Fenton. 2002. The role of IRF-4 in transcriptional regulation. J. Interferon Cytokine Res. 22:121.[Medline]
  54. Marecki, S., M. J. Fenton. 2000. PU.1/Interferon regulatory factor interactions: mechanisms of transcriptional regulation. Cell Biochem. Biophys. 33:127.[Medline]
  55. Calame, K.. 2001. Immunology: end game for B cells. Nature 412:289.[Medline]
  56. Calame, K. L., K. I. Lin, C. Tunyaplin. 2003. Regulatory mechanisms that determine the development and function of plasma cells. Annu. Rev. Immunol. 21:205.[Medline]
  57. Nelson, N., Y. Kanno, C. Hong, C. Contursi, T. Fujita, B. J. Fowlkes, E. O’Connell, J. Hu-Li, W. E. Paul, D. Jankovic, et al 1996. Expression of IFN regulatory factor family proteins in lymphocytes: induction of Stat-1 and IFN consensus sequence binding protein expression by T cell activation. J. Immunol. 156:3711.[Abstract]
  58. Angelin-Duclos, C., G. Cattoretti, K. I. Lin, K. Calame. 2000. Commitment of B lymphocytes to a plasma cell fate is associated with Blimp-1 expression in vivo. J. Immunol. 165:5462.[Abstract/Free Full Text]
  59. Angelin-Duclos, C., K. Johnson, J. Liao, K. I. Lin, K. Calame. 2002. An interfering form of Blimp-1 increases IgM secreting plasma cells and blocks maturation of peripheral B cells. Eur. J. Immunol. 32:3765.[Medline]
  60. Coccia, E. M., N. Del Russo, E. Stellacci, R. Orsatti, E. Benedetti, G. Marziali, J. Hiscott, A. Battistini. 1999. Activation and repression of the 2-5A synthetase and p21 gene promoters by IRF-1 and IRF-2. Oncogene 18:2129.[Medline]
  61. Tanaka, N., M. Ishihara, M. S. Lamphier, H. Nozawa, T. Matsuyama, T. W. Mak, S. Aizawa, T. Tokino, M. Oren, T. Taniguchi. 1996. Cooperation of the tumor suppressors IRF-1 and p53 in response to DNA damage. Nature 382:816.[Medline]
  62. Manzella, L., R. Gualdi, D. Perrotti, N. C. Nicolaides, G. Girlando, M. A. Giuffrida, A. Messina, B. Calabretta. 2000. The interferon regulatory factors 1 and 2 bind to a segment of the human c-myb first intron: possible role in the regulation of c-myb expression. Exp. Cell Res. 256:248.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
Y.-H. Chan, M.-F. Chiang, Y.-C. Tsai, S.-T. Su, M.-H. Chen, M.-S. Hou, and K.-I Lin
Absence of the Transcriptional Repressor Blimp-1 in Hematopoietic Lineages Reveals Its Role in Dendritic Cell Homeostatic Development and Function
J. Immunol., December 1, 2009; 183(11): 7039 - 7046.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Kaku and T. L. Rothstein
Fas Apoptosis Inhibitory Molecule Expression in B Cells Is Regulated through IRF4 in a Feed-Forward Mechanism
J. Immunol., November 1, 2009; 183(9): 5575 - 5581.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. A. Barnes, S. J. Stephenson, R. M. Tooze, and G. M. Doody
Amino Acid Deprivation Links BLIMP-1 to the Immunomodulatory Enzyme Indoleamine 2,3-Dioxygenase
J. Immunol., November 1, 2009; 183(9): 5768 - 5777.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S.-T. Su, H.-Y. Ying, Y.-K. Chiu, F.-R. Lin, M.-Y. Chen, and K.-I Lin
Involvement of Histone Demethylase LSD1 in Blimp-1-Mediated Gene Repression during Plasma Cell Differentiation
Mol. Cell. Biol., March 15, 2009; 29(6): 1421 - 1431.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. A. Lord, D. Savitsky, R. Sitcheran, K. Calame, J. R. Wright, J. P.-Y. Ting, and K. L. Williams
Blimp-1/PRDM1 Mediates Transcriptional Suppression of the NLR Gene NLRP12/Monarch-1
J. Immunol., March 1, 2009; 182(5): 2948 - 2958.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Smith and E. H. Davidson
Gene Networks in Development and Evolution Special Feature Sackler Colloquium: Gene regulatory network subcircuit controlling a dynamic spatial pattern of signaling in the sea urchin embryo
PNAS, December 23, 2008; 105(51): 20089 - 20094.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Wang, N. van Panhuys, J. Hu-Li, S. Kim, G. Le Gros, and B. Min
Blimp-1 Induced by IL-4 Plays a Critical Role in Suppressing IL-2 Production in Activated CD4 T Cells
J. Immunol., October 15, 2008; 181(8): 5249 - 5256.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Cimmino, G. A. Martins, J. Liao, E. Magnusdottir, G. Grunig, R. K. Perez, and K. L. Calame
Blimp-1 Attenuates Th1 Differentiation by Repression of ifng, tbx21, and bcl6 Gene Expression
J. Immunol., August 15, 2008; 181(4): 2338 - 2347.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
K. Kurimoto, Y. Yabuta, Y. Ohinata, M. Shigeta, K. Yamanaka, and M. Saitou
Complex genome-wide transcription dynamics orchestrated by Blimp1 for the specification of the germ cell lineage in mice
Genes & Dev., June 15, 2008; 22(12): 1617 - 1635.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. M. Doody, S. Stephenson, C. McManamy, and R. M. Tooze
PRDM1/BLIMP-1 Modulates IFN-{gamma}-Dependent Control of the MHC Class I Antigen-Processing and Peptide-Loading Pathway
J. Immunol., December 1, 2007; 179(11): 7614 - 7623.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. Magnusdottir, S. Kalachikov, K. Mizukoshi, D. Savitsky, A. Ishida-Yamamoto, A. A. Panteleyev, and K. Calame
Epidermal terminal differentiation depends on B lymphocyte-induced maturation protein-1
PNAS, September 18, 2007; 104(38): 14988 - 14993.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
W. Zhao, E. N. Cha, C. Lee, C. Y. Park, and C. Schindler
Stat2-Dependent Regulation of MHC Class II Expression
J. Immunol., July 1, 2007; 179(1): 463 - 471.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. M. Tooze, S. Stephenson, and G. M. Doody
Repression of IFN-{gamma} Induction of Class II Transactivator: A Role for PRDM1/Blimp-1 in Regulation of Cytokine Signaling
J. Immunol., October 1, 2006; 177(7): 4584 - 4593.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K.-I Lin, Y.-Y. Kao, H.-K. Kuo, W.-B. Yang, A. Chou, H.-H. Lin, A. L. Yu, and C.-H. Wong
Reishi Polysaccharides Induce Immunoglobulin Production through the TLR4/TLR2-mediated Induction of Transcription Factor Blimp-1
J. Biol. Chem., August 25, 2006; 281(34): 24111 - 24123.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. S. Coro, W. L. W. Chang, and N. Baumgarth
Type I IFN Receptor Signals Directly Stimulate Local B Cells Early following Influenza Virus Infection
J. Immunol., April 1, 2006; 176(7): 4343 - 4351.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kuo, T. C.
Right arrow Articles by Calame, K. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kuo, T. C.
Right arrow Articles by Calame, K. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS