|
|
||||||||
-Defensin-2 Expression Is Regulated by TLR Signaling in Intestinal Epithelial Cells1









* Inflammatory Bowel Disease Center, Division of Gastroenterology, Department of Medicine, Mount Sinai School of Medicine, New York, NY 10029;
Inflammatory Bowel Disease Center, Division of Gastroenterology, Department of Medicine, and
Division of Pediatric Infectious Diseases, Department of Pediatrics, Steven Spielberg Pediatric Research Center, Burns and Allen Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048; and
Department of Bacteriology, Institute of Tropical Medicine, Nagasaki University, Nagasaki, Japan
| Abstract |
|---|
|
|
|---|
-defensin expression by IEC. The effect of LPS and peptidoglycan on
-defensin-2 expression was examined in IEC lines constitutively or transgenically expressing TLRs. Regulation of
-defensin-2 was assessed using promoter-reporter constructs of the human
-defensin-2 gene. LPS and peptidoglycan stimulated
-defensin-2 promoter activation in a TLR4- and TLR2-dependent manner, respectively. A mutation in the NF-
B or AP-1 site within the
-defensin-2 promoter abrogated this response. In addition, inhibition of Jun kinase prevents up-regulation of
-defensin-2 protein expression in response to LPS. IEC respond to pathogen-associated molecular patterns with expression of the antimicrobial peptide
-defensin-2. This mechanism may protect the intestinal epithelium from pathogen invasion and from potential invaders among the commensal flora. | Introduction |
|---|
|
|
|---|
One way in which the intestinal epithelium participates in the innate immune response to pathogens is through the expression of TLRs (6, 7, 8). TLRs recognize specific pathogen-associated molecular patterns (PAMPs) that are associated with a variety of organisms including bacteria, viruses, and fungi (9). The interaction of TLRs with a particular PAMP results in activation of NF-
B and the secretion of inflammatory cytokines such as IL-8 (10, 11, 12). TLR4 and its accessory molecule MD-2 are required for recognition of the LPS found in the outer membrane of Gram-negative bacteria (13). By contrast, TLR2 is required for the recognition of bacterial lipopeptide, and, in combination with TLR6, for the recognition of peptidoglycan (PGN), lipotechoic acid, and soluble tuberculosis factor, which are components of Gram-positive bacteria and mycobacteria (9). We have previously shown that IEC are poorly responsive to Gram-positive and Gram-negative PAMPs, because they express low levels of TLR2, TLR6, TLR4, and its accessory molecule MD-2 (14, 15). In response to cytokine stimulation, expression of TLR4 and MD-2 is increased (10, 16), suggesting that TLR expression is increased in the setting of infections or idiopathic IBD (17).
In addition to pattern recognition receptors, the intestinal epithelium also contributes to the innate immune response through secretion of antimicrobial peptides. Defensins are one class of antimicrobial peptides. Defensins are small, cationic peptides containing sulfide bonds that exert their effect by damaging the bacterial cell membrane (18). These small peptides have broad antimicrobial properties and have recently been shown to have chemokine properties (19). Defensins are classified as either
or
depending on the position of three intramolecular disulfide bonds.
-Defensins, HD5 and HD6, are made by Paneth cells that reside in the crypts of the small intestine (3). They have also been shown to be overexpressed in the inflamed colon in IBD (20, 21, 22, 23).
-Defensins are synthesized by various epithelial cells such as in the skin, respiratory tract, and gastrointestinal tract (24, 25). Whereas expression of human
-defensin-1 may be constitutive,
-defensin-2 is induced by bacterial infection (26, 27).
Recent data demonstrate that human
-defensin-2 is up-regulated in the inflamed mucosa of patients with ulcerative colitis (21, 24, 28). The increase in
-defensin-2 expression correlates with an increase in the related
-defensin-3 but does not correlate with expression of TNF-
, suggesting that other factors are involved in its regulation (28). Our coauthors have demonstrated that Salmonella enteritidis flagellin increases
-defensin-2 promoter activation in IEC (26, 29). Human
-defensin gene expression is increased in tracheobronchial epithelial cells in response to LPS (30) and in lung and skin epithelial cells in response to TLR2 stimulation (31, 32, 33, 34). These studies led us to hypothesize that
-defensin-2 is regulated by TLR4 and TLR2 signaling in human IEC. Our data demonstrate that
-defensin-2 expression is up-regulated in response to PAMPs in a TLR-dependent fashion. The results of our studies support the notion that TLR signaling serves a protective role in the intestinal epithelium by inducing
-defensin-2 and limiting pathogenic infection or preventing commensal organisms from breaching the epithelial barrier.
| Materials and Methods |
|---|
|
|
|---|
IEC lines, Caco-2, T84, and SW480 were obtained from the American Type Culture Collection (Manassas, VA). Subconfluent monolayers of the cell lines were kept in a humidified incubator at 37°C with 5% CO2. T84 were cultured on 12-mm Transwell polycarbonate membranes (no. 3041; Costar, Cambridge, MA) and maintained in DMEM/F12 (Invitrogen Life Technologies, Gaithersburg, MD) with 5% penicillin/streptomycin (Pen/Strep), 5% L-glutamine, supplemented with 5% FBS as previously described (35). T84 cells were used between passages 16 and 35 (35, 36). Caco-2 were maintained in MEM (Invitrogen Life Technologies) supplemented with 10% FBS, 2 mM L-glutamine, 0.1 mM nonessential amino acids, 1 mM sodium pyruvate, and 5% Pen/Strep. SW480 was maintained in Leibowitz L-15 supplemented with 10% FBS, 5% Pen/Strep, and 2 mM L-glutamine. The immortalized human dermal microvessel endothelial cells (HMEC) (a generous gift from Dr. F. Candal, Centers for Disease Control and Prevention, Atlanta, GA (37)) were cultured in MCDB-131 medium supplemented with 10% heat-inactivated FBS, 2 mM glutamine, and 100 µg/ml Pen/Strep in 24-well plates, and used from passages 10 to 14, as described earlier (37, 38, 39). PGN from Staphylococcus aureus was purchased from Fluka (Buchs, Switzerland) and diluted in PBS. Highly purified, phenol-water-extracted Escherichia coli K235 LPS (<0.008% protein) was prepared according to the method of McIntire et al. (40) and obtained from S. N. Vogel (Uniformed Services University of the Health Sciences, Bethesda, MD) (41, 42). The purity of this LPS has been demonstrated previously (40, 43, 44), and this preparation of E. coli LPS is active on TLR4-transfected HEK 293 cells and not on TLR2 transfectants (S. N. Vogel, unpublished observations). Inhibitors of signaling pathways are as follows: BAY 11-7082
NF-
B inhibitor (inhibits I
B phosphorylation) (45, 46) and SP600125
JNK inhibitor (Sigma-Aldrich, St. Louis, MO) (47). SB202474 was used as a nonspecific inhibitor (Calbiochem, San Diego, CA). All inhibitors were used at a final concentration of 0.5 mmol/ml.
Expression vectors and cDNA constructs
Endothelial leukocyte adhesion molecule (ELAM)-NF-
B luciferase and pCMV-
-galactosidase were used as previously described (14). The promoter-luciferase constructs for the human
-defensin-2 gene (pGL3-2110, pGL3-938, pGL3-398, pGL3-229, and pGL3-197), an NF-
B-mutated hBD-2 promoter construct (pGL3-938/mt), or an AP-1-mutated hBD-2 promoter (pGL3-938/AP-1mt) were used as previously described (29, 48, 49). Human TLR2 cDNA and murine TLR6 were a kind gift from R. Medzhitov (Yale University, New Haven, CT). A Flag-tagged human TLR4 construct was obtained from Tularik (San Francisco, CA). MD-2 cDNA construct was kindly provided by K. Miyake (Saga Medical School, Saga, Japan). Plasmids were prepared with an endotoxin-free Plasmid Mega-prep kit (Qiagen, Valencia, CA).
Transient gene expression and reporter gene assays
HMEC, Caco-2, T84, or SW480 cells were plated at a density of 100,000, 150,000, 200,000, or 150,000 cells/well, respectively, in 12-well plates 24 h before transfection. Cells were transfected the following day with FuGENE 6 transfection reagent (Roche, Basel, Switzerland) per the manufacturers instructions and as described earlier (14). Reporter genes pCMV-
-galactosidase (0.5 µg), ELAM-NF-
B-luciferase (0.5 µg), hBD-2 promoter constructs (0.5 µg) and PCDNA3 empty vector (0.51.0 µg), Flag-tagged wild-type human TLR2 (0.5 µg), wild-type murine TLR6 (0.5 µg), Flag-tagged human TLR4 (0.5 µg), or MD-2 (0.5 µg) were cotransfected as indicated in the figures. After overnight transfection, cells were stimulated for 6 h with PGN (10 µg/ml) or LPS (100 ng/ml). Cells were then lysed in 100 µl of reporter lysis buffer, and luciferase activity was measured with a firefly luciferase kit (Promega, Madison, WI) using a Wallac 1450 Microbeta Liquid Scintillation Counter (PerkinElmer, Wellesley, MA). Transfection efficiency was determined by assaying for
-galactosidase activity using a colorimetric method (Stratagene, La Jolla, CA) as previously described (38), and luciferase measurements were normalized for
-galactosidase activity. Data are reported as mean ± SD of three or more independent experiments, and are reported as fold-induction over cells transfected with a control vector.
Immunofluorescence
SW480 cells or Caco-2 cells were removed by trypsinization from a culture dish when confluent. After counting the cell number, cells were seeded onto sterile four-chamber slides (Nalge Nunc International, Rochester, NY) at a density of 10,000 cells/well. Cells were incubated with 500 µl of medium for 24 h at 37°C, and then treated with LPS (100 ng/ml) for 6 or 18 h at 37°C. The cells were then washed and fixed with 100% cold methanol for 5 min at 20°C and then permeabilized with 0.5% Triton X-100 for 5 min at room temperature. Nonspecific sites were blocked with 10% normal rabbit serum, and
-defensin-2 was detected by using a goat polyclonal anti-
-defensin-2 (Santa Cruz Biotechnology, Santa Cruz, CA) at a dilution of 1/400. Subsequently, cells were washed and incubated with FITC-conjugated rabbit anti-goat IgG F(ab') (ICN Biomedicals, Irvine, CA) Ab for 1 h at room temperature. DNA was counterstained with 4',6'-diamidino-2-phenylindole (Molecular Probes, Eugene, OR). After washing with PBS, the cells were mounted in nonfluorescent glycerol in 0.05 M Tris-HCl. Slides were viewed on an Olympus (Melville, NY) BX51 immunofluorescence microscope, and photographs were taken with Magnalite 2.0 software program attached to the microscope.
Real-time PCR analyses
For cell lines, total RNA was isolated using RNA Stat 60 (Tel-Test, Friendswood, TX) according to the manufacturers protocol. Quantitative real-time PCR was conducted for TLR2, TLR4, MD-2,
-defensin-2, and
-actin using TaqMan probes. TLR2 and TLR4 primers and probes were previously published (15, 16). TaqMan probes and primers for
-defensin-2 and
-actin were designed using Beacon Designer 2.06 (Premier Biosoft International, Palo Alto, CA). The
-defensin-2 forward primer was GACTGAGTCTTGCTCTGTCGG, the reverse primer was GGCATGATGGCTTACGCCTATA, and the probe was AGCGACTCCTGTGCCTCAGCCTCC. The
-actin forward primer was CATCCTCACCCTGAAGTACC, the reverse primer was GCTCATTGTAGAAGGTGTGG, and the probe was CACGGCATCGTCACCAACTG. A total of 1 µg of RNA was reverse-transcribed using Superscript III (Invitrogen Life Technologies). The following conditions were used: 50°C for 2 min, 95°C for 2 min, then 50 cycles at 95°C for 15 s, and 60°C for 1 min. Assays were performed following the predeveloped TaqMan assay reagents protocol (Applied Biosystems, Foster City, CA) in an iCycler (Bio-Rad, Hercules, CA). The iCycler Optical System Interface (Bio-Rad) was used to analyze and to quantitate samples.
ELISA
For human IL-8 ELISA, 150,000 SW480 cells were plated per well in 12-well plates. Cells were treated with LPS (100 ng/ml) or PGN (10 µg/ml) for 6 h, and supernatants were harvested for measurement of IL-8. ELISA (R&D Systems, Minneapolis, MN) were performed per the manufacturers instructions.
Statistical analysis
Students t tests and SD were performed using the statistics package within Microsoft (Redmond, WA) Excel. Values of p were considered statistically significant when <0.05.
| Results |
|---|
|
|
|---|
-defensin-2 in IEC
IEC lines recapitulate many features of normal IEC and can be characterized by their ability to respond to PAMPs. We and others have previously shown that T84 and Caco-2 cells are poorly responsive to LPS and PGN due to low expression of the TLR4 and TLR2 complexes (10, 14, 15). By contrast, Suzuki et al. (10) have described LPS responsiveness in SW480 cells, a colon cancer cell line. We hypothesized that PAMPs stimulate the expression of the antimicrobial peptide
-defensin-2 in IEC. To test this hypothesis, we first examined the ability of LPS and PGN to stimulate transcriptional activation of the
-defensin-2 promoter. SW480 cells express TLRs (Fig. 1A), and both LPS and PGN stimulate NF-
B activation (B) and IL-8 secretion (C) in these cells. LPS and PGN stimulated transcriptional activation of the full-length, 2.1-kB
-defensin-2 promoter in SW480 cells but not in T84 or Caco-2 cells (Fig. 2A). Moreover, stimulation of SW480 cells with LPS or PGN resulted in an increase in
-defensin-2 expression by real-time PCR (Fig. 2B) and by immunofluorescent staining (C). These data suggest that LPS and PGN stimulate
-defensin-2 expression in PAMP-responsive IEC.
|
|
-defensin-2 expression is regulated by TLR4 and MD-2 in IEC
The data above demonstrate that LPS stimulates expression of
-defensin-2. To further understand the molecular mechanisms regulating expression of
-defensin-2, we used IEC lines that do not constitutively express TLR4 and MD-2 and asked whether expression of TLR4 or MD-2 was necessary and sufficient to induce
-defensin-2 promoter activation (Fig. 3). Expression of both TLR4 and MD-2 in the presence of LPS is required for
-defensin-2 promoter activation.
|
-defensin-2 promoter contains an NF-
B binding site between 208 and 199 (29). Using deletion mutants of the
-defensin-2 promoter, we found that the 938 nt upstream of the transcription start site were sufficient for directing LPS-dependent
-defensin-2 expression albeit less strongly than the full-length 2.1-kB promoter (Fig. 4). Further truncations of the
-defensin-2 promoter proximal to the NF-
B site at 208 (397, 229) continued to demonstrate LPS inducibility but less than the full-length 2.1-kB promoter (Fig. 4, A and B). A promoter construct with a mutation in the NF-
B site (938 mut) had significantly reduced LPS-dependent
-defensin-2 expression. These data suggest that TLR4 and MD-2 activate
-defensin-2 expression in an NF-
B-dependent fashion. In addition to an important NF-
B element, we asked whether there were additional elements in the hBD-2 promoter directing gene expression in response to TLR4. Our colleagues (49) have recently shown that gangliosides in combination with Salmonella flagellin induce hBD-2 promoter expression. This induction is dependent on an AP-1 binding site at 134 to 140 in the promoter. To test the role of AP-1 in TLR4-mediated hBD-2, we used a combination of approaches. First, we tested the inducibility of an hBD-2 promoter containing a mutation in the AP-1 site. Our data demonstrate that a promoter containing a mutation in the AP-1 site is significantly inhibited in response to LPS (Fig. 5A).
|
|
B inhibitor, BAY11-7082 (0.5 mmol/ml) (45, 46). By real-time PCR,
-defensin-2 expression is reduced in the presence of the JNK inhibitor compared with SW480 cells stimulated with LPS alone or with a nonspecific inhibitor (data not shown). Finally, addition of a selective JNK inhibitor, SP600125 (0.5 mmol/ml), or an NF-
B inhibitor, BAY 11-7082 (0.5 mmol/ml), blocks LPS-induced expression of
-defensin protein in SW480 cells (Fig. 5C). These data, taken together, demonstrate that JNK activation and the AP-1 site within the
-defensin promoter is important for TLR4-mediated gene and protein expression.
PGN-induced
-defensin-2 expression is regulated by TLR2 and TLR6 in IEC
The intestinal flora consists of both Gram-positive and Gram-negative bacteria. We next examined the ability of TLR2 and its coreceptor TLR6 to direct
-defensin-2 expression in IEC. We have previously shown that expression of TLR6 in Caco-2 cells is sufficient for PGN-dependent activation but less than expression of both TLR2 and TLR6 (14). Our data demonstrate that both TLR2 and TLR6 expression are required for PGN-dependent
-defensin-2 expression (Fig. 6). Mutation of the NF-
B site within the promoter (938 mut) impairs PGN-mediated activation (Fig. 7). Further truncations of the
-defensin-2 promoter proximal to the NF-
B site at 208 (397, 229) had significantly impaired PGN inducibility (Fig. 7, A and B). These data suggest that TLR2 and TLR6 are required for PGN stimulation of
-defensin-2 gene expression. In addition to NF-
B, other elements in the 2.1-kB
-defensin-2 promoter may contribute to the full activation by TLR2/TLR6 ligands.
|
|
-defensin-2 expression. A promoter with a mutation in AP-1 is significantly less active in response to PGN than the intact promoter, analogous to what is seen with an NF-
B-mutated promoter (Fig. 8A). Likewise, inhibition of JNK with a specific inhibitor, SP600125 (0.5 mmol/ml), but not with a nonspecific inhibitor, blocks TLR2-dependent activation of both the 938 and 398 promoter fragments (Fig. 8B). These data support a role for the JNK pathway in TLR-dependent expression of antimicrobial peptides.
|
| Discussion |
|---|
|
|
|---|
-defensin-2 is regulated by TLR4- and TLR2-dependent pathways. Before the characterization of TLRs, ONeil et al. (24) demonstrated that IEC up-regulate
-defensin-2 expression in response to IL-1
and invasive enteric bacteria. Although others (30) have shown that LPS induces expression of
-defensin-2 in tracheobronchial epithelial cells, the characterization of the receptor and signaling requirements has not been established. Again in lung (31) or tracheobronchial epithelial cells (32, 34), others have demonstrated that TLR2 mediates
-defensin-2 expression but have not examined the
-defensin-2 promoter in any detail. Moreover, others (20, 28) have described an increase in
-defensin-2 expression in IBD, but the mediators of this expression have not been established. We are the first to show that TLR4 and MD-2 or TLR2 and TLR6 are required for PAMP-mediated expression of
-defensin-2 in IEC. In addition, we show that both NF-
B and AP-1 transactivation are required for the full expression of
-defensin-2 in IEC. We and others (10, 16) have shown that expression of TLRs is increased in response to Th1 cytokines in IBD mucosa and may also be up-regulated by infection with pathogens. Our findings provide a mechanistic explanation for the up-regulation of
-defensin-2 in the setting of increased bacterial signaling. Increased expression of TLRs may result in increased bacterial reactivity resulting in chemokine expression, recruitment of inflammatory cells, and secretion of antimicrobial peptides.
In addition to its well-characterized role as an antibiotic,
-defensin-2 has recently been shown to act as a chemokine (19, 51).
-Defensin-2 can bind to human CCR6, a chemokine receptor preferentially expressed by immature dendritic cells and memory T cells, resulting in chemotaxis and recruitment of adaptive immune cells to an area of microbial invasion. Recent data (52) also demonstrate that murine
-defensin-2 participates in dendritic cell maturation through activation of TLR4. One may therefore postulate that production of
-defensin-2 by IEC may have several effects: direct lysis of microbial pathogens, recruitment of immature dendritic cells and memory T cells, followed by induction of dendritic cell maturation.
Regulation of
-defensin-2 expression in the intestinal epithelium is not fully understood. Using gastric or colonic epithelial cells, Wada and colleagues (29, 48) have shown that Helicobacter pylori or the flagella filament structural protein (FliC) of S. enteritidis, respectively, induce
-defensin-2 promoter activation in an NF-
B-dependent fashion. An NF-
B binding site is present between 208 and 199 in the
-defensin-2 promoter (29). Deletion of the promoter distal to this site (pGL3 197) or mutation of the NF-
B site at 208 to 199 (938mut) results in a loss of H. pylori or FliC inducibility. Studies by Wang et al. (32) in airway epithelial cells have demonstrated that TLR2-mediated activation of the
-defensin-2 promoter requires intact NF-
B sites at 175 and 165 (equivalent to the 208 and 199 NF-
B site described above) relative to the TATA box but not a putative NF-
B site at 564. Similar to these studies, our data demonstrate that mutation of the NF-
B site at 208 to 199 (938mut) results in a loss of TLR-dependent inducibility (Figs. 4 and 6). Our colleagues have recently shown that an AP-1 site within the
-defensin-2 promoter (134 to 140) is required for augmentation of the flagellin response in the presence of gangliosides (49). In this study, we have found that mutations in either the NF-
B site or AP-1 site severely reduce TLR4 and TLR2 induciblity of the promoter. Inhibition of the JNK pathway has a similar effect, suggesting that TLR-mediated activation of JNK is required for expression of
-defensin-2. These findings have implications for some of the novel therapies being explored for IBD using small-molecule inhibitors of MAPKs (53).
Because some studies used whole bacteria or bacterial-derived proteins that may contain additional PAMPs, it is plausible that multiple signaling pathways and multiple TLRs may be activated in these other studies. Our study takes advantage of a reductionist system in which one can dissect the role of individual PAMPs and their respective TLRs in the induction of
-defensin-2 expression. Using this system, we have demonstrated that deletion of the promoter, including the portion between 2.1 kB to 938, loses
50% of its TLR2- or TLR4-dependent inducibility. Although the promoter fragments that retain the NF-
B binding site between 208 and 199 continue to demonstrate some PAMP inducibility (Figs. 4 and 6, pGL3-938, 398, 229), there is a significant reduction compared with the full-length promoter. These data suggest that additional elements in the promoter may be activated by TLR2 and TLR4 signaling in addition to NF-
B and AP-1.
The first gene to be found associated with Crohns disease is CARD15/NOD2 (54, 55). The Crohns disease-associated mutations in CARD15/NOD2 result in decreased responsiveness to bacterial muramyl dipeptide (56, 57). Recent data demonstrate that CARD15/NOD2 is highly expressed by Paneth cells (58) and have antibacterial properties (59). Some have suggested that deficiency in antimicrobial peptide expression may contribute to the pathogenesis of Crohns disease (60). Taken together, these data suggest that defects in the innate immune response to pathogens or commensal bacteria may contribute to the pathogenesis of IBD. The results of our study help to achieve a better understanding of how the intestinal epithelium participates in the innate immune response to commensals and pathogens in the gut.
| Footnotes |
|---|
1 This work was supported by National Institutes of Health Grant AI52266 (to M.T.A.). ![]()
2 Address correspondence and reprint requests to Dr. Maria T. Abreu, Inflammatory Bowel Disease Center, Mount Sinai School of Medicine, 1425 Madison Avenue, 11-23, New York, NY 10029. E-mail address: Maria.Abreu{at}msnyuhealth.org ![]()
3 Abbreviations used in this paper: IEC, intestinal epithelial cell; IBD, inflammatory bowel disease; PAMP, pathogen-associated molecular pattern; PGN, peptidoglycan; Pen/Strep, penicillin/streptomycin; ELAM, endothelial leukocyte adhesion molecule. ![]()
Received for publication March 12, 2004. Accepted for publication August 20, 2004.
| References |
|---|
|
|
|---|
-Interferon augments the intracellular pathway for lipopolysaccharide (LPS) recognition in human intestinal epithelial cells through coordinated up-regulation of LPS uptake and expression of the intracellular Toll-like receptor 4-MD-2 complex. Infect. Immun. 71:3503.
MyD88
IRAK
TRAF
NIK
IKK
NF-
B signal transduction pathway that induces transcription of interleukin-8. Infect. Immun. 69:2270.
-interferon increase production of interleukin-8 in response to lipopolysaccharide through up-regulation of membrane CD14 and MyD88 mRNA expression. Infect. Immun. 70:1272.
-Defensins: linking innate and adaptive immunity through dendritic and T cell CCR6. Science 286:525.
-defensins. Dig. Dis. Sci. 47:1349.[Medline]
-defensins hBD-1 and hBD-2 in intestinal epithelium. J. Immunol. 163:6718.
- and
-defensins mRNA in gastrointestinal epithelia. Eur. J. Clin. Invest. 30:695.[Medline]
-defensin-2 by human colonic epithelial cells induced by Salmonella enteritidis flagella filament structural protein. FEBS Lett. 508:484.[Medline]
-defensin 2 by Fusobacterium nucleatum in oral epithelial cells: multiple signaling pathways and role of commensal bacteria in innate immunity and the epithelial barrier. Infect. Immun. 68:2907.
-defensin 2 but not
-defensin 1 is expressed preferentially in colonic mucosa of inflammatory bowel disease. Eur. J. Gastroenterol. Hepatol. 14:745.[Medline]
-defensin-2 mRNA production by Caco-2 cells. J. Biol. Chem. 276:30521.
-defensin-2 expression in human tracheobronchial epithelium. J. Biol. Chem. 275:29731.
-defensin 2 in response to bacterial lipoprotein. Eur. J. Immunol. 31:3131.[Medline]
-defensin 2 through Toll-like receptor 2. FASEB J. 17:1727.
-defensin-2. J Immunol. 171:6820.
B through interleukin-1 signaling mediators in cultured human dermal endothelial cells and mononuclear phagocytes. J. Biol. Chem. 274:7611.
B through Toll-like receptor 4 (TLR-4) in cultured human dermal endothelial cells: differential expression of TLR-4 and TLR-2 in endothelial cells. J. Biol. Chem. 275:11058.
B and induces apoptosis of HTLV-I-infected T-cell lines and primary adult T-cell leukemia cells. Blood 100:1828.
B inhibitors induce adhesion-dependent colon cancer apoptosis: implications for metastasis. Cancer Res. 62:6870.
-defensin 2 gene requires NF-
B. Cell. Microbiol. 3:115.[Medline]
-defensin-2 expression in Caco-2 cells. J. Biol. Chem. 279:12213.
-defensin 2. Science 298:1025.This article has been cited by other articles:
![]() |
T. E. Burkey, K. A. Skjolaas, and J. E. Minton BOARD-INVITED REVIEW: Porcine mucosal immunity of the gastrointestinal tract J Anim Sci, April 1, 2009; 87(4): 1493 - 1501. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Wu, S. A. McClellan, R. P. Barrett, and L. D. Hazlett {beta}-Defensin-2 Promotes Resistance against Infection with P. aeruginosa J. Immunol., February 1, 2009; 182(3): 1609 - 1616. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Mishra, Q. Zhang, J. L. Rosson, J. Moran, J. M. Dopp, and B. L. Neudeck Lipopolysaccharide Increases Cell Surface P-glycoprotein That Exhibits Diminished Activity in Intestinal Epithelial Cells Drug Metab. Dispos., October 1, 2008; 36(10): 2145 - 2149. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hussain, N. Nasreen, Y. Lai, B. F. Bellew, V. B. Antony, and K. A. Mohammed Innate immune responses in murine pleural mesothelial cells: Toll-like receptor-2 dependent induction of {beta}-defensin-2 by staphylococcal peptidoglycan Am J Physiol Lung Cell Mol Physiol, September 1, 2008; 295(3): L461 - L470. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. O. Canny and B. A. McCormick Bacteria in the Intestine, Helpful Residents or Enemies from Within? Infect. Immun., August 1, 2008; 76(8): 3360 - 3373. [Full Text] [PDF] |
||||
![]() |
A. Abtin, L. Eckhart, M. Mildner, F. Gruber, J.-M. Schroder, and E. Tschachler Flagellin is the principal inducer of the antimicrobial peptide S100A7c (psoriasin) in human epidermal keratinocytes exposed to Escherichia coli FASEB J, July 1, 2008; 22(7): 2168 - 2176. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kumar, L. D. Hazlett, and F.-S. X. Yu Flagellin Suppresses the Inflammatory Response and Enhances Bacterial Clearance in a Murine Model of Pseudomonas aeruginosa Keratitis Infect. Immun., January 1, 2008; 76(1): 89 - 96. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kindrachuk, N. Paur, C. Reiman, E. Scruten, and S. Napper The PhoQ-Activating Potential of Antimicrobial Peptides Contributes to Antimicrobial Efficacy and Is Predictive of the Induction of Bacterial Resistance Antimicrob. Agents Chemother., December 1, 2007; 51(12): 4374 - 4381. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kumar, J. Yin, J. Zhang, and F.-S. X. Yu Modulation of Corneal Epithelial Innate Immune Response to Pseudomonas Infection by Flagellin Pretreatment Invest. Ophthalmol. Vis. Sci., October 1, 2007; 48(10): 4664 - 4670. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Brandl, G. Plitas, B. Schnabl, R. P. DeMatteo, and E. G. Pamer MyD88-mediated signals induce the bactericidal lectin RegIII{gamma} and protect mice against intestinal Listeria monocytogenes infection J. Exp. Med., August 6, 2007; 204(8): 1891 - 1900. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.A. Palladino, T.A. Johnson, R. Gupta, J.L. Chapman, and P. Ojha Members of the Toll-Like Receptor Family of Innate Immunity Pattern-Recognition Receptors Are Abundant in the Male Rat Reproductive Tract Biol Reprod, June 1, 2007; 76(6): 958 - 964. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Palazzo, A. Balsari, A. Rossini, S. Selleri, C. Calcaterra, S. Gariboldi, L. Zanobbio, F. Arnaboldi, Y. F. Shirai, G. Serrao, et al. Activation of Enteroendocrine Cells via TLRs Induces Hormone, Chemokine, and Defensin Secretion J. Immunol., April 1, 2007; 178(7): 4296 - 4303. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. van Dijk, E. J. A. Veldhuizen, S. I. C. Kalkhove, J. L. M. Tjeerdsma-van Bokhoven, R. A. Romijn, and H. P. Haagsman The {beta}-Defensin Gallinacin-6 Is Expressed in the Chicken Digestive Tract and Has Antimicrobial Activity against Food-Borne Pathogens Antimicrob. Agents Chemother., March 1, 2007; 51(3): 912 - 922. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. B. Mitchell, M. H. Al-Haddawi, M. E. Clark, J. D. Beveridge, and J. L. Caswell Effect of Corticosteroids and Neuropeptides on the Expression of Defensins in Bovine Tracheal Epithelial Cells Infect. Immun., March 1, 2007; 75(3): 1325 - 1334. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Menzies and A. Kenoyer Signal Transduction and Nuclear Responses in Staphylococcus aureus- Induced Expression of Human {beta}-Defensin 3 in Skin Keratinocytes Infect. Immun., December 1, 2006; 74(12): 6847 - 6854. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Huang, W. Du, S. A. McClellan, R. P. Barrett, and L. D. Hazlett TLR4 Is Required for Host Resistance in Pseudomonas aeruginosa Keratitis Invest. Ophthalmol. Vis. Sci., November 1, 2006; 47(11): 4910 - 4916. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ouhara, H. Komatsuzawa, H. Shiba, Y. Uchida, T. Kawai, K. Sayama, K. Hashimoto, M. A. Taubman, H. Kurihara, and M. Sugai Actinobacillus actinomycetemcomitans Outer Membrane Protein 100 Triggers Innate Immunity and Production of {beta}-Defensin and the 18-Kilodalton Cationic Antimicrobial Protein through the Fibronectin-Integrin Pathway in Human Gingival Epithelial Cells Infect. Immun., September 1, 2006; 74(9): 5211 - 5220. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Motzkus, S. Schulz-Maronde, A. Heitland, A. Schulz, W.-G. Forssmann, M. Jubner, and E. Maronde The novel {beta}-defensin DEFB123 prevents lipopolysaccharide-mediated effects in vitro and in vivo FASEB J, August 1, 2006; 20(10): 1701 - 1702. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Pioli, L. K. Weaver, T. M. Schaefer, J. A. Wright, C. R. Wira, and P. M. Guyre Lipopolysaccharide-Induced IL-1beta Production by Human Uterine Macrophages Up-Regulates Uterine Epithelial Cell Expression of Human beta-Defensin 2. J. Immunol., June 1, 2006; 176(11): 6647 - 6655. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Mueller, T. Terada, I. M. Rosenberg, O. Shibolet, and D. K. Podolsky Th2 Cytokines Down-Regulate TLR Expression and Function in Human Intestinal Epithelial Cells J. Immunol., May 15, 2006; 176(10): 5805 - 5814. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. K. Boughan, R. H. Argent, M. Body-Malapel, J.-H. Park, K. E. Ewings, A. G. Bowie, S. J. Ong, S. J. Cook, O. E. Sorensen, B. A. Manzo, et al. Nucleotide-binding Oligomerization Domain-1 and Epidermal Growth Factor Receptor: CRITICAL REGULATORS OF beta-DEFENSINS DURING HELICOBACTER PYLORI INFECTION J. Biol. Chem., April 28, 2006; 281(17): 11637 - 11648. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Lievin-Le Moal and A. L. Servin The Front Line of Enteric Host Defense against Unwelcome Intrusion of Harmful Microorganisms: Mucins, Antimicrobial Peptides, and Microbiota Clin. Microbiol. Rev., April 1, 2006; 19(2): 315 - 337. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Elahi, R. M. Buchanan, S. Attah-Poku, H. G. G. Townsend, L. A. Babiuk, and V. Gerdts The Host Defense Peptide Beta-Defensin 1 Confers Protection against Bordetella pertussis in Newborn Piglets Infect. Immun., April 1, 2006; 74(4): 2338 - 2352. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chabot, J. S. Wagner, S. Farrant, and M. R. Neutra TLRs Regulate the Gatekeeping Functions of the Intestinal Follicle-Associated Epithelium J. Immunol., April 1, 2006; 176(7): 4275 - 4283. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Canny, E. Cario, A. Lennartsson, U. Gullberg, C. Brennan, O. Levy, and S. P. Colgan Functional and biochemical characterization of epithelial bactericidal/permeability-increasing protein Am J Physiol Gastrointest Liver Physiol, March 1, 2006; 290(3): G557 - G567. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Rodriguez-Martinez, M E Cancino-Diaz, and J C Cancino-Diaz Expression of CRAMP via PGN-TLR-2 and of {alpha}-defensin-3 via CpG-ODN-TLR-9 in corneal fibroblasts. Br J Ophthalmol, March 1, 2006; 90(3): 378 - 382. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Voss, J. Wehkamp, K. Wehkamp, E. F. Stange, J. M. Schroder, and J. Harder NOD2/CARD15 Mediates Induction of the Antimicrobial Peptide Human Beta-defensin-2 J. Biol. Chem., January 27, 2006; 281(4): 2005 - 2011. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-M. Chen, S. P. O'Hara, J. B. Nelson, P. L. Splinter, A. J. Small, P. S. Tietz, A. H. Limper, and N. F. LaRusso Multiple TLRs Are Expressed in Human Cholangiocytes and Mediate Host Epithelial Defense Responses to Cryptosporidium parvum via Activation of NF-{kappa}B J. Immunol., December 1, 2005; 175(11): 7447 - 7456. [Abstract] [Full Text] [PDF] |
||||
![]() |
E Cario BACTERIAL INTERACTIONS WITH CELLS OF THE INTESTINAL MUCOSA: TOLL-LIKE RECEPTORS AND NOD2 Gut, August 1, 2005; 54(8): 1182 - 1193. [Full Text] [PDF] |
||||
![]() |
M. T. Abreu, M. Fukata, and M. Arditi TLR Signaling in the Gut in Health and Disease J. Immunol., April 15, 2005; 174(8): 4453 - 4460. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |