|
|
||||||||



* Center for Marine Biomedicine and Environmental Sciences, and Department of Biochemistry and Molecular Biology, Medical University of South Carolina, Charleston, SC 29407; and
Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The E-proteins bind a series of E-box motifs (named for A. Ephrussi (17)) of consensus sequence CANNTG, which were detected in the intronic enhancer (Eµ) of the Ig H chain (IgH) locus. The µE2 and µE5 motifs are important E-protein binding sites found in the regulatory regions of many immune function genes, including those encoding the Igs (17, 18, 19, 20). Although knockout studies in mice indicate that E2A is an essential factor for lymphocyte development, other E-proteins (e.g., HEB) are able to compensate to a substantial degree for the lack of E2A when expressed in an appropriate context, i.e., as knockin mutants under the control of the E2A promoter (21). Thus, E-protein functions are complex and redundant. They can interact with the following: 1) other E-protein, 2) other classes of HLH protein, and 3) other transcription factors that bind to complex regulatory elements such as the enhancers of Ig H and L chain, and TCR
and
genes (8, 22, 23).
Major shifts have taken place in vertebrate evolution in terms of the transcriptional control of the locus (IgH) that encodes the H chains of the Igs, and these shifts have been shown to involve E-protein-binding sites. Although the transcriptional enhancer (Eµ3') of the IgH locus of the channel catfish, Ictalurus punctatus, shows strong B cell-specific activity when tested in cell lines of both mammals and fish (24), it differs from the mammalian Eµ enhancer in location, structure, and function. The mammalian Eµ enhancer contains multiple motifs, each in single copy, that bind a range of transcription factors including members of the Ets, Oct, E-protein, and basic HLH (bHLH)-Zip families (25, 26, 27, 28). However, the core region of this enhancer has been shown to consist of two Ets factor-binding sites (µA and µB) flanking (in mouse) a µE3 site that binds TFE3 or (in humans) a CBF site that binds core binding factor (28). In contrast, the Eµ3' enhancer of the catfish contains 11 variant and consensus Oct motifs and 4 E-protein-binding µE motifs of variant and consensus sequences (29). The core of this enhancer contains 2 variant (but highly functional) Oct motifs and a single consensus µE5 site (24). The function of the Eµ3' enhancer has been shown to be dependent on the interaction of factors bound to the Oct and µE5 sites (24). Although isoforms of catfish Oct2 have been cloned and their function characterized (30, 31, 32), nothing is known of the nature of catfish E-proteins and the manner in which they might interact with Oct transcription factors. More generally, although it is known from genomic and other studies that bony (teleost) fish, e.g., zebrafish and carp (33, 34), possess homologs of the E-protein-encoding genes, little is known of the expression and, more importantly, the functions of this major family of transcription factors in fish. The identification of TF12/HEB homologs in the catfish, and the results of an investigation of their expression and role in driving transcription of the catfish IgH locus are reported here.
| Materials and Methods |
|---|
|
|
|---|
Total RNA of the catfish B lymphoblastoid cell line 1B10 (35) was extracted using the RNeasy kit (Qiagen, Valencia, CA). Five micrograms of total RNA was reverse-transcribed and used in the construction of a
ZAPII cDNA library (Stratagene, La Jolla, CA) according to the manufacturers instructions.
Conserved bHLH regions of catfish E-proteins were amplified by PCR using the degenerate primers: ATG GCI AAY AAY GCI MGN GA (G-1987) and CKY TCI CKI ACY TGY TGY TC (G-1988). This PCR was conducted with a denaturing step of 95°C for 5 min followed by 20 cycles of 95°C for 30 s, 46°C for 1.5 min, and 72°C for 30 s; 20 cycles of 95°C for 30 s, 48°C for 1.5 min, and 72°C for 30 s; and 5 min at 72°C for the final extension. The amplified DNA fragments (of 180250 bp) were purified following electrophoresis on a 2% agarose gel using NucleoSpin Extraction kits (Clontech, Palo Alto, CA). The purified DNA fragments were sequenced by T7 and M13 reverse primers after cloning (TOPO/TA vector; Invitrogen Life Technologies, San Diego, CA) and shown to contain catfish homologs of the bHLH sequence.
Screening of the cDNA library was performed using as a probe the bHLH fragment pool,
-32P-labeled by PCR. Plaque-purified phages were converted to plasmids before sequencing on both strands using vector- and gene-specific primers.
Determination of full-length cDNA sequences of catfish E-proteins
Total RNA of the 1B10 cell line was isolated using TRIzol (Invitrogen Life Technologies), reverse-transcribed, and used in 5'-RACE (SMART RACE kit; Clontech). The full-length cDNA sequences of catfish E-proteins were obtained by 5'-RACE extension using primers designed from the known sequences.
Sequencing and DNA analysis
DNA sequencing of TF12/HEB homologs was performed by the Biomolecular Resource Laboratory of the Medical University of South Carolina. Sequence analysis for homology, multiple alignment, and secondary structure prediction was performed using the DNAStar (DNAStar, Madison, WI) or GENETIX, Mac version 10.3 (SDC Software Development, Tokyo, Japan), suites of programs.
Phylogenetic analysis
Inferred amino acid sequences of catfish CFEB1 and -2 (accession nos. AY528668 and AY528669), human E12 (AAA52331), human ITF1 (S10099), mouse E2A (AAH18260), mouse E47 (AAK18618), hamster E2A (P98180), rat E2A (P21677), Xenopus E12 (S23391), zebrafish E12 (I50518), human HEB (M80627), mouse ALF1A (C45020), mouse ALF1B (S19958), mouse TF12 (NP_035674), rat TF12 (NP_037308), chicken TF12 (P30985), human TF4 (NP_003190), mouse TF4 (NP_038713), mouse MITF2A (AAC52414), mouse SEF2 (CAA62868), and dog TF4/ ITF2 (P15881), were aligned using the MegaAlign program (DNAStar) with PAM 250 residue weight table, gap penalty of 10, and gap-length penalty of 10. The alignment was used to generate most-parsimonious phylogenetic trees (branch swapping, tree bisection reconnection, 1000 bootstrap replicates) in the PAUP program, version 4.0 beta (36). The Drosophila bHLH protein Da (NP_477189) was used as an outgroup.
Genomic PCR
Catfish genomic DNA was extracted from 2 x 107 cells of the catfish B cell line 1B10 using the DNeasy tissue kit (Qiagen). The sequence spanning the gap region of CFEB was amplified by PCR using the catfish genomic DNA as the template and the following primers: G-2037, 5'-CAGGCTGACACTTTCAGAGG-3'; G-2049, 5'-TAAGCTCCAGAGCTGAAGCC-3'. Amplified fragments were cloned into the pCR4-TOPO TA cloning vector (Clontech), and their sequences were determined.
S1 nuclease protection assay
Total RNA was isolated from the head kidney, trunk kidney, spleen, brain, and muscle of catfish, and from the B lymphoblastoid cell line (1B10) and T cell line (G14D) of catfish using TRIzol (Invitrogen Life Technologies).
A 92-bp oligonucleotide (G-2187) that would detect both CFEB1 and CFEB2 had the following sequence: 5'-GATTCTCAATCTTAAGCTC CAGAGCTGAAGCCACCTGAGATGCCAGGCTACCAGAGAGGCAT TTGAGAGCAAAAGACTGGGAGAGGCATGGT-3'.
A 49-bp oligonucleotide probe for catfish
-actin (G-1034) had the following sequence: 5'-GGGTCACACCATCACCAGAGTCCATCACGATACCAGTGGGCATCAACTC-3'.
The probes were 5' end-labeled with [
-32P]ATP (New England Nuclear, Boston, MA) using polynucleotide T4 kinase (Promega, Madison, WI). Labeled probes (106 cpm; specific activity, 3.55.4 x 106 cpm/pM) were hybridized in the presence of 50 µg of catfish total RNA and 50 µg of yeast total RNA (Ambion, Austin, TX) at 42°C for 16 h. The hybridized RNA/probe mixtures were digested with 75 U of S1 nuclease (Amersham Biosciences, Piscataway, NJ) at 37°C for 30 min. The protected fragments were resolved on a 10% urea-polyacrylamide gel, which was then exposed to a storage phosphor image screen for 24 h, developed in a Typhoon PhosphorImager, and quantified using the ImageQuant program (Amersham Biosciences).
Reporter constructs
The pGL3/
56 plasmid was used as the parent for the construction of the luciferase reporter constructs to test transcriptional activating activity of catfish E-proteins. The pGL3/
56 construct (containing the minimal (
56) c-fos promoter, consisting of TATA-box and transcription-initiation site) was constructed by cloning the
56 promoter region into the HindIII-BglII sites of the pGL3-promoter (Promega) to replace the SV40 promoter. The
56 region was amplified by PCR using the following primers (restriction sites underlined): G-1938, 5'-GGAAGATCTCGTCCATCCATTCACAGCG-3'; G-1939, 5'-GGGAAGCTTAGACACTGGTGGGAGCTGC-3'. The template DNA for the PCR was the p
56.c-fos/CAT plasmid (no. 97-110; Ref. 24).
pGL3/
56/R#2 was constructed by cloning the minimal enhancer, region no. 2 (R#2) of the catfish Eµ3' enhancer, into the KpnI-SacI sites of pGL3/
56. The R#2 fragment was amplified by PCR using the following primers (restriction sites underlined): G-1875, 5'-TTTGGTACCCAAAAAGCAAAAAGCACTCTTTAC-3'; and G-1876, 5'-TTTGAGCTCGCATCTCTGAGATGGAGTGAAAC-3'. The template DNA for the PCR was pFprCAT/ELF11 (no. 96-1; Ref. 37).
pGL3/
56/R#2-
µE5 was constructed by cloning a mutant derivative of R#2, wherein the µE5 site was mutated to a nonfunctional sequence, into the KpnI-SacI sites of pGL3/
56. The R#2-
µE5 DNA fragment was amplified by PCR using G-1875/G-1876 primers and, as template DNA, plasmid p
56/CAT/Oct#10-#11v-
µE5#2 (no. 00-48; Ref. 24).
PCRs were performed for 30 cycles with the following profile: 30 s at 95°C, 30 s at 55°C, and 1 min at 72°C. All constructs were verified by sequencing. Plasmids for transfection were purified using the Nucleobond AX Mega Prep kit (Clontech) and dissolved in dH2O.
Expression vectors
Full-length coding regions of catfish CFEB1 and CFEB2 were directionally cloned (HindIII and XbaI) into the expression vector pRc/CMV (Invitrogen Life Technologies). The sequences to be cloned were PCR amplified using the following primers containing the cloning site (underlined) and a Kozak consensus sequence in the sense primer (italics). The CFEB1/2 sense primer was G-2298, 5'-TTTAAGCTTGGCACCATGAATCCTCAGCAGCGGATCGCCGCTA-3', and the CFEB1/2 antisense primer was G-2299, 5'-TTTTCTAGATCACAAATGGCCCATGGGGTTAGATGTG-3'. PCR was performed for 30 cycles with the following profile: 15 s at 94°C and 5 min at 68°C. Plasmids for transfection were purified using Nucleobond AX Mega Prep kit (Clontech) and dissolved in dH2O.
Cell lines and DNA transfection
The catfish B lymphoblastoid cell line, 1B10 (or 1G8, which is a subline of 1B10 (35)) and T cell line G14D (24) were maintained in AL-5 medium (50% AIM V (Invitrogen Life Technologies) and 50% Leibovitz-L15 medium (Invitrogen Life Technologies) adjusted to catfish isotonicity by dilution, 9/1 (v/v) medium/water). AL-5 was supplemented with heat-inactivated catfish serum to a final concentration of 5%, streptomycin at 100 µg/ml (Cambrex Bio Science, Walkersville, MD), penicillin at 100 U/ml (ICN Biomedicals, Aurora, OH), 50 µM 2-ME (Sigma-Aldrich, St. Louis, MO), and 0.1% sodium bicarbonate (Sigma-Aldrich). 1B10 (or 1G8) and G14D cells were cultured at 27°C in a 5% CO2 atmosphere. The mouse plasmacytoma cell line J558L was maintained in RPMI 1640 medium (Invitrogen Life Technologies) with a final concentration of 5% FCS (Invitrogen Life Technologies), and grown at 37°C in a 5% CO2 atmosphere. All transfections were done using an Electro Cell Manipulator 600 (BTX, San Diego, CA) and 2-mm gap cuvettes (BTX). Cells were harvested during logarithmic growth, washed in serum-free RPMI 1640 (at the appropriate tonicity), and resuspended again in serum-free RPMI 1640 for transfection. Directly before transfection, 180 µl of cells (8 x 106 cells of 1B10 or 1G8, 5 x 106 cells of G14D, or 4 x 106 cells of J558L) were mixed with 20 µl of DNA solution. Equimolar amounts of reporter construct (8 µg), and of empty or E-protein expression constructs (39 µg) were transfected. As a control for transfection efficiency, all transfections included 1.0 µg of the Renilla luciferase construct, pRL/CMV (Promega), expressing Renilla luciferase driven by the CMV promoter. Optimal electroporation conditions were determined as previously described (24). Briefly, 1B10 (or 1G8) cells harvested at a density of 3.54.0 x 106 cells/ml were electroporated at 210 V, 1100 µF, and 48
. G14D cells harvested at a density of 2.63.0 x 106 cells/ml were electroporated at 190 V, 1100 µF, and 48
. J558L cells, harvested at a density of 8 x 105 cells/ml, were electroporated at 130 V, 1100 µF, and 48
.
Luciferase reporter assay
Transfected cells were harvested 3640 h after electroporation, and the luciferase activity was measured using the Dual Luciferase reporter assay system (Promega) and a TD-20/20 luminometer (Turner Designs, Sunnyvale, CA). Normalization for transfection activity was performed using the activity of the Renilla luciferase, and values were calculated as mean ± SD.
Recombinant proteins and antiserum production
To express the recombinant catfish E-proteins for production of antisera, sequences encoding the open reading frames (aa 1705 and 1697 of catfish CFEB1 and CFEB2, respectively) were directionally cloned into the SphI-KpnI site of the expression vector pQE-30 (Qiagen) for the production of antiserum. Recombinant E-proteins (His6-tagged) were expressed in Escherichia coli M15 and induced with 2 mM isopropyl
-D-thiogalactoside (Fisher, Pittsburgh, PA) for 5 h at 37°C. Bacteria were harvested, and lysed in TN buffer (50 mM Tris (pH 8), 0.3 M NaCl) by freeze/thaw three times in a dry ice-ethanol slurry, and the recombinant proteins were prepared using Probond resin (Invitrogen Life Technologies). Rabbits (Cocalico Biologicals, Reamstown, PA) were immunized with the protein corresponding to aa 1705 of CFEB1, and the IgG fraction of the antiserum was prepared by affinity chromatography on protein A (Invitrogen Life Technologies).
For in vitro transcription and translation of epitope-tagged CFEB1 and -2, the full-length coding sequences were cloned into the EcoRI-BglII sites (with S-tag) or NdeI-XhoI sites (without S-tag) of the pCITE-4b(+) vector (Novagen, Cambridge, MA). The DNA fragments to be cloned were PCR-amplified by 30 cycles, with the following profile: 15 s at 94°C and 5 min at 68°C. For the pQE-30 vector, the primers were as follows (restriction sites underlined): G-2339, 5'-TTTGCATGCGGCACCATGAATCCTCAGCAGCGGATCGCCGCTA-3'; and G-2297, 5'-TTTGGTACCTCACAAATGGCCCATGGGGTTAGATGTG-3'. For the pCITE-4b(+) vector with S-tag, the primers were as follows: G-2374, 5'-TGAATTCGATGAATCCTCAGCAGCGGATCGCCGCT-3'; and G-2375, 5'-TTTAGATCTTCACAAATGGCCCATGGGGTTAGATGTG-3'. For the pCITE-4b(+) vector without S-tag, the primers were as follows: G-2591, 5'-AGTAATTCATATGATGAATCCTCAGCAGCGGATCGCCGCT-3'; and G-2592, 5'-TTTCTCGAGCAAATGGCCCATGGGGTTAGATGTGTCT-3'.
EMSA
Two µE5 probes were used for EMSA, in which the core consensus sequence (CAGGTG) was placed either in the context of an arbitrary sequence, or in the context of the native sequence surrounding the µE5 site in the catfish enhancer. The µE5 (underlined) probe in an arbitrary sequence context was created by annealing the following oligonucleotides: forward (G-1603), 5'-CAGACACACCTGCAGCATCTACCAAC-3'; and reverse (G-1604), 5'-CAGTTGGTAGATACTGCAGGTGTGTC-3'.
The corresponding probe with a scrambled µE5-site (underlined) was created by annealing the following oligonucleotides: forward (G-1631), 5'-CAGAACTCGACCACGCATCTACCAAC-3'; and reverse (G-1632), 5'-CAGTTGGTAGATGCGTGGTCGAGTTC-3'.
The probe containing the µE5 consensus sequence (underlined) in the context of the native surrounding sequence was created by annealing the following oligonucleotides: forward (G-2616), 5'-TTCCTGTGCAGGTGTGTTTCA-3'; and reverse (G-2617), 5'-TGAAACACACCTGCACAGGA-3'.
The corresponding probe with a scrambled µE5-site (underlined) was created by annealing the following oligonucleotides: forward (G-2618), 5'- TTCCTGACGTGTGGGTTTTCA-3'; and reverse (G-2619), 5'-TGAAAACCCACACGTCAGGA-3'.
After annealing, the dsDNA was purified by electrophoresis on an 8% nondenatured polyacrylamide gel (Bio-Rad, Hercules, CA) followed by electroelution. The annealed probes were radiolabeled by fill-in with Klenow fragment (Fisher) using [
-32P]dTTP (New England Nuclear) and purified using, sequentially, two Microspin columns: G-50 and G-25 (Amersham Biosciences). In vitro-synthesized CFEB1 and CFEB2 proteins were produced by transcription and translation using the TNT quick coupled transcription/translation systems (Promega). Western blot analysis of the synthesized proteins was performed using the STag Western blot system (Novagen). The EMSA reaction mixtures containing 2-µl aliquot of 5x Gel shift binding buffer (Promega), 1 µl of TNT products, and 5 µg of purified IgG in a total volume of 17 µl were incubated at room temperature for 10 min, and then 1 µl of 32P-labeled probe (105 cpm/µl; specific activity, 5 x 104 cpm/ng), unlabeled competitor, or scrambled competitor (100x the concentration of the labeled probe) were added. After 20-min incubation, DNA-protein complexes were analyzed on a 4% nondenaturing polyacrylamide gel in 0.5x TBE (45 mM Tris-HCl, 45 mM boric acid, 1 mM EDTA). Gels were dried, exposed to a PhosphorImager screen and analyzed using a Typhoon PhosphorImager and the ImageQuant program (Amersham Biosciences).
Assays of CFEB1 and CFEB2 interaction
CFEB1 and CFEB2 proteins were produced by transcription and translation using the TNT quick coupled transcription/translation systems (Promega). Two forms of the proteins were synthesized: 35S-labeled proteins without an S-tag, and nonradioactive proteins with an S-tag. Fifty microliters of the in vitro-synthesized S-tagged CFEB1 or CFEB2 proteins were bound to 25 µl of S-protein agarose resin for 3 h at 4°C in 250 µl of bind/wash buffer (25 mM Tris-HCl (pH 7.5), 100 mM NaCl, 2 mM EDTA, 0.5% Triton X-100, 1 mM PMSF), and then washed twice with 500 µl of the bind/wash buffer. Fifty microliters of 35S-labeled in vitro-synthesized CFEB1 and CFEB2 proteins (without S-tag) were then incubated with the CFEB1 and -2 proteins bound to the resin for 3 h at 4°C in 250 µl of the bind/wash buffer. The samples were then washed four times in 500 µl of the bind/wash buffer, boiled in 2x sample buffer, and analyzed on a 7% SDS-PAGE gel. The gel was dried and exposed to a PhosphorImager screen for 1620 h and analyzed using a Tyhoon PhosphorImager and the ImageQuant program (Amersham Biosciences).
| Results |
|---|
|
|
|---|
A cDNA library (
200,000 recombinant phage) constructed from the cloned catfish B lymphoblastoid cell line (1B10) was screened with a probe for the bHLH domain of catfish E-proteins, prepared as described in Materials and Methods. A total of 149 positive clones were identified, and preliminary analyses (involving partial DNA sequencing and PCR) indicated that the majority (a total of 87) of these clones were catfish homologs of TF12/HEB; these were termed CFEB. Twenty of the CFEB clones were completely sequenced, and although none of the clones was full-length, it was clear that two sequences, termed CFEB1 and CFEB2, were represented. The sequences of CFEB1 and CFEB2 were completed by 5'-RACE and shown to consist of 3678 and 3691 bp, encoding 705 and 697 amino acid residues, respectively (Fig. 1A). The nucleotide sequence of CFEB2 corresponded to that of CFEB1 except for a gap region of 24 bp (encoding eight amino acid residues: SQSFALKC) present in CFEB1 and missing in CFEB2.
|
helix in the region between the putative LH-AD2 and bHLH domains (Fig. 1B). The elucidation of the full-length sequences of CFEB1 and CFEB2 allowed a more precise comparison with other vertebrate E-proteins, thereby facilitating testing of the hypothesis that these sequences were indeed homologs of HEB/TF12. The sequence identities between CFEBs and HEB, mouse TF12 and chicken TF12 were striking, particularly in the bHLH and putative activation domains (Fig. 2A); the bHLH domains of the HEB homologs in catfish, human, mouse, and chicken showed complete identity. A more precise analysis of phylogenetic relationships using parsimony-based methods showed (Fig. 2B) that the E-protein sequences of vertebrates cluster on distinct HEB, E2-2, and E2A branches, with the HEB and E2-2 branches strongly supported by bootstrap values of 100 for the basal nodes. Thus, the assignment of the catfish CFEBs to the TF12/HEB family is appropriate.
|
The major difference between CFEB1 and CFEB2 is the 24-bp sequence that spans bases 17481771 bp in CFEB1 and that is deleted at the 1782/1783-bp junction in CFEB2 (Fig. 3A). To investigate the underlying structure of the CFEB gene in this region, the corresponding genomic DNA sequence was amplified by PCR using primers spanning the gap region. As illustrated in Fig. 3B, the nucleotide sequence of the resulting genomic PCR fragment showed a single intron of 126 bp. However, the 5' region of the intron contained two GT dinucleotides that conform to the GT/AG rule for processing of pre-mRNA splice sites, and whose alternative use would generate the mRNAs encoding CFEB1 and CFEB2 (Fig. 3C).
|
S1 nuclease protection assays were used to identify the expression patterns of CFEB1 and -2 in catfish cell lines and tissues. The results (Fig. 4A) indicated that both isoforms are ubiquitously expressed, being readily detected in catfish B cells, T cells, kidney, spleen, brain, and muscle. In all tissues and cells, the quantity of message for CFEB1 predominated over that for CFEB2 by factors of
23 (Fig. 4). The expression of CFEB was high in lymphoid tissues (spleen, T and B cells) and lowest in muscle (Fig. 4A).
|
To assess the ability of the CFEB isoforms to activate transcription, µE5-dependent reporter constructs, containing a trimer of the consensus µE5 site found in the Eµ3' enhancer (Fig. 5A) were cotransfected into the catfish B cell line (1B10), T cell line (G14D), and mouse B cell line (J558L) with constructs expressing CFEB1 or -2. The results (Fig. 5B) showed that CFEB1 and -2 were able to drive transcription strongly in 1B10 cell lines (
800- and 600-fold increase above control levels, respectively) from a simple construct containing a minimal promoter (TATA box and transcription start site) plus three copies of the µE5 motif. CFEB1 and -2 could also drive transcription in the catfish T cell line, G14D, at a lower level than in 1B10 (a
200-fold increase above control levels) (Fig. 5C). The transcriptional activity of CFEB1 and -2 in a mouse B cell line, J558L, was much weaker than observed in the catfish B and T cells (Fig. 5D). When the ability of the CFEB isoforms to drive transcription from the core of the catfish Eµ3' enhancer (R#2; Fig. 6A) was tested, it was again observed that CFEB1 and CFEB2 were active (increasing transcription by up to 14- and 13-fold, respectively; Fig. 6, B and C). The core of the Eµ3' enhancer contains a single µE5 site, along with two variant octamer motifs. To test whether the activities of CFEB1 and CFEB2 from the core enhancer were µE5 dependent, a R#2-containing construct was prepared in which the µE5 motif had been scrambled (Fig. 6A). These constructs were no longer responsive to CFEB1- and CFEB2-induced enhancement of transcription (Fig. 6C).
|
|
|
The ability of CFEB1 and CFEB2 to drive transcription from µE5-dependent constructs (Figs. 5 and 6) is consistent with, but does not prove, their ability to bind a µE5 site. To test directly their µE5-binding ability, each of the CFEB isoforms was expressed as recombinant proteins by in vitro transcription and translation, and tested for their abilities to bind the µE5 motif by EMSA. Binding to the consensus µE5 sequence (CAGGTG) was tested in the context of two different flanking sequences: an arbitrary sequence (Fig. 8A) or the native flanking sequence found in R#2 (B). The results clearly showed that both CFEB1 and CFEB2 were individually capable of binding the µE5 motif, in both contexts, in a manner that was specifically inhibited by an excess of unlabelled competitor. That the mobility shift was due to the CFEB proteins was confirmed by Ab supershift (Fig. 8, A and B). The significance of the two shifted bands in the case of CFEB2 is not known (Fig. 8A).
|
The EMSA results (Fig. 8) are most readily explained by the assumption that CFEB1 and -2 homodimerize. To test directly the homotypic and heterotypic interactions between CFEB1 and -2, binding was investigated using epitope-tagged proteins. In these experiments, the ability of 35S-labeled in vitro-synthesized CFEB1 and -2 proteins to bind to S-tagged, unlabeled CFEB1 and -2 proteins was assessed by SDS-PAGE and phosphor imaging (Fig. 9). The results showed that CFEB1 was capable of associating with both itself (Fig. 9, lane 5) and with CFEB2 (lanes 7 and 8). Similarly, CFEB2 was capable of associating with itself (Fig. 9, lane 6). The heterotypic interactions were independent of which partner was epitope tagged (Fig. 9, compare lanes 7 and 8). That the interactions were mediated by the CFEB proteins and not the epitope tag was shown by the lack of interaction with the S-tag peptide alone (Fig. 9, lanes 3 and 4).
|
| Discussion |
|---|
|
|
|---|
In terms of overall structure, the catfish TF12/HEB homolog (termed CFEB) was highly conserved in comparison with other vertebrate E-proteins. Inferred activation domains (AD1, LH-AD2) and the DNA-binding and dimerization bHLH domain (38) were readily identified. However, as judged by its representation in a cDNA library, the catfish CFEB is expressed at high levels in a catfish B lymphoblastoid line. This contrasts with the situation in mammals, where products of the E2A gene (as the alternative splice products E12 and E47) dominate over the other two class I E-proteins, HEB and E2-2 (7). The transcriptional control of mammalian E-proteins, rather than differences in their functional properties, is of great importance. For example, although E2A knockout produces major phenotypic effects such as a failure of B cells to develop, the effects of its loss can be compensated by HEB expressed under the control of the E2A promoter (39). This shows that the level and site of expression of HEB, rather than the intrinsic properties of the protein, determine its role in regulating B cell development. In fact, in mammals, the functional outcome of E-protein expression depends upon many factors, including the following: 1) the relative levels of expression of the different activating and inhibitory factors, i.e., E-proteins, other bHLH factors, and the dominant-negative Id proteins (3); 2) the extent of homodimerization vs heterodimerization between these factors; and 3) covalent modifications, such as disulfide bonding and phosphorylation (7, 12, 40).
CFEB genes, in common with their mammalian counterparts, exhibit broad expression. Although isoforms of E2A and E2-2 are known to be generated by alternative RNA processing pathways in mammals (41, 42, 43), the present results are the first example in which such isoforms have been documented in the HEB family. Messages encoding both CFEB1 and -2 isoforms were detectable in all tissues and cells examined, with CFEB1 message always predominating over that for CFEB2, by a factor of between 2 and 3. The significance of the structural differences between the isoforms of CFEB is not known. Both isoforms of CFEB showed equivalent activity, in transient transfection assays, in driving transcription both from the core (R#2) of the physiologically relevant Eµ3' enhancer as well as from an artificial promoter containing a trimer of µE5 motifs. The difference between CFEB1 and CFEB2 is the lack (in CFEB2) of an 8-aa stretch (predicted to form a
helix; see in Fig. 1B) that lies between the LH-AD2 and bHLH domains. The region in which this deletion occurs is known to play a major role in regulating the activity of mammalian E-proteins. It contains two functionally important domains, the repression (Rep) domain modulating transcriptional activation of the E-proteins (44) and an inhibition domain that inhibits homodimerization (45). In this context, the binding interactions of CFEB1 and -2 (Fig. 9) suggest that the structural difference between them does not have a major impact on their properties of homotypic and heterotypic association. In addition, it can be questioned whether or not the CFEB proteins possess a well-conserved Rep domain. The Rep-homologous region in CFEB1 (aa 540569) and in CFEB2 (aa 532561) share only 55% identity with the Rep domain of HEB (44).
HEB family factors are typically found as heterodimers in mammalian cells. For example, in thymocytes, E47/HEB heterodimers are the predominant E-protein configuration (12, 46, 47). In contrast with mammalian HEB, the CFEB isoforms possesses the potential to both homo- and heterodimerize (Fig. 9). The EMSA results (Fig. 8) indicate that both CFEB1 and CFEB2 can bind effectively to the µE5 motif under conditions where heterotypic associations are excluded, and in which homodimerization can reasonably be assumed.
The results of this study show that evolutionary divergence (of structure, expression, and function) has occurred in the vertebrate TF12/HEB family and emphasizes that an understanding of the function of E-proteins in different vertebrate lineages cannot be inferred from our knowledge of the situation in mammals, but requires direct experimental analysis.
| Footnotes |
|---|
1 This work was supported by awards from the National Science Foundation (MCB9807531) and the National Institutes of Health (R01-GM62317 and R01-AI-19530). ![]()
2 This is Publication no. 12 from the Marine Biomedicine and Environmental Sciences Center of Medical University of South Carolina. ![]()
3 Current address: Johnson and Johnson Pharmaceutical Research and Development, LLC, South Raritan, NJ 08869. ![]()
4 Address correspondence and reprint requests to Dr. Gregory W. Warr, Department of Biochemistry and Molecular Biology, Hollings Marine Laboratory, 331 Fort Johnson Road, Charleston, SC 29412. E-mail address: warrgw{at}musc.edu ![]()
5 Abbreviations used in this paper: HLH, helix-loop-helix; bHLH, basic helix-loop-helix; LH, loop-helix; AD, activation domain; Eµ, intronic enhancer; Eµ3', catfish IgH enhancer; R#2, region no. 2; Rep, repression. ![]()
Received for publication March 30, 2004. Accepted for publication August 19, 2004.
| References |
|---|
|
|
|---|
enhancer and characteristics of its DNA-binding proteins. Mol. Cell. Biol. 10:5027.
in the human T-cell receptor
locus. Proc. Natl. Acad. Sci. USA 86:6714.This article has been cited by other articles:
![]() |
J.-i. Hikima, M. L. Lennard, M. R. Wilson, N. W. Miller, L. W. Clem, and G. W. Warr Evolution of vertebrate E protein transcription factors: comparative analysis of the E protein gene family in Takifugu rubripes and humans Physiol Genomics, April 14, 2005; 21(2): 144 - 151. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |