|
|
||||||||
1 Promoter1
Department of Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, MI 48109
| Abstract |
|---|
|
|
|---|
1 H chain gene were regulated by IL-4 like that of the endogenous genes. In mice with two or more copies of the H chain locus transgene, both germline transcripts and S recombination took place at levels comparable to those from the endogenous loci. We also prepared a version of the transgene with a 4-bp mutation in a STAT6 binding site in the
1 promoter region. On the average, this mutation reduced germline transcription by 80%, but did not change the amount of S recombination in vitro. Among both the wild-type and mutant transgenes, we found no significant correlation between the amount of germline transcripts and the amount of S recombination. We infer that the physiologic level of germline transcription of the
1 gene is in excess over the amount required for efficient S recombination. | Introduction |
|---|
|
|
|---|
,
, or
is mediated by a DNA deletion between S regions, 2- to 10-kb segments of short and imprecise tandem repeats that lie upstream of each H chain C region (except C
) (1, 2, 3). S recombination depends strictly on the activation-induced cytidine deaminase (4, 5, 6) and is probably initiated by lesions that result from the activity of this enzyme (7, 8, 9). Subsequently, S recombination may use enzymes involved in double-stranded break repair and mismatch repair (9, 10, 11, 12, 13, 14). It is probably relevant to the mechanism of S recombination that H chain S and constant regions are transcribed before S recombination (15, 16).
Many inferences concerning the mechanism of class S recombination have been derived by studies of the endogenous gene: sequencing of recombined S regions, analysis of transcription of the H chain genes, analysis of deletions or replacements in the H chain locus, or analysis of the effect of genetic deficiencies in transacting factors on switching of the H chain genes (1, 2, 3). Ideally, one would like to mutate a recombinant DNA molecule and then test how the mutation changed both germline transcription and S recombination of the molecule. Toward this end, many substrates have been developed for S recombination. Substrate studies have demonstrated the ability of S regions to stimulate recombination, and, like recombination of H chain genes, recombination of the substrates is usually increased by transcription (17, 18, 19, 20, 21). Recombination of substrates is usually better in B cell lines than in non-B cell lines (17, 18, 19, 22, 23). One substrate system has provided the surprising conclusion that part of the isotype specificity of S recombination is mediated by the S regions themselves (23). Regulatory elements in the promoter regions for germline transcripts and 3' of the C
gene are thought to be important in the regulation of S recombination (1, 2, 3). However, due to the size constraints inherent in transfection assays, plasmid-based substrates are not well suited for tests of the function of these regulatory elements.
It seems likely that regulation of S recombination is dependent on the physiological spacing and order of known and unknown regulatory elements in the H chain locus. We also wanted to explore the possibility that cytokine-regulated DNA binding proteins had different roles in germline transcription and S recombination. We have developed a transgenic system for the study of both germline transcription and S recombination that uses the entire H chain constant region locus in a bacterial artificial chromosome (BAC), so that all known regulatory and recombinational elements will be present in their physiologic order and spacing. An advantage of the transgenic BAC is that it allows the efficient and rapid modification of a single gene in the H chain locus using the technology developed by Yang et al. (24). We prepared one set of transgenic mice with a wild-type H chain locus. We prepared a second set of mice in which the H chain locus transgene has a 4-bp mutation that reduces the ability of STAT6 to bind a site at 123 bp relative to the start sites for germline transcripts of the
1 H chain gene. This STAT6 binding site is important for the production of IL-4-induced transcripts from reporter constructs that include the
1 promoter region (25, 26). We report in this study that in the context of a transgene of the entire constant region locus, this mutation reduced the production of germline transcripts by 80%. We also tested how this reduction in germline transcription of a physiologic locus changed S recombination.
| Materials and Methods |
|---|
|
|
|---|
The BAC with the H chain constant region locus from 129 mice (Igha) was a gift from Dr. F. Alt (Harvard University Medical School, Boston, MA). In its 230-kb insert, this BAC includes the JH complex; all of the CH genes and associated, full-length S regions; all known enhancer elements 3' of C
(3, 27); and 11 kb of DNA 5' of JH and 35 kb of DNA 3' of HS4 (not shown). We made two modifications to this BAC, using homologous recombination in Escherichia coli (Fig. 1A) (24). We inserted a VDJH2 gene segment encoding anti-arsonate (ARS) binding activity from the hybridoma R16.7 (28) into JH2. For this modification we cloned into pSV1.RecA (24) a 5.2-kb EcoRI fragment with the VDJ exon, 5'-flanking sequences, and the JH3-JH3-Eµ region as a 3' homology region for the recombination event. For the 5' homology region, we cloned a 1.0-kb BamHI fragment with JH1 and JH2 in front of the VDJ exon. The second modification, a 4-bp insertion (GATC) into the BglII site in I
1, was made so that we could easily differentiate germline transcripts from the transgene from those from the endogenous genes. We placed this 4-bp insertion in a 1.8-kb BamHI fragment, which provided both 5' and 3' homology regions. Three lines of transgenic mice (556, 578, and 580) were established using the BAC with these two modifications. We made a third modification in the BAC, a 4-bp insertion (AATT) into the EcoRI site in I
2a, using a 1.6-kb HindIII fragment for 5' and 3' homology regions. The BAC with three modifications was named ARS/Igh (BAC with the entire H chain constant region locus and an anti-ARS VDJH2 exon) and is found in the lines 507, 551, 7898, and 995.
|
1, the ARS/Igh BAC was modified by introducing a 4-bp mutation in the STAT6 binding site 123 bp 5' of the start sites for
1 germline transcripts (Fig. 1A). For the modification, the mutation was embedded in a 1.8-kb BamHI fragment to provide 5' and 3' homology regions. Founders with this transgene (ARS/Igh with a mutation in the STAT6 binding site at 123 bp of the promoter for
1 germline transcripts (ARS/Igh/G1MSTAT)) were designated by 800 numbers. Preparation of transgenic mice
A cleared lysate of a 50-ml culture of E. coli harboring ARS/Igh was precipitated with isopropanol, and the resulting nucleic acid pellet was washed twice with 70% ethanol. This pellet, which included
40 µg of ARS/Igh DNA, was digested with NotI, and the DNA insert was separated from the vector sequences, proteins, and RNA by fractionation on a 3-ml Sepharose 4B-CL column with 100 mM NaCl, 10 mM Tris (pH 7.5), and 0.1 mM EDTA running buffer (24). The 230-kb insert eluted at
1.8 ml and was adjusted to 70 µM spermine and 30 µM spermidine. This sample was essentially free of vector sequences and was >90% intact (not shown). Dilutions of the fraction including the ARS/Igh insert were injected into fertilized, SJLxC57BL/6 F2 (Ighb) eggs (29). Potential founders were screened by PCR for the transgenic VDJH2 and then by Southern blot for the transgenic HS4. Positive founders and resulting offspring were crossed to C57BL/6 males or females to generate transgenic lines. The results reported in this study include mice backcrossed to C57BL/6 for two or three generations. The copy numbers of the following segments of the transgene were determined by Southern analysis of genomic DNA from tail biopsies: JH34/Eµ, BamHI digest probed with a nick-translated 1.6-kb BamHI/EcoRI fragment; S
3, SstI digest probed with p
3/HBg2.5 (30); S
1, SstI digest probed with p
1/B.Y (31); S
2a, BamHI digest probed with pS
2a-1 (30); S
, SstI digest probed with a 4.5-kb HindIII/EcoRI fragment; and HS4, BamHI digest probed with a 1.4-kb PstI/HindIII fragment.
DNA samples from transgenic mice were tested for the presence of the following 3' enhancer segments by PCR of tail DNA in the presence of [32P]dATP and digestion with restriction enzymes that distinguish the endogenous (C57BL/6 sequence NT_039553) and the transgene (strain 129 sequence AF450245) (32). Below, primers are identified by residue numbers in AF450245. In all cases denaturation was at 95°C for 1 min, annealing for 1 min, and extension at 72°C for 1 min for 30 cycles, followed by a 10-min extension at 72°C. HS3A sequences were amplified using the primers TGAGGTCAGCCAGCATCACCC (19641984) and TTTGATCTTACAGCTTGACTCTAC (complementary to 23002324) with annealing at 66°C. Digestion of the 361-bp product with MboII yielded products of 192 bp (both genes), 169 bp (endogenous), and 108 and 61 bp (transgene). Nuclease activity in the MboII preparation pre-empted quantification of transgene copy number, but we were able to determine the presence or absence of transgenic HS3A. HS3B sequences were amplified with the primers AGTCCAGAGGACTGTCCTCCAT (2399924020) and TGAGGTCAGCCAGCATCACCC (complementary to 2418924209) with annealing at 66°C. Digestion of the 211-bp product with TaqI yielded undigested fragment (endogenous) and fragments of 142 and 69 bp (transgene). HS1,2 sequences were amplified with the primers GCTGCAGGTTCACCCCAACC (1193811957) and GACAAGCAGGGAGGTGACAGGCTG (complementary to 1239212416) with annealing at 68°C. Digestion of the 479-bp fragment with MboI yielded fragments of 281 bp (transgene), 241 and 40 bp (endogenous), and 198 bp (both genes).
Detection of transgenic RNA expression
RNA was derived from 1- or 4-day cultures of splenocytes depleted of erythrocytes and T cells and purified on Lympholyte gradients (Cedar Lane Laboratories, Hornby, Canada) (33). Cultures included 25 µg/ml LPS, 35 ng/ml rIL-4 (BioSource International, Camarillo, CA), or 1 Sf9 cell expressing CD40L (26)/20 lymphocytes. Germline transcripts of the
1 gene were detected by use of an S1 nuclease probe that distinguishes transcripts from the transgene from those from the endogenous gene, because the nuclease cuts probes hybridized to transcripts from the endogenous gene at the 4-bp loop-out that represents the GATC insertion in the transgene (34).
1 germline transcripts were also amplified in the presence of [32P]dATP from cDNA (5', I
1: GACGGCTGCTTTCACAGCTT) and (3', C
1: TCAGAGTGTAGAGGTCAGACTGC). The purified 578-bp product was digested with TaqI, which cuts in products from the endogenous gene once and cuts in products from the transgene twice due to the GATC insertion in I
1. C
1 transcripts were amplified in the presence of [32P]dATP with primers CTGACTCCTAAGGTCACGTGTG (CH2) and GCAGGTCAGACTGACTTTATCC (CH3). The 334-bp purified product was digested with MboI, which cuts once in the transgenic product, but twice in the product of the endogenous gene, due to a polymorphism (34).
Transcripts of rearranged VDJC
1 (transcripts in which the VDJ exon is joined to C
1) transgene were detected by an S1 nuclease probe that includes 18 bp of V region sequence, four N nucleotides, 20 bp of D region sequence, 45 bp of JH2, and 135 bp of C
1. To estimate the relative levels of these VDJC
1 transcripts in the mutant and wild-type transgenes, over a number of independent experiments we divided the amount of full-length, VDJC
1 protection by the amount of C
1 protection that would correspond to germline transcripts of the endogenous gene. The amount of endogenous
1 germline transcription should be a good estimate of the extent of IL-4 induction, and thus would account for different inductions of different preparation of B cells on different days. The amount of C
1 protection is greater in the wild-type RNA samples than in the mutant samples, because the mutant transgenes contribute only a small amount of germline transcripts. Before dividing by the amount of C
1 protection, we subtracted the portion of the C
1 protection that would result from transgene expression, using the values in Fig. 3B.
|
Transgenic IgG1 was detected by coating ELISA plates with monoclonal mouse anti-IgG1a (BD Pharmingen, San Diego, CA) or AD8 mAb (a gift from Dr. E. Selsing, Tufts University School of Medicine, Boston, MA). AD8 binds to any Ab with the 3665 H chain variable region and binds 2.3-fold better if the L chain is derived from an anti-ARS Ab (35). Total IgG1 in tissue culture supernatants was detected by coating ELISA plates with goat anti-mouse IgG1 (Southern Biotechnology Associates, Birmingham, AL). Sera or culture supernatant fluids were tested. All wells were developed with goat anti-mouse IgG1 conjugated to alkaline phosphatase (Southern Biotechnology Associates). Ab concentrations were determined by comparison with a dilution series of R16.7 Ab, which was also a gift from E. Selsing, and expresses the transgenic VH, H chain isotype, and allotype.
| Results |
|---|
|
|
|---|
Lines of transgenic mice were established using a 230-kb fragment of the murine H chain constant region locus, with an anti-ARS VDJH2 exon inserted in its normal location. In this study we have focused on germline transcription and S recombination of the
1 gene, and so all seven of the transgenic lines with a wild-type
1 gene have been analyzed as a group. Beginning with the ARS/Igh BAC, we also produced an H chain locus with a 4-bp change in the STAT6 binding site (Fig. 1A) at 123 bp 5' of the transcription start sites in the promoter for
1 germline transcripts (25, 36, 37). Berton and colleagues (26, 37) made the same change to the STAT6 consensus binding sequence that we made (TTC
GGA) and found that this mutation dramatically reduced STAT6 binding in vitro and IL-4-induced transcription from a reporter construct with the
1 promoter region. We made a fourth change to the first nucleotide in the spacer region (A
T). STAT6 protein does not bind to the mutated sequence (Fig. 1B, compare lane 9 to lane 2). The mutated sequence completes poorly with radiolabeled wild-type sequence for binding to STAT6 (Fig. 1B, lanes 6 and 7). Five lines of transgenic mice were established with the insert from the BAC with the mutated
1 STAT6 binding site (called ARS/Igh/G1MSTAT): 816, 847, 858, 861, and 884 (Fig. 1C).
Transgene copy number was estimated by Southern hybridization for six DNA segments throughout the transgene with probes and restriction enzyme digests that distinguish the a allele transgene from the b allele endogenous genes (for example, Fig. 1D). Identification of transgenic fragments for three enhancer elements 3' of C
was completed by PCR and digestion with a restriction enzyme that distinguished the transgene and endogenous genes (see Materials and Methods). Most of the transgenic lines had similar copy numbers for each for the segments tested, indicating that all transgene copies were intact (Fig. 1C). All transgenic lines analyzed in this study had at least one complete copy of the transgenic constant region locus, with one exception. We used line 859, which lacked S
1 and everything 3' of it as a control that could express transgenic µ, but not
1.
We examined allelic exclusion in some of the transgenic lines by staining splenocytes with monoclonal anti-µa (transgenic) and anti-µb (endogenous) reagents. We observed two patterns of allelic exclusion, which did not correlate well with copy number. In some lines (995 and 507), allelic exclusion was more or less complete; all B220+ splenocytes were positive for transgenic µ surface expression and negative for endogenous µ surface expression. In other lines (551 and 7898), about one-half of the splenic B220+ cells expressed µa, but not µb, and the other one-half expressed µb, but not µa. We did not observe a significant portion of cells that expressed both transgenic and endogenous µ on the cell surface in any transgenic line (data not shown).
Transgenic germline transcripts
B cells from the seven lines of transgenic mice with a wild-type
1 gene were cultured with LPS, LPS and IL-4, Sf9 cells expressing CD40L, and CD40L and IL-4. After 4 days in culture, RNA was prepared and tested for the expression of IL-4-regulated
1 germline transcripts. As determined by S1 nuclease analysis, germline transcripts were expressed from the ARS/Igh transgenes (wild type for
1; lines 507 and 7898 are shown as examples) and were up-regulated like the endogenous genes by IL-4 (38, 39, 40) (Fig. 2). We also examined IL-4-regulated expression of
1 germline transcripts from five transgenic lines with a mutation in the STAT6 site. For S1 nuclease analysis, two examples with a single copy of the mutated transgene are shown. B cells from these mice did not express detectable IL-4-regulated
1 germline transcripts from the transgene (line 861; Fig. 2) or very small amounts of transgenic germline transcripts (line 847; Fig. 2).
|
1 germline transcripts in the wild-type transgene, but potential over- and underdigestion by the nuclease at the 4-bp loop-out pre-empts accurate quantification of small amounts of transgenic transcripts in the ARS/Igh/G1MSTAT B cells. To more accurately quantify these small amounts of transgenic germline transcripts, we amplified all
1 germline transcripts by RT-PCR and distinguished transcripts from the endogenous and transgenes by digestion with the restriction enzyme TaqI (Fig. 3A). The amount of these IL-4-induced transcripts, relative to those from the endogenous locus, was calculated as described in Fig. 3.
1 germline transcripts from the wild-type transgene were 2655% of the total germline transcripts expressed by the transgenic B cells (Fig. 3B). Using this assay, we could detect small amounts of IL-4-induced germline transcripts from the transgene in B cells from four of the ARS/Igh/G1MSTAT (800 series) mice, but not in B cells from line 861 (Fig. 3, A and B). On the average, the mutation in the STAT6 binding site reduced the amount of IL-4-regulated
1 germline transcripts by 80%, from an average relative expression in the wild-type transgenes of 0.39 to an average relative expression of 0.094 in the mutant transgenes.
It is possible that more abundant
1 germline transcripts were expressed from the ARS/Igh/G1MSTAT transgene, but were initiated at sites that would not allow detection with the PCR primers we used for the experiment in Fig. 3A. This is perhaps a reasonable assumption if an inability of STAT6 to bind at 123 bp in the promoter region would also shift binding of RNA polymerase. Hence, we amplified
1 C region transcripts after 1 day of culture with LPS and IL-4. We reasoned that this would detect
1 germline transcripts no matter where they initiated, as long as they were spliced to C
1. This approach would not distinguish germline transcripts from VDJC
1 transcripts, but after only 22 h of culture the latter should be of low abundance. We distinguished endogenous C
1 transcripts from transgenic C
1 transcripts by differential digestion with MboI (Fig. 3C). Even with extended digestion times with additional MboI, we could not completely digest the nontransgenic RT-PCR product (Fig. 3C). However, we obtained no evidence for additional germline transcripts as hypothesized above. RNA from B cells from line 861 revealed no more transgenic 290 bp protection than did RNA from nontransgenic B cells. B cells from line 816 expressed a small amount of C
1 transcripts, and those from lines 847, 884, and 858 expressed more C
1 transcripts, but fewer than B cells from a wild-type line (7898). The results from this analysis of C
1 transcripts after 1 day of culture were quantitatively similar to those of germline
1 transcripts from 4-day cultures (compare Fig. 3, B and C).
S recombination of the transgene in vivo
We next determined the ability of the wild-type and mutant ARS/Igh transgenes to undergo S recombination in vivo (Fig. 4). Before immunization, some mice expressed 1030 µg/ml transgenic IgG1 (
and
). In the absence of overt immunization, transgenic B cells in some mice may be activated by a self or exogenous Ag, undergo S recombination in vivo, and express moderate amounts of transgenic IgG1.
|
and
). Even considering the amounts of transgenic IgG1 in preimmune sera, virtually all the wild-type lines expressed more IgG1 from the transgene after immunization (2 or 3 logs greater than the lower limit of detection, as revealed by analysis of sera from immunized, nontransgenic mice). Line 507 was an exception, in that it expressed almost no transgenic IgG1 during the early primary response.
With immunization, mice with transgenes mutated in the
1 STAT6 site expressed increased amounts of transgenic IgG1 (Fig. 4, right). The substantial variation in quantity of transgenic IgG1 after immunization among wild-type lines and among lines with the STAT6 site mutation pre-empted an accurate quantitative comparison of the two types of transgenes. However, qualitatively,
1 genes with the STAT6 site mutation were able to undergo S recombination.
S recombination of the transgene in tissue culture
The amount of IgG1 expression in vivo is dependent on the efficiency of S recombination, but is also dependent on B cell selection by Ag. Hence, we wanted to test the ability of transgenic B cells to undergo S recombination in tissue culture, where selection by Ag does not occur. We cultured transgenic B cells in various combinations of LPS, CD40L, and IL-4 for 7 days and tested the supernatants for secreted IgG1 with the transgenic allotype (C
1a). Transgenic IgG1a was expressed by transgenic B cells treated with LPS and IL-4 or CD40L and IL-4 in tissue culture (Fig. 5A). This transgenic IgG1 was induced by IL-4; at least 10 times more IgG1 (e.g., lines 7898 and 861) and as much as a 1000 times more IgG1 (e.g., lines 884 and 847), were secreted compared with cells cultured with LPS or CD40L alone. Even though the mutant lines lacked an effective STAT6 binding site at 123, they were induced by IL-4 to express and secrete IgG1.
|
1 STAT6 site mutation has no effect on the ability of the transgene to undergo S recombination and secrete IgG1 protein in tissue culture.
As an additional measure of S recombination, we assayed RNA from cultured primary B cells for the presence of VDJC
1 RNA by S1 nuclease protection (Fig. 6). We used a probe from the transgenic VDJC
1 transcripts, which includes the transgene-specific VDJ junction (schematic at the bottom of Fig. 6A). As expected, transcripts derived from nontransgenic B cells did not protect the full-length probe (Fig. 6A, NTg). Protection of shorter fragments by nontransgenic RNA was observed, which would correspond to endogenous C
1 transcripts that use JH2 (like the transgene, JH2C
1) in their VDJ exon or the somewhat similar JH1 or JH4 (JH1/JH4C
1). In RNA from transgenic B cells, full-length VDJC
1 protection, the result of S recombination from µ to
1 by the transgene, was induced by LPS and IL-4 or CD40L and IL-4 (Fig. 6A). A significant amount of protection of a smaller fragment (C
1, corresponding to C
1 without V, D, or J attached) was also induced by IL-4. This protection is primarily due to germline transcripts from both the endogenous and transgenes. Because B cells with the STAT6 site mutation in the transgenic
1 gene produce fewer germline transcripts (Fig. 3), RNA from B cells with the mutated transgene express less total C
1 protection.
|
1 transcripts. Data from lines 507, 861, 995, and 884 are shown as examples in Fig. 6A. More full-length protection, corresponding to switched VDJC
1 transcripts, was observed using RNA from transgenic B cells cultured with LPS and IL-4 or CD40L and IL-4 than from cells cultured with LPS or CD40L alone Thus, even though IL-4-induced STAT6 binds poorly to the site at 123 bp in the promoter region, S recombination of transgenes mutated in the
1 gene continues to be induced by IL-4.
To compare the quantities of VDJC
1 transcripts between wild-type and mutant transgenes, we tested RNA samples from independent cultures in the same S1 protection experiment. Two sample experiments are shown in Fig. 6B. RNA from line 859 B cells, lacking the transgenic C
1, was used as a control and revealed a small amount of full-length VDJC
1 protection (Fig. 6B). This may indicate a small amount of trans-switching from the transgenic VDJ-Cµ to the endogenous C
1 (28, 41) or a small number of B cells using an endogenous VDJ very similar to the transgenic VDJ. All RNA samples, whether derived from wild-type or mutant transgenic B cells, protected full-length VDJC
1 transcripts. We normalized this VDJC
1 protection from multiple cultures of B cells from the same line of transgenic mice as described in Materials and Methods and plotted the average values compared with transgenic copy number (Fig. 6C). The inferences from this analysis of RNA expression are consistent with those from IgG1 protein expression (Fig. 5B). The amount of normalized VDJC
1 expression increases with copy number. The data do not appear to be exactly linear, because the points for one- and two-copy mice are less than exact linearity through the origin would predict. This nonlinearity may be statistical or true biologic variation. VDJC
1 mRNA expression by B cells with the STAT6 site mutation is virtually the same as that from wild-type B cells, suggesting that the mutation in the
1 STAT6 site has little effect on the ability to S to
1.
In Fig. 7, for each transgenic line, we compared the portion of transgenic
1 germline transcripts (y-axis, values from Fig. 3B) to the relative transgenic VDJC
1 expression (x-axis, values from Fig. 6C). We found no correlation between the amount of germline transcripts and the amount of S recombination as measured by VDJC
1 transcripts.
|
| Discussion |
|---|
|
|
|---|
The ARS/Igh transgene (and its version without the I
2a 4-bp insertion, lines 556, 578, and 580) is able to undergo IL-4-regulated germline transcription and S recombination like that of the endogenous gene (Figs. 2, 5, and 6). Transgenic IgG1 expression in tissue culture is, to a large extent, consistent among all transgenic lines. In lines with two or more copies of the transgene, transgenic IgG1 expression can be induced 40- to 1000-fold over control levels without IL-4 (Fig. 5). Switched VDJC
1 RNA expression is also strongly expressed for most transgenic lines (Fig. 6B). There is a good correlation between transgenic copy number and IgG1 protein expression in tissue culture (Fig. 5B) or VDJC
1 transcript expression (Fig. 6C). Hence, in vitro, the expression of products of switched genes is robust, is related to transgene copy number, and is independent of insertion site. These characteristics along with the simple technology to generate mutations in the H chain locus (24) make quantitative analysis of mutations of the large transgene feasible.
S recombination in vivo is also regulated, to the extent that immunization with a hapten that binds to the transgenic H chain VH induces more transgenic IgG1 expression (Fig. 4). However, the expression of IgG1 in vivo after immunization is not well correlated with transgene copy number (the data for in vivo IgG1 expression in Fig. 4 are presented in order of transgene copy number), even though IgG1 expression in vitro is well correlated. For example, after immunization line 7898 expresses much smaller amounts of transgenic IgG1 than other lines, and line 507 expresses almost no transgenic IgG1 (Fig. 4). We tested the DNA from each of the 12 transgenic lines that we studied for nine different segments across the transgene and did not detect any gross alteration in the transgenes that would explain their unusually high or low expression in vivo. Regulation of transgenic B cells, rather than regulation of S recombination, might explain the variation in IgG1 expression in vivo. First, the amount of transgenic IgG1 expressed will depend on the amount of allelic exclusion by the transgene. Second, anti-self-regulation of transgenic B cells might affect IgG1 expression in vivo. Transgenes with the anti-ARS VH region can be subject to anergy or clonal deletion, apparently due to self-reactivity of anti-ARS Abs in some contexts (42, 43, 44). Induction of tolerance might depend on when and to what extent the transgenic VDJCµ protein is expressed and thus (like allelic exclusion) depend on the insertion site.
Effect of the STAT6 site mutation on
1 expression
Many small mutations in promoter region binding sites for transcription factors have been tested for function in transient transfection assays (1, 2). Using the proximal
1 promoter, IL-4-driven transcription of a reporter gene is dependent on the STAT6 binding site at 123 of the
1 promoter (25, 26). In the context of the ARS/Igh transgene with the entire H chain constant region locus, the STAT6 site mutation has a similar, albeit less dramatic, effect. The
1 STAT6 site mutation results in an incomplete (80%) reduction in the amount of germline transcripts. There is variation in the amount of germline transcripts among both wild-type and mutant transgenes; nevertheless, the amount of germline transcripts in the best expresser with the STAT6 site mutation (line 858) is reduced by 40% compared with the worst expresser with the wild-type gene (line 578).
By tests in vitro, secretion of IgG1 in tissue culture and expression of VDJC
1 mRNA, the mutation in the STAT6 binding site has a small or no effect on S recombination (Figs. 5 and 6). In vivo, mice with the STAT6 site mutation express 5-fold less IgG1 (on the average) after immunization than mice with the wild-type transgene (Fig. 4). For two reasons, this reduction in transgenic IgG1 is difficult to evaluate. First, it is not statistically significant. Five-fold is a modest change in this assay; for six of the lines tested in Fig. 4, we have observed a 5-fold difference in IgG1 expression among three to six mice within the same founder line. Second, this assay shows little dependence on copy number, and some of its variation must be due to the insertion site of the transgene (see above). Hence, the reduction in IgG1 expression after immunization in mice with the STAT6 site mutation might be due to the mutation, but also might be due to the insertion site of some of these transgenes. Putting aside quantitative evaluation of the in vivo data, qualitatively it is entirely consistent with the data from tissue culture experiments. The mice with the STAT6 site mutation in their transgenes undergo immunization-dependent expression of IgG1.
Despite the STAT6 site mutation, the expression of IgG1 protein and H chain mRNA in vitro is dependent on IL-4 (Figs. 5 and 6). There are other STAT6 binding sites and IL-4-induced binding sites in the
1 gene (45, 46), including a consensus STAT6 binding site at 298. In addition to these sites, sites more distant from the
1 promoter region may play a role in IL-4-regulated S recombination. Germline transcription may also use alternative STAT6 binding sites, but it seems to depend on an intact STAT6 binding site at 123 more than does S recombination.
Germline transcription and S recombination
Deletion or replacement of the promoter and the 5-most exon (the I exon) for germline transcription dramatically reduces S recombination (47, 48, 49), correlating germline transcription with S recombination. In endogenous loci where splicing of germline transcripts has been altered, S recombination is also altered (50, 51, 52, 53). These results tend to support a functional role for germline transcripts; if germline transcripts were mere side products, loss of splicing should be irrelevant to S recombination. S regions have the unusual ability to form R loops with their transcripts in vitro (54, 55, 56) and in vivo (57). These R loops do not form in vitro if the S region DNA is inverted (55, 56), and inversion of S regions in the endogenous locus reduces S recombination in vivo, providing strong support for a functional role for S region R loops in S recombination (58).
The results in this study support previous reports that class S recombination is not a direct consequence of germline transcription (49, 51, 52, 59). S recombination by the ARS/Igh transgene in vitro is copy number dependent (Figs. 5 and 6), but the expression of germline transcripts is not (the data on germline transcription in Fig. 3B are presented in order of transgene copy number). This suggests that germline transcription, at least for the ARS/Igh transgenes, is regulated differently than S recombination. Consistent with this inference, the STAT6 site mutation reduces germline transcription more than it reduces S recombination. Also consistent with this inference, for the ARS/Igh transgenes, there is no correlation between the expression of germline transcripts and the expression of switched VDJC
1 transcripts (Fig. 7).
We speculate that one part of this functional discontinuity between germline transcription and S recombination is that the amount of germline transcription of the endogenous
1 gene is in excess of that required for S recombination. B cells from three lines of mice with wild-type transgenes express the physiological amount of germline transcripts, about equal to that from the endogenous loci in the same cells (lines 507, 551, and 995 with one or three copies of the transgene; Fig. 3B). Reduction from this physiologic amount of germline transcripts by 80% in lines 816, 847, 884, and 858 is not accompanied by a reduction (on the average) in S recombination (Figs. 3, 6, and 7). A similar conclusion can be drawn from the expression of transgenic IgG1 in tissue culture (Fig. 5). An additional reduction to
4% of physiologic levels of germline transcription still allows a significant amount of S recombination in line 861. The amount of S recombination in line 861 is consistent with its single copy of the transgene (Figs. 5 and 6). Because 861 represents a single line of mice, subject to unique insertion site regulation or to undetected structural changes in the transgene, results from line 861 may not be applicable to the endogenous gene.
Lee et al. (20) demonstrated a strong correlation between transcription and recombination for a substrate that included S regions, but used regulatory elements from other genes for transcriptional regulation. This result is apparently different than those presented in Fig. 7, but we would like to consider the possibility that at lower levels of germline transcription, there is a quantitative dependence between transcription and S recombination. The substrate in the study by Lee et al. (20) may represent the lowest levels of transcription of the physiologic genes. Alternatively, the use of ectopic regulatory elements might require more abundant germline transcripts for S recombination. It is also possible that germline transcription in excess of that required for S recombination is unique to the
1 gene. The
1 H chain gene expresses more germline transcripts than other murine H chain genes. S recombination to
1 is also not as sensitive as other isotypes to both cis and trans mutations (12, 60, 61, 62, 63, 64). In contrast, we note that recombination of some S substrates with different S regions (S
3 or S
) does not require abundant transcription (22, 23).
One model for the function of germline transcription in S recombination is that it maintains accessibility, because continuous transcription would not allow DNA binding proteins to obscure the S region from the S recombination machinery (3). Our results are not consistent with this model, because the model would predict that more transcription should result in more S recombination. Another model is that R loops formed by the intron of germline transcripts and the S region are the preferred target for the S recombination machinery (2, 3). This model is attractive because it is consistent with the formation of R loops between S region DNA and S region transcripts in vitro and in vivo (54, 55, 56, 57, 58). Furthermore, the R loop model explains how S region DNA becomes single-stranded, the preferred target for activation-induced cytidine deaminase (65, 66, 67). The R loop model would predict that a low level of germline transcription would be sufficient for optimal S recombination. Because the R loops are sufficiently stable that they can be easily isolated in vitro and can be detected on the endogenous locus even after DNA extraction from B cells (56, 57, 58), it would seem that low levels of transcription would maintain the S regions in an R loop.
| Acknowledgments |
|---|
| Footnotes |
|---|
1 This work was supported by grants from the National Cancer Institute (CA39068 (to W.D.) and CA46592 (to the Biomedical Research Core Facilities)) and from the Midwest Affiliate of the American Heart Association (051127Z). ![]()
2 Address correspondence and reprint requests to Dr. Wesley Dunnick, Department of Microbiology and Immunology, University of Michigan Medical School, 1150 West Medical Center Drive, Ann Arbor, MI 48109-0620. E-mail address: wesadunn{at}umich.edu ![]()
3 Abbreviations used in this paper: S, switch; ARS, arsonate; BAC, bacterial artificial chromosome. ![]()
Received for publication January 6, 2004. Accepted for publication July 30, 2004.
| References |
|---|
|
|
|---|
-H2AX focus formation and mutations at sites of class switching. Nature 414:660.[Medline]
3 DNA-specific double strand breaks are induced in mitogen-activated B cells and are implicated in switch recombination. J. Immunol. 159:4139.[Abstract]
1 RNA: analysis of the promoter/enhancer. EMBO J. 11:145.[Medline]
1 and
Ig gene expression in murine B cells: interleukin 4 and the CD40 ligand-CD40 interaction provide distinct but synergistic signals. J. Immunol. 155:5637.[Abstract]
1 switch segments reveals novel structural elements. J. Immunol. 136:2674.[Abstract]
. J. Immunol. 136:949.[Abstract]
1 heavy chain gene includes all the cis-acting elements necessary for expression of properly regulated germline transcripts. J. Immunol. 157:176.[Abstract]
and IL-4 response element present in the germ-line
1 Ig promoter. J. Immunol. 154:4513.[Abstract]
1 switch regions in activated murine B cells by interleukin 4. EMBO J. 8:483.[Medline]
1 immunoglobulin heavy-chain transcripts in resting B cells: induction by interleukin 4 and inhibition by interferon
. Proc. Natl. Acad. Sci. USA 86:2829.
1. Int. Immunol. 10:527.
2b promoter and exon. EMBO J. 12:3529.[Medline]
2b exon from class switching. Int. Immunol. 10:1683.
exon-replacement mice synthesize a spliced HPRT-C
transcript which may explain their ability to switch to IgA: inhibition of switching to IgG in these mice. Int. Immunol. 11:37.
1 transgene. Int. Immunol. 10:1027.
B knockout mice have selective defects in proliferation, differentiation, germ-line CH transcription, and Ig class switching. J. Immunol. 156:183.[Abstract]
This article has been cited by other articles:
![]() |
B. Zhang, A. Alaie-Petrillo, M. Kon, F. Li, and L. A. Eckhardt Transcription of a Productively Rearranged Ig VDJC{alpha} Does Not Require the Presence of HS4 in the Igh 3' Regulatory Region J. Immunol., May 15, 2007; 178(10): 6297 - 6306. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Rush, M. Liu, V. H. Odegard, S. Unniraman, and D. G. Schatz Expression of activation-induced cytidine deaminase is regulated by cell division, providing a mechanistic basis for division-linked class switch recombination PNAS, September 13, 2005; 102(37): 13242 - 13247. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. A. Dunnick, J. Shi, K. A. Graves, and J. T. Collins The 3' end of the heavy chain constant region locus enhances germline transcription and switch recombination of the four {gamma} genes J. Exp. Med., May 2, 2005; 201(9): 1459 - 1466. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Gao, T. Dang, W. A. Dunnick, J. T. Collins, B. R. Blazar, and D. Yuan Receptors and Counterreceptors Involved in NK-B Cell Interactions J. Immunol., April 1, 2005; 174(7): 4113 - 4119. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Zarrin, M. Tian, J. Wang, T. Borjeson, and F. W. Alt Influence of switch region length on immunoglobulin class switch recombination PNAS, February 15, 2005; 102(7): 2466 - 2470. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |