The JI Acurri Cytometers
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yui, M. A.
Right arrow Articles by Rothenberg, E. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yui, M. A.
Right arrow Articles by Rothenberg, E. V.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
The Journal of Immunology, 2004, 173: 5381-5391.
Copyright © 2004 by The American Association of Immunologists

Deranged Early T Cell Development in Immunodeficient Strains of Nonobese Diabetic Mice1

Mary A. Yui and Ellen V. Rothenberg2

Division of Biology, California Institute of Technology, Pasadena, CA 91125


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
NOD mice exhibit defects in T cell functions that have been postulated to contribute to diabetes susceptibility in this strain. However, early T cell development in NOD mice has been largely unexplored. NOD mice with the scid mutation and Rag1 deficiency were analyzed for pre-T cell development in the NOD genetic background. These strains reveal an age-dependent, programmed breakdown in {beta} selection checkpoint enforcement. At 5–8 wk of age, even in the absence of TCR{beta} expression, CD4+ and CD4+CD8+ blasts appear spontaneously. However, these breakthrough cells fail to restore normal thymic cellularity. The breakthrough phenotype is recessive in hybrid (NODxB6)F1-scid and -Rag1null mice. The breakthrough cells show a mosaic phenotype with respect to components of the {beta} selection program. They mimic normal {beta} selection by up-regulating germline TCR-C{alpha} transcripts, CD2, and Bcl-xL and down-regulating Bcl-2. However, they fail to down-regulate transcription factors HEB-alt and Hes1 and initially express aberrantly high levels of Spi-B, c-kit (CD117), and IL-7R{alpha}. Other genes examined distinguish this form of breakthrough from previously reported models. Some of the abnormalities appear first in a cohort of postnatal thymocytes as early as the double-negative 2/double-negative 3 transitional stage. Thus, our results reveal an NOD genetic defect in T cell developmental programming and checkpoint control that permits a subset of the normal outcomes of pre-TCR signaling to proceed even in the absence of TCR{beta} rearrangement. Furthermore, this breakthrough may initiate thymic lymphomagenesis that occurs with high frequency in both NOD-scid and -Rag1null mice.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Nonobese diabetic mice spontaneously develop autoimmune type I diabetes that is similar to human disease. Autoimmune diabetes in both humans and NOD mice is physiologically and genetically complex. Approximately 20 loci have been mapped that contribute to diabetes in the NOD mouse (1, 2). Very few of the diabetogenic genes have been identified, but it is known that T lymphocytes play a central role in pathogenesis (3).

Although the percentages of immature and mature T cell subsets in NOD mice are minimally perturbed compared with those in other genotypes (4), functional abnormalities have been reported in various thymic and mature T cell populations from the NOD mouse. Mature T cells from NOD mice display defects in both activation and apoptosis (5, 6, 7, 8, 9). Immature double-positive (DP)3 thymic T cells from NOD mice also appear to be less sensitive to apoptotic stimuli (8, 10), and negative selection of self-reactive DP thymocytes may be aberrant (11). In addition, NOD mice are reported to have fewer immunoregulatory NKT cells (12, 13). These observations support the view that the NOD genetic background can predispose to diabetes through a combination of specific regulatory alterations in function. However, they leave open the question of whether the behavior of these cells, particularly at selection, is a consequence of defects in T cell precursors at the earliest stages of development.

Mice unable to complete TCR and BCR rearrangements, e.g., those homozygous for the Prkdcscid (scid) mutation or for ablation of one of the Rag genes, provide useful access to both immature lymphoid precursors and the recombination-dependent checkpoint mechanisms in lymphocyte development (14). Such immunodeficient mice accumulate specific precursor T cell populations in the thymus that are incapable of rearranging a TCR {beta}-chain and therefore cannot proceed with normal T cell development, remaining CD4–CD8– double negative (DN). The DN cells differentiate through a succession of well-marked stages with increasing commitment to the T lineage: first CD44+CD25– (DN1), which retain the ability to give rise to NK and dendritic cells, then CD44+CD25+ (DN2), then CD44–CD25+ (DN3), when they are fully committed to the T lineage, but there they arrest.

The arrest of the cells at the DN3 stage is itself a response to T cell-specific checkpoint control functions, called {beta} selection, which assay the cells for correct assembly of a pre-TCR signaling complex with the product of a rearranged TCR {beta}-chain gene (15). After early proliferation dependent on IL-7 and Kit ligand (stem cell factor), rearrangement of the TCR{beta} locus is initiated at DN2 or DN3 and development is halted at DN3 until a productive TCR{beta} is made. If a TCR{beta} protein is made that can pair with pre-T{alpha} and CD3 components already present in the cell, signaling commences and induces rapid proliferation and a cascade of gene expression changes. These include loss of surface CD25, transcription and expression of CD8 and CD4, protection from apoptosis, allelic exclusion at the TCR{beta} locus, and initiation of TCR{alpha} germline transcription and rearrangement. Failure to make a properly rearranged TCR{beta} normally results in cell death without further differentiation, unless components of the checkpoint control system are manipulated (reviewed in Ref. 16). This early differentiation programming establishes the signaling machinery to be used for positive and negative selection, when signal strength appears to play a critical role. Variations in differentiation at these TCR-independent stages could then have a profound impact upon later TCR-dependent developmental decisions.

To determine whether NOD mice exhibit any defects in T cell development before the TCR-dependent events of positive and negative selection, we have conducted a detailed analysis of thymocytes from the immunodeficient strains of NOD mice with the scid mutation (17, 18) or Rag1 deficiency (19). In this study we report that both NOD-scid and NOD-Rag1null mouse thymocytes spontaneously break through the {beta} selection checkpoint at ~5–8 wk of age, generating CD4+ single-positive (SP) and CD4+CD8+ DP, TCR-negative cells. These breakthrough cells fail to restore thymic cellularity and show some, but not all, traits of normal {beta}-selected cells, indicating a significant breakdown of developmental coordination and checkpoint control in the NOD genetic background.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mice

C57BL/6J, NOD.CB17-Prkdcscid/J (NOD-scid), B6.CB17-Prkdcscid/SzJ (B6-scid), and NOD.129S7(B6)-Rag1tmMom/J (NOD-Rag1null) mice (The Jackson Laboratory, Bar Harbor, ME); B6.{beta}2mnullIAnull mice (B6-Mhcnull; E. Robey, University of California, Berkeley, CA); and B6-Rag2null mice (Basel Institute, Switzerland) were bred and maintained in specific pathogen-free facilities at Caltech.

Flow cytometric staining and cell sorting

Single-cell suspensions of thymocytes were blocked with anti-Fc Abs and stained on ice in 96-well, U-bottom plates as described previously (20). The following conjugated Abs were used for cell surface staining: CD25, CD4, CD44, CD8, CD2, CD4, CD8, IL-7R{alpha} (BD Pharmingen, San Diego, CA), and CD117 (c-Kit; eBiosciences, San Diego, CA). Anti-TCR{beta}-allophycocyanin and BclII-FITC (BD Pharmingen) and the BD Cytofix/Cytoperm Kit (BD Biosciences, Mountain View, CA) were used for intracellular staining. FACS analyses were performed using a FACSCalibur (BD Biosciences). Thymocyte subsets were sorted using a FACSVantage Cell Sorter (BD Biosciences).

Gene expression analysis using real-time quantitative RT-PCR (Q-PCR)

Pools of four to six thymuses from 8- to 9-wk-old B6-Rag2null and NOD-Rag1null mice and 6- to 8-wk-old B6-scid and NOD-scid mice as well as individual 8-wk-old B6-Mhcnull mice were Ab stained, FACS-sorted, and used for RNA preparations. RNA and cDNA were prepared as described previously (20). Q-PCR was performed on diluted samples of cDNA using SYBR Green PCR Master Mix in an ABI PRISM 7700 Sequence Detector (Applied Biosystems, Foster City, CA). Primers were designed to cross introns and were synthesized at the Caltech DNA Synthesis Core Facility. Primer sequences are as follows: {beta}-actin: forward, ACACCCGCCACCAGTTC; reverse, TACAGCCCGGGGAGCAT; TCR-C{alpha}: forward, AAAGAGACCAACGCCACCTAC; reverse, GAGGATTCGGAGTCCCATAAC; c-Kit: forward, ACTTCGCCTGACCAGATTAAA; reverse, CGTACGTCAGGATTTCTGGTT; IL-7R{alpha}: forward, CAGTTGGAAGTGGATGGAAGT; reverse, TGCAGCTTGTTAAGAGTTAGGC; Bcl2: forward, AGTACCTGAACCGGCATCTG; reverse, CAGCCAGGAGAAATCAAACAG; Bcl-xL: forward, GTCGCCGGAGATAGATTTGAAT; reverse, GTCGCCGGAGATAGATTTGAAT; Heb-alt: forward, GTG CTTATCCTGTCCCTGGAA TG; reverse, TGGCTTGGGAGATGGGTAAC; Hes1: forward, TGAAAACACTGATTTTGGATGC; reverse, GCTCGGGTCTGTGCTGAG; SpiB: forward, CTTGCTCTGGAGGCTGCAC; reverse, CCCCCATCTGAATCTGGGTA; Ikaros: forward, CATAAAGAGCGATGCCACAA; reverse, CAGGACAAGGGACCTCTCTG; Gata3: forward, CCTGCGGACTCTACCATAAAA; reverse, GTGGTGGTGGTCTGACAGTTC; Pim1: forward, GCGAAATCAAACTCATCGAC; reverse, GGTAGCGATGGTAGCGAATC; and p53: forward, GACCATCCTGGCTGTAGGTAG; reverse, GGCTGATATCCGACTGTGACT. Standard curves were obtained for all primer pairs used. Results were calculated using the {Delta}{Delta}Ct method, standardizing all samples to {beta}-actin and then adjusting all values relative to one sample.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Thymocytes from 6- to 8-wk-old NOD-scid and NOD-Ragnull mice spontaneously break through the {beta} selection checkpoint

Unable to complete the rearrangement of the TCR{beta} locus, thymocytes from 4-wk-old NOD-scid mice arrest in the CD44–CD25+CD4–CD8– (DN3) stage of development, like those of B6-scid mice, at the {beta} selection checkpoint, (Fig. 1A, top panels). However, by 6 wk of age NOD-scid thymocytes spontaneously break through the {beta} selection checkpoint, developing CD4+ cells, CD4+CD8+ DP cells, or both (Fig. 1B). The breakthrough cells are negative for detectable surface CD3 or intracellular TCR{beta} (data not shown). Despite this dramatic breakthrough, thymus sizes remain small, and total cell numbers (given above CD4 vs CD8 plots) are comparable between age-matched NOD- and B6-scid mice, indicating that the developing cells fail to proliferate, fail to survive, or both.



View larger version (66K):
[in this window]
[in a new window]
  		FIGURE 1. Spontaneous {beta} selection checkpoint breakthrough in NOD-scid and NOD-Ragnull thymocytes. CD4 vs CD8 and CD44 vs CD25 profiles of thymocytes from 8-wk-old B6-scid and 4-wk-old NOD-scid mice (A) and 8-wk-old B6-Ragnull and 6-wk-old NOD-Ragnull mice (C), showing typical arrest at the {beta} selection checkpoint at the DN3 (CD4–CD8–CD25+CD44–) stage of development. Thymocytes from 6- to 9-wk-old NOD-scid mice (B) and 8- to 10-wk-old NOD-Rag1null mice (D) exhibit breakthrough CD4+ and CD4+CD8+ DP cells. CD25 and CD44 profiles of these cells are also shown for total thymocytes (All) or after gating on CD4–CD8– (DN), CD4+, or CD4+CD8+ (DP) subsets. E, FACS profiles of two 4- to 5-mo-old NOD-Ragnull mice with thymic lymphomas. Total thymus cell numbers are given above all CD4 vs CD8 FACS plots. F, Breakthrough of immunodeficient NOD cells occurs in an age-dependent manner and is genetically recessive. Percentages of CD4+ ({cjs2108}), DP ({blacksquare}), and CD8+ cells ({square}) determined by FACS analyses of thymuses from individual B6-scid, NOD-scid, (B6xNOD)F1-scid, B6-Rag2null, NOD-Rag1null, and (B6xNOD)F1-Rag1null mice at various ages. G, Partial blastogenesis without intracellular TCR{beta} expression in breakthrough immunodeficient NOD cells. CD4 vs CD8 profiles for B6, NOD-scid, and NOD-Ragnull thymocytes (top panels), showing gates used to define DN, ISP, and DP cells for size distribution analysis. B6 ISP cells are also defined by lack of surface TCR{beta} (not shown). Forward scatter plots (lower panels) show the size distributions for gated subsets of ISP and CD4+CD8+ DP cells from B6 (tinted histograms), NOD-scid (dotted lines), and NOD-Ragnull (solid black lines) thymocytes. NOD ISP cells are CD4+, whereas B6 ISP cells are CD8+, surface TCR{beta}-negative cells.

 
Although the scid defect is intrinsically "leaky" and occasionally permits a TCR{beta} rearrangement, Rag1- or -2null mutations completely block rearrangement. For this reason, thymocytes from NOD-Rag1null mice at various ages were also analyzed. Thymocytes from these animals also show an age-dependent breakthrough, similar to that of NOD-scid mice. Development at 6 wk and younger is similar to that of B6-Rag2null thymocytes (Fig. 1C). However, at ~8 wk of age CD4+ SP and CD4+CD8+ DP cells first appear in NOD-Ragnull thymuses (Fig. 1D). Again, intracellular TCR{beta} is not detected (data not shown), and the thymus sizes and cell numbers are not very different from those of control B6-Ragnull thymuses. Thus, the breakthrough phenotype is a characteristic of early T cells on the NOD genetic background, which is revealed by mutations that inhibit TCR gene rearrangement.

The phenotypes of the breakthrough thymocytes are similar in both strains and somewhat unusual. First, the CD4+ SP cells appear to be immature transitional cells between DN and DP cells. Such immature single positives (ISP) are normally CD8+ in most commonly studied mouse strains, such as B6, or acquire CD4 and CD8 together (e.g., as in wild-type NOD (M. A. Yui and E. V. Rothenberg, unpublished observations)). Second, the expression of CD4 occurs without full down-regulation of CD25 (Fig. 1, B and D). This atypical phenotype is especially prominent in the CD4 ISP breakthrough cells, which preserve a DN-like CD44/CD25 staining pattern (Fig. 1, B and D). Third, the down-regulation of CD25 that does occur in the breakthrough cells usually begins in cells that retain some CD44, as if undergoing a direct DN2 to DN4 transition (Fig. 1, B and D), although this is variable between individual animals. All these results contrast with most mouse strains, in which the gains and losses of CD44, CD25, CD8, and CD4 expression from DN2 to DP occur in distinct, sequential steps. Thus, in the NOD immune-deficient thymus, landmark stages of early T cell development appear to overlap and become generally disordered.

Thymic lymphomas, composed of TCR-negative DP and/or CD8+ cells, were observed in two of three NOD-Ragnull mice >4 mo of age (Fig. 1E). Such thymuses were large, with 20–30 x 106 DP and/or CD8 SP cells. Thymic lymphoma formation has been found in NOD-Rag2null cells previously (21) and is well known to occur in NOD-scid mice, where it is the primary cause of mortality in this strain (17). Most of these reported thymic lymphomas consist of CD4+CD8+ TCR-negative cells. Although the focus of this report is on the alterations of thymocyte differentiation observed at ages when frank thymomas are rare, the early loss of {beta} selection checkpoint control may be one of the initiating steps in tumorigenesis in these strains.

Breakthrough is age-dependent and genetically recessive

A summary of the percentages of CD4+ SP and DP cells in individual animals of the various immunodeficient B6 and NOD strains at different ages is shown in Fig. 1F. There were few, if any, breakthrough cells detectable in any animals 4 wk of age or younger. However, all NOD-scid and NOD-Ragnull mice, 5.5 and 8 wk or older, respectively, were found to have CD4+ and/or DP breakthrough cells in variable percentages. In both scid and Ragnull cases, breakthrough occurs similarly in male and female mice (data not shown). Furthermore, (B6xNOD)F1-scid and (B6xNOD)F1-Rag1null hybrid mice do not exhibit the breakthrough NOD phenotype, indicating that this NOD trait is recessive. These results demonstrate that the failure to arrest at the {beta} selection checkpoint is a postnatal developmental event regulated by a recessive gene(s) in the NOD background.

Breakthrough NOD-scid and -Ragnull cells undergo limited proliferation, but disappear before full withdrawal from the cell cycle

One outcome of {beta} selection is a rapid entry into cell cycle and proliferation, especially in the ISP stage, resulting in an increase in cell size and 50- to 100-fold increases in thymic cell numbers. As shown in Fig. 1, A–D, thymic cell numbers in the immunodeficient NOD mice do not significantly increase during breakthrough. Few of the immunodeficient NOD breakthrough CD4+ ISP cells are as large as normal B6 CD8+ ISPs (Fig. 1G, left histogram), but they include a subset of large blasts (based on forward light scatter), suggesting that some of the cells are actively cycling. Similarly, the immune-deficient NOD DP cells include a population of larger, lymphoblastic cells as well as a population of smaller cells that are just slightly larger than the postmitotic DP cells from wild-type B6 mice (Fig. 1G, right histogram). Thus, despite some level of blastogenesis, it appears that the DP cells die before or just after withdrawing from cell cycle.

Bcl-xL expression increases, whereas Bcl2 expression declines, in NOD-scid and -Ragnull breakthrough thymocytes: similarities to normal {beta} selection

To dissect the nature of the breakthrough phenomenon, we evaluated a series of functionally important gene products that are induced or down-regulated in normal {beta} selection. After {beta} selection, Bcl2 levels normally decline and remain low in DP thymocytes (22, 23), whereas Bcl-xL expression dramatically increases and becomes the critical antiapoptotic factor (24). To determine whether abnormally high amounts of Bcl-2 might contribute to the {beta} selection breakthrough, intracellular Bcl-2 was measured by FACS analysis of immunodeficient NOD thymocyte populations. The NOD-scid and -Ragnull breakthrough cells exhibited a decline in intracellular Bcl-2 when surface CD4 was up-regulated, with a further decrease in the DP stage (Fig. 2A, middle and right panels). To determine whether these changes reflect ongoing synthesis, RNA levels were assessed in breakthrough thymocyte subsets by quantitative real-time Q-PCR analysis. DN2, DN3, ISP (CD4+), and DP populations were FACS purified from pools of NOD-scid and -Ragnull thymocytes and compared both with control DN2 and DN3 populations from B6-scid and -Ragnull mice and with control DN3, ISP (CD8+) and DP cells from B6-Mhcnull mice. B6-Mhcnull cells were used as controls for the TCR-negative breakthrough cells because they undergo normal {beta} selection and development of DP cells without proceeding to TCR/MHC-dependent positive or negative selection (25). Using {beta}-actin for normalization, Bcl2 gene transcription, like protein expression, was found to decline in NOD thymocytes during differentiation from DN3 to DP (Fig. 2B, top panel). The same immunodeficient NOD thymocyte samples were also found to increase Bcl-xL expression, although levels were never as high as in Mhcnull controls (Fig. 2B, middle panel). Looking at ratios of Bcl-xL to Bcl2, which removes {beta}-actin normalization artifacts, the breakthrough immunodeficient NOD cells followed a pattern similar to that of thymocytes from B6-Mhcnull control mice undergoing normal {beta} selection, with a delay in the atypical NOD ISP phase and a dramatic increase of ~100-fold by the DP stage (Fig. 2B, bottom panel). This demonstrates that the general regulatory patterns of expression of these critical antiapoptotic genes are maintained in the NOD breakthrough cells, and part of the differentiation program in these cells is the up-regulation of Bcl-xL transcription.



View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 2. Bcl-2 levels decline and Bcl-xL levels increase in immunodeficient NOD breakthrough cells. A, Intracellular Bcl2 staining of breakthrough cells. Thymocytes from B6, B6-scid, NOD-Ragnull, and NOD-scid mice were stained for surface CD4 and CD8, followed by intracellular Bcl-2 (icBcl2) staining. CD4 vs CD8 plots (left panels) and CD4 vs icBcl-2 (middle panels) are shown for each mouse strain along with fluorescence histograms for icBcl2, gated on DN, ISP, and DP populations based upon CD4 and CD8 expression (right panels). Tinted histograms are isotype controls. B, Scatter plots showing the relative amounts of Bcl2 (top panel) and Bcl-xL (middle panel) mRNA normalized with {beta}-actin, and Bcl-xL relative to Bcl2 mRNA (bottom panel) in the same samples. Gene expression was measured by Q-PCR on RNA from sorted DN2 (CD44+CD25+CD4–CD8–), DN3 (CD44–CD25+CD4–CD8–), ISP (CD4+), and CD4+CD8+ DP populations from NOD-scid and -Ragnull mice; DN2 and DN3 cells from B6-scid and Ragnull, and DN3, ISP (CD8+); and DP cells from B6-Mhcnull mice. Data from two or three independent pooled samples are included for each strain and subset.

 
Similarities to normal {beta} selection: expression of germline TCR{alpha} transcription and surface CD2 in breakthrough NOD-Ragnull and -scidcells

One hallmark outcome of {beta} selection is the transcription of C{alpha} that accompanies the opening of the TCR{alpha} locus to recombination (26). Comparing sorted thymocyte subsets from the different mouse strains by Q-PCR, C{alpha} transcription was not detected in DN2 and DN3 subsets from immunodeficient NOD or B6 mice, whereas expression was found in control B6-Mhcnull ISP and DP cells, as well as some low level expression in the Mhcnull DN3 population, which includes some cells beginning {beta} selection. In these analyses, breakthrough NOD-Ragnull DP cells and NOD-scid CD4+ and DP cells expressed germline TCR-C{alpha} transcripts similarly to the control ISP cells (Fig. 3A).



View larger version (31K):
[in this window]
[in a new window]
  		FIGURE 3. TCR-C{alpha} germline transcription and surface CD2 are up-regulated in immunodeficient NOD breakthrough cells. A, Relative amounts of TCR-C{alpha} transcription in control and immunodeficient NOD thymocyte subsets, using Q-PCR on the same samples used and described in Fig. 2. {beta}-Actin levels were used for normalization. *, Not detected. B, FACS analysis showing that surface CD2 is up-regulated in both normal (B6-Mhcnull) and NOD-Ragnull DN, ISP, and DP cells, but not in B6-Ragnull DN cells. C, Summary of CD2 mean fluorescence (geometric) values for DN, ISP, and DP subsets from FACS analysis data obtained from B6-Mhcnull, B6-Ragnull, NOD-Ragnull, B6-scid, and NOD-scid thymocytes.

 
CD2 is typically up-regulated after {beta} selection (27). Like control B6-Mhcnull ISP and DP cells, NOD-Ragnull and -scid breakthrough CD4+ ISP and DP cells showed a dramatic increase in CD2 fluorescence relative to the DN cells (Fig. 3B). Furthermore, the mean fluorescence levels of surface CD2 expressed in most populations of NOD-Ragnull as well as NOD-scid cells were even higher than those observed in control cells (Fig. 3C). These results show that both C{alpha} and CD2 are induced in NOD breakthrough cells, demonstrating that several more aspects of the normal post-{beta} selection differentiation program are initiated in the breakthrough cells.

Breakthrough NOD-scid and -Ragnull thymocytes have high levels of surface c-Kit and IL-7R{alpha} expression: distinction from normal {beta} selection

The mechanisms exerting checkpoint control in normal mice are thought to include a default apoptotic pathway from which pre-TCR signaling rescues the cells (28). Thus, any gene products that could provide survival signals aberrantly were of special interest. The growth receptors for stem cell factor, c-Kit (CD117), and IL-7, IL-7R{alpha}, are critical for the survival and proliferation of cells in the DN stages of T cell development, but not after {beta} selection (29). c-Kit levels are normally highest in DN1 and DN2 cells and decline from DN2 to DN3, with levels remaining low in most ISP and DP cells. This decline could be important for the normal shift in the survival requirements of the cells, from cytokine dependence to pre-TCR dependence. In the NOD-Ragnull thymocytes, surface expression of c-Kit in breakthrough CD4+ and DP cells was much higher than that in normal B6-Mhcnull ISP and DP thymocytes (Fig. 4A). Mean fluorescence values from NOD-Ragnull and -scid subsets showed that whereas levels of c-Kit in NOD-Ragnull breakthrough cells were much higher than those in control cells, NOD-scid levels of c-Kit were only slightly higher than those in control subsets (Fig. 4B), although the latter observation was consistent, especially in early breakthrough cells (data not shown). The differences in c-Kit expression in NOD-scid vs -Ragnull cells may be related to the more complex mechanism of developmental arrest and cell death in the scid mutant generally (14).



View larger version (36K):
[in this window]
[in a new window]
  		FIGURE 4. c-Kit and IL-7R{alpha} are initially expressed at higher levels in breakthrough immunodeficient NOD subsets than corresponding control subsets. A, FACS analysis showing that surface c-Kit (left panels) and IL-7R{alpha} (right panels) are higher in NOD-Ragnull DN, ISP, and DP cells than in corresponding control B6-Ragnull or normal (B6-Mhcnull) cells. CD4 vs CD8 plots and gates for these cells are shown in Fig. 4B. B, Histograms of surface c-Kit (top) and IL-7R{alpha} (bottom) expression, showing mean fluorescence (geometric) values for gated DN, ISP, and DP subsets from B6-Mhcnull, B6-Ragnull, NOD-Ragnull, B6-scid, and NOD-scid thymocytes. (Off-scale values are given above corresponding histogram bars.) C, Histograms showing relative amounts of c-Kit (left plot) and IL-7R{alpha} (right plot) mRNA in control and immunodeficient NOD thymocyte subsets, using Q-PCR on the same samples used and described in Fig. 2. {beta}-Actin levels were used for normalization. nd, not detected. Subsets with detectable differences in levels between NOD and controls are boxed.

 
Although surface IL-7R{alpha} levels declined somewhat after {beta} selection in normal cells, surface expression of IL-7R{alpha} in breakthrough CD4+ and DP NOD-Ragnull thymocytes was again higher than that in normal B6-Mhcnull ISP and DP thymocytes (Fig. 4A). Mean fluorescence values from NOD-Ragnull and -scid cells showed that in all subset populations from both NOD strains, values were much higher than those in control cells, with the peak in expression occurring in the CD4+ ISP cells (Fig. 4B). Thus, c-Kit and IL-7R{alpha} levels in breakthrough cells appear to be at least initially higher than those in normal {beta}-selected cells in both immunodeficient NOD strains.

To determine whether this unusual level of surface c-Kit and IL-7R{alpha} expression reflects ongoing synthesis, Q-PCR was performed on the same samples used for Bcl2, Bcl-xL, and TCR-C{alpha} RNA analysis. The c-kit and IL-7R{alpha} genes were expressed at high levels in the DN2 and DN3 cells from B6-Ragnull and B6-Mhcnull mice as well as in these subsets from immunodeficient NOD mice. However, although the c-kit and IL-7R{alpha} mRNA levels declined precipitously in the ISP and DP cells from B6-Mhcnull mice, they remained high in all ISP from NOD-scid and NOD-Ragnull mice (Fig. 4C). The c-kit and IL-7R{alpha} mRNA levels in DP samples from immunodeficient NOD mice were more variable, although levels of IL-7R{alpha} in particular were still much higher than those ofMhcnull DP cells, which were undetectable. These data support the FACS data showing that c-kit and IL-7R{alpha} levels are both unusually high in the immunodeficient NOD cells, especially in the CD4+ early breakthrough cells.

Some, but not all, gene expression changes typical of {beta} selection occur during differentiation of breakthrough immunodeficient NOD cells

To begin to dissect the causes and outcomes of the checkpoint breakthrough in the immunodeficient NOD cells, expression patterns of a number of other genes expressed in early thymocytes were analyzed by Q-PCR, using the same samples shown previously. These analyses were designed, on the one hand, to examine the status of functions that have been implicated in other cases of checkpoint violation and, on the other hand, to define subsets of coordinately regulated events within the complex set of {beta} selection responses.

Three transcription factors expressed in DN cells, the bHLH factors HEB-alt (a 5' splice isoform of HEB) (M. K. Anderson and E. V. Rothenberg, unpublished observations) (30) and Hes1, and an Ets factor, SpiB, all declined precipitously in the transition from DN3 to ISP/DP stages in B6-Mhcnull cells as they undergo {beta} selection (Fig. 5). However, none of these factors exhibited the same magnitude of decline in the NOD breakthrough cells. Levels of mRNA of HEB-alt decreased only slightly in the NOD breakthrough cells, while declining to almost undetectable levels after {beta} selection in control cells. Hes1 also displayed a modest decline in transcription in NOD CD4+ and DP breakthrough cells at a time of precipitous decrease in expression in normal control ISP and DP cells. The Ets-related transcription factor, SpiB, normally expressed only transiently in the DN3 stage of development, was not only higher initially in immunodeficient NOD DN3 cell populations than those from most control mice, but also failed to decline in NOD breakthrough cells and was even elevated in many cases. These results, along with data for c-kit and IL-7R{alpha}, show that negative transcriptional changes that occur during normal {beta} selection take place much more slowly, if at all, in NOD breakthrough cells.



View larger version (23K):
[in this window]
[in a new window]
  		FIGURE 5. Real-time Q-PCR analyses of HEB-alt, Hes1, SpiB, Ikaros, Gata3, Pim1, and p53 mRNA expression in immunodeficient NOD breakthrough cells and in normal {beta} selection. The same immunodeficient NOD and control subsets were used as described in Fig. 2B. {beta}-Actin levels were used for normalization. Subsets with detectable differences in levels between NOD and control cells are boxed.

 
Genes that fail to show clear differences between subsets from immunodeficient NOD and control B6 animals include Ikaros, which is implicated in tumor suppression and checkpoint control (31); another transcription factor critical for T cell development, Gata3 (32, 33); and Pim1 and p53, known to play roles in {beta} selection and thymic lymphoma formation (34, 35, 36) (Fig. 5).

An additional set of genes with known or suspected roles in {beta} selection checkpoint control, apoptosis, and/or thymic lymphoma formation was assayed for evidence of major dysregulation at the RNA level. These include pre-T{alpha}, pro- and antiapoptotic factors (Bad, Bax, Bim, Cflar/Flip, and Fadd), other transcription factors (Id2, Id3, Runx1, and PU.1), as well as other genes (hedgehog pathway receptor Smoothened (Smo), suppressor of cytokine signaling (Socs1), twisted gastrulation (Twsg)) (reviewed in Ref. 16). However, none of these exhibited obvious or consistent differences between immunodeficient NOD cells and controls, either pre- or postbreakthrough (data not shown).

Breakthrough CD2+c-Kit+IL-7R{alpha}+ NOD-Ragnull cells emerge before overt CD4 up-regulation and can occur at DN2 or DN2-DN3 transitional stages

Examining the timing of the developmental defect in more detail, thymocytes from 4.5-, 6-, and 7.5-wk-old mice were analyzed in comparison with cells from 8-wk-old B6-Ragnull and TCR-negative cells from B6-Mhcnull mice. Thymocytes from 4.5- and 6-wk-old NOD-Ragnull mice looked much like those from B6-Ragnull mice, except for somewhat higher levels of CD4 (Fig. 6A). Although the levels of CD4 were not different between 4.5- and 6-wk-old mice, gating on CD4int-high populations, a distinct subpopulation, expressing high levels of both c-Kit and IL-7R{alpha}, appeared in 6-wk-old mouse cells that was not present in 4.5-wk-old mice (Fig. 6A, long arrow). At 7.5 wk of age, this cytokine receptor high population was seen distinctly in the DN subset as well as the CD4high cells (Fig. 6A, short arrows).



View larger version (38K):
[in this window]
[in a new window]
  		FIGURE 6. Flow cytometric detection of the emergence of breakthrough cells in DN thymocytes of NOD-Ragnull mice. Thymocytes from 8-wk-old B6-Ragnull mice were compared with those from 4.5-, 6-, and 7.5-wk-old NOD-Ragnull mice as indicated. A, CD4 vs CD8 FACS plots, showing gates for DN (CD4–CD8–) and CD4 intermediate or high cells (CD4int-high; left panels). Right panels, c-Kit vs IL-7R{alpha} plots, gated on DN and CD4int-high cells, show the appearance of a distinct subset of c-Kit+IL-7R{alpha}+ cells in the CD4int-high cells at 6 wk (long arrow) that is not present in 4.5-wk-old mice and is present in both DN and CD4int-high cells at 7.5 wk (short arrows). B, CD44 vs CD25 staining, showing CD44+CD25+ (DN2-like) and CD44–CD25+ (DN3-like) populations gated as indicated (left panels). Middle panels, CD4 vs CD2 plots, gated on DN2 and DN3 cells, show the appearance of a CD4intCD2+ population in 6-wk-old DN3 cells (long arrow) that is not present in 4.5-wk-old mice, and a CD4+CD2+ subset in both DN2 and DN3 populations at 7.5 wk. Right panels, CD4 vs c-Kit plots, gated on DN2 and DN3 cells, show the appearance of a CD4intc-Kit+ population in 6-wk-old DN3 cells (long arrow) that is not present in 4.5-wk-old mice, and a CD4+c-Kit+ subset in both DN2 and DN3 populations (short arrows) at 7.5 wk. The percentages of cells in gates and quadrants are shown.

 
Examining the DN subsets from the same mice using pre-T cell markers CD44 and CD25 as well as CD4, a small subset of CD44–CD25+ DN3-like (DN3) cells appeared in 6-wk-old NOD-Ragnull animals that were intermediate for CD4, but high for CD2 and c-Kit, before an obvious breakthrough of CD4+ cells was observed (Fig. 6B, long arrows). CD44+CD25+ DN2-like (DN2) populations from 6-wk-old animals looked very much like DN2 cells from 4.5-wk-old NOD-Ragnull cells and 8-wk-old B6-Ragnull cells (Fig. 6B). However, at 7.5 wk, the DN2 and DN3 populations also contain a subset of CD4+c-Kit+CD2+ cells (Fig. 6B, short arrows) in addition to a conventional DN3 population of cells that are lower for all these markers, like cells from younger animals and B6 controls. Even at 4.5 wk of age, DN3 cells from NOD-Ragnull mice had a slightly higher percentage of CD2+ and c-Kit+ thymocytes than those from B6-Ragnull mice, suggesting that the cells may arise even earlier. Taken together, these results show that there is a cohort of cells present in the thymus emerging before 6 wk of age that fails to undergo normal DN developmental pathways found in B6-Ragnull mice. Some of these cells can be distinguished by the retention of some DN2-like characteristics (high levels of surface CD44, c-Kit, and IL-7R{alpha}) as well as the acquisition of surface CD2 and CD4. These results suggest that the breakdown in developmental programming may be initiated at the DN2 or DN2-DN3 transitional stage rather than only after prolonged survival at the DN3 stage.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The scid mutation and Rag deficiency reveal that the NOD genetic background confers a fundamental defect in early T cell development and checkpoint control. Although these mutations, on a normal B6 or CB.17 genetic background, block development at the {beta} selection checkpoint, thymocytes from both NOD immunodeficient strains spontaneously break through this checkpoint. At ~5–7 wk of age CD4+ and CD4+CD8+ DP cells appear in the thymuses of both NOD strains. Although some differences in the precise timing and gene expression patterns occur between NOD-scid and NOD-Ragnull breakthrough thymocytes, the overall patterns are the same and demonstrate that the defect is due to the NOD genetic background. Furthermore, both NOD immune-deficient strains are prone to thymic lymphomas, which are often CD4+CD8+ DP and may have their origins in these breakthrough cells.

Manipulations that allow cells to develop beyond the DN3 stage without a pre-TCR fall into three general categories. First, cells with the scid or Ragnull mutations or any other pre-TCR defect can undergo a fairly normal {beta} selection process in response to the triggering of an Lck/MAPK/protein kinase C signaling cascade, mimicking the pre-TCR (15). These options include cross-linking with anti-CD3 Abs, which can initiate a TCR signal even without a TCR{beta} protein (37), deletion of the Lck inhibitory kinase, Csk (38), or expression of constitutively activated Lck (39). These models result in all the normal outcomes of {beta} selection and restoration of thymocyte cell numbers. Second, at the opposite extreme, loss of Runx1 or Brg leads to an appearance of prematurely CD4+ cells without any other features of normal {beta} selection due to a specific failure of CD4 repression (40, 41). Finally, a partial rescue can be obtained by alterations that do not reproduce the full pre-TCR signal. Bcl-2 overexpression (23), p53 deficiency (35, 36, 42), Ikaros deficiency (31), constitutively active NF-{kappa}B (43), and dominant negative Fadd (44) each allow differentiation of Ragnull cells, but with little or no proliferation or cell accumulation. These breakthroughs appear to be due to transient antiapoptotic functions, bypassing the need for pre-TCR signaling for survival, but inadequate to produce a full proliferative response.

As in the latter examples, the NOD defect in {beta} selection checkpoint control induces many specific aspects of {beta} selection, but does not support strong proliferation and accumulation of DP cells, suggesting an antiapoptotic component. Mature TCR-positive cells and DP thymocytes from wild-type NOD mice are known to be resistant to some forms of cell death, and this defect is postulated to be involved in the generation of autoimmunity (7, 8, 10, 45). Furthermore, the high frequency of thymomas in both NOD-scid (17) and NOD-Ragnull mice (Ref. 21 and this study) as well as the presence of tumors in older NOD mice that do not die from diabetes (46) support the idea that checkpoint control and apoptosis are abnormal in NOD mice. The results presented in this study could extend that relative death resistance back to the earliest stages of T cell development.

The elevated expression of c-Kit and IL-7R{alpha} growth factor receptors may contribute to survival signals, although they normally do so via induction of Bcl-2 expression, which is not maintained in the breakthrough cells. Control of apoptosis vs survival in T cells and other cells is very complex, with many different genes and pathways impacting on the outcome. Although transcription of the molecules implicated in other similar cases of checkpoint violation, such as p53, Cflar/Flip, Fadd, and Bcl2, do not appear to be dramatically affected, we cannot rule out more subtle variations in the expression of these genes at key developmental points or mutational and posttranslational effects.

The breakthrough may include failure of a cell death mechanism that normally limits the life span of the DN3 thymocytes. However, the developmental abnormalities can appear at an earlier stage, before CD44, c-Kit, and IL-7R{alpha} are down-regulated, at the DN2 or DN2-DN3 transitional stages. This suggests that the defect is not simply due to prolonged survival at the DN3 stage. Furthermore, the overall gene expression pattern induced during breakthrough is clearly atypical, indicating a basic decoupling of {beta} selection program components.

Our detailed analyses enable us to distinguish between specific components of the differentiation program initiated in NOD early T cells that do and do not follow the program of normal {beta}-selected cells. Fig. 7 summarizes the similarities and differences in the timing and expression of landmark surface markers and other genes known to change around the time of {beta} selection between immunodeficient NOD breakthrough cells and control immunodeficient and normal cells on a B6 background. CD4, CD8, CD2, Bcl-xL, and Tcr-C{alpha} all increase in expression in the breakthrough cells, mimicking normal thymocytes, although the timing may differ. The shift to a high Bcl-xL:Bcl2 ratio with differentiation occurs, although again there is some delay in the NOD breakthrough cells, suggesting a closer linkage with CD8 expression (by induction) (47) than with CD4 expression (by derepression) (40). The expression of c-kit and IL-7R{alpha} is high in early breakthrough cells and remains high, in NOD-Ragnull cells in particular. However, several other genes whose expression normally drops sharply after {beta} selection are still maintained at fairly high levels in the NOD CD4+ ISP breakthrough cells, including CD25 and the transcription factors HEB-alt, SpiB, and Hes1. The differences in rates of proliferation occurring in normal {beta}-selected cells vs NOD breakthrough cells may play a role in this failed down-regulation, because the high rate of proliferation seen in {beta}-selected cells, but not breakthrough cells, may help to dilute out both surface receptors and extant pools of mRNA. However, this cannot be the whole story for SpiB, which appears to be up-regulated in the ISP cells of the NOD-scid and NOD-Ragnull mice. Although SpiB overexpression in T cell progenitors can favor the development of plasmacytoid dendritic cells (48), the normal role for transient SpiB expression in normal DN3 cells is not known.



View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 7. Summary of differences and similarities between breakthrough immunodeficient NOD thymocytes and control B6 immunodeficient and normal thymocytes. A, Diagram showing the developmental sequence of landmark surface markers for immunodeficient NOD T cells compared with normal T cell development. B, Table summarizing the differences and similarities in the expression of specific molecules changing before or after the {beta} selection checkpoint between immunodeficient NOD breakthrough cells and control B6 immunodeficient or wild-type cells.

 
Together this panel of genes shows that the immunodeficient breakthrough cells initially maintain many gene expression characteristics of the DN2/3 progenitor cells while initiating the expression of new genes characteristic of cells receiving a pre-TCR signal to progress through {beta} selection. The specific pattern of alterations we document in this study gives the NOD breakthrough phenotype a distinctive molecular signature. An extension of this gene expression approach to other models would provide the tools to compare the mechanisms of the NOD form of breakthrough with those of specifically targeted genetic perturbations in checkpoint control.

The expression of the adhesion and signaling molecule, CD2, in the earliest breakthrough cells is particularly intriguing. CD2 can play an important role in TCR signaling by setting quantitative thresholds for Ag responsiveness (49) and in pre-TCR signaling (50). Whether CD2 expression contributes to or is a consequence of a partial pre-TCR signal in the immunodeficient NOD breakthrough cells will require further investigation. Furthermore, in preliminary experiments we find that CD2 levels in most wild-type NOD subsets are higher than levels in similar populations from B6 thymuses, and this difference may be age-dependent (M. A. Yui, unpublished observations), a characteristic that could affect thymic selection and tolerance induction. Thus, phenomena observed in the earliest stages of development in TCR-negative immunodeficient NOD strains may have relevance for differentiation and mature cell functions in wild-type NOD mice.

There appears to be a close relationship between the breakthrough phenotype and the development of thymic lymphomas in the immunodeficient NOD animals. Thymic lymphomas were reported to be predominantly TCR-negative and either DP or CD8+ in NOD-scid (17) and NOD-Ragnull mice (21). We also observed thymic lymphomas in two of three 4-mo-old NOD-Rag1null mice in this study. A previous study showed linkage between the large thymic lymphomas in NOD-scid mice and an endogenous ecotropic retrovirus, Emv30 (17), which was subsequently found to affect the progression, but not the initiation of thymic lymphomas (51). To check whether the breakthrough phenotype in NOD-scid and -Ragnull mice maps to this locus, we analyzed (NOD-scidxB6-scid)F1 and F1xNOD-scid backcross mice. The trait appears to be genetically recessive, because F1 mice did not exhibit the breakthrough phenotype despite having an expressible copy of Emv30. Furthermore, in a preliminary analysis of 58 backcross mice the trait did not correlate with the presence of two copies of the gene (data not shown), further ruling out Emv30 as the genetic source of the breakthrough phenotype. The precedents of E2a and Ikaros knockout mice (31, 52) support the inference that {beta} selection violation in itself can be the source of susceptibility to thymic lymphoma.

These defects in {beta} selection, revealed by mutations in TCR recombinational machinery, suggest a new class of abnormality in thymocyte development that could contribute to diabetogenesis in wild-type NOD mice. The exact relationships among these processes remain to be worked out. Our findings demonstrate that T cells developing postnatally in the NOD mouse may have derangements in their differentiation and responses to checkpoint controls from the earliest stages of development. Although the developmental defect is revealed by immunodeficiency, the underlying genetic and molecular natures of this defect are shared by wild-type NOD precursor T cells, with unknown effects in the presence of ongoing TCR rearrangement. Because many of the same molecular pathways are required at {beta} selection and during subsequent T cell differentiation, subtle differences in signaling and survival at critical early stages of development may set aberrant thresholds for later T cell responses to selecting, activating, and apoptotic signals. The higher levels of CD2 seen in breakthrough cells as well as normal NOD cells may be among these factors. These immunodeficient NOD strains should provide an excellent model system in which to study a unique defect in early T cell differentiation programming, {beta} selection checkpoint control, and thymic lymphoma development.


   Acknowledgments
 
We thank R. Bayon for excellent mouse care, R. Diamond and P. Koen (Caltech Flow Cytometry Facility) for advice and cell sorting, Dr. M. K. Anderson (University of Toronto) for Heb-alt primers, and Dr. E. Robey (University of California-Berkeley) for providing B6-Mhcnull mice.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grants AG13108 and CA90233 (to E.V.R.). Back

2 Address correspondence and reprint requests to Dr. Ellen V. Rothenberg, Division of Biology, 156-29, California Institute of Technology, Pasadena, CA 91125. E-mail address: evroth{at}its.caltech.edu Back

3 Abbreviations used in this paper: DP, double positive; DN, double negative; ISP, immature single positive; Q-PCR, quantitative real-time RT-PCR. Back

Received for publication May 27, 2004. Accepted for publication August 12, 2004.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Wicker, L. S., J. A. Todd, L. B. Peterson. 1995. Genetic control of autoimmune diabetes in the NOD mouse. Annu. Rev. Immunol. 13:179.[Medline]
  2. Todd, J. A., L. S. Wicker. 2001. Genetic protection from the inflammatory disease type 1 diabetes in humans and animal models. Immunity 15:387.[Medline]
  3. Serreze, D. V., E. H. Leiter. 2001. Genes and cellular requirements for autoimmune diabetes susceptibility in nonobese diabetic mice. Curr. Dir. Autoimmun. 4:31.[Medline]
  4. Berzins, S. P., E. S. Venanzi, C. Benoist, D. Mathis. 2003. T-cell compartments of prediabetic NOD mice. Diabetes 52:327.[Abstract/Free Full Text]
  5. Garchon, H. J., J. J. Luan, L. Eloy, P. Bedossa, J. F. Bach. 1994. Genetic analysis of immune dysfunction in non-obese diabetic (NOD) mice: mapping of a susceptibility locus close to the Bcl-2 gene correlates with increased resistance of NOD T cells to apoptosis induction. Eur. J. Immunol. 24:380.[Medline]
  6. Colucci, F., C. M. Cilio, K. Lejon, C. P. Goncalves, M. L. Bergman, D. Holmberg. 1996. Programmed cell death in the pathogenesis of murine IDDM: resistance to apoptosis induced in lymphocytes by cyclophosphamide. J. Autoimmun. 9:271.[Medline]
  7. Leijon, K., B. Hammarstrom, D. Holmberg. 1994. Non-obese diabetic (NOD) mice display enhanced immune responses and prolonged survival of lymphoid cells. Int. Immunol. 6:339.[Abstract/Free Full Text]
  8. Lamhamedi-Cherradi, S. E., J. J. Luan, L. Eloy, G. Fluteau, J. F. Bach, H. J. Garchon. 1998. Resistance of T-cells to apoptosis in autoimmune diabetic (NOD) mice is increased early in life and is associated with dysregulated expression of Bcl-x. Diabetologia 41:178.[Medline]
  9. Zipris, D., A. H. Lazarus, A. R. Crow, M. Hadzija, T. L. Delovitch. 1991. Defective thymic T cell activation by concanavalin A and anti-CD3 in autoimmune nonobese diabetic mice: evidence for thymic T cell anergy that correlates with the onset of insulitis. J. Immunol. 146:3763.[Abstract]
  10. Penha-Goncalves, C., K. Leijon, L. Persson, D. Holmberg. 1995. Type 1 diabetes and the control of dexamethasone-induced apoptosis in mice maps to the same region on chromosome 6. Genomics 28:398.[Medline]
  11. Kishimoto, H., J. Sprent. 2001. A defect in central tolerance in NOD mice. Nat. Immunol. 2:1025.[Medline]
  12. Gombert, J. M., A. Herbelin, E. Tancrede-Bohin, M. Dy, C. Carnaud, J. F. Bach. 1996. Early quantitative and functional deficiency of NK1+-like thymocytes in the NOD mouse. Eur. J. Immunol. 26:2989.[Medline]
  13. Baxter, A. G., S. J. Kinder, K. J. Hammond, R. Scollay, D. I. Godfrey. 1997. Association between {alpha}{beta}TCR+CD4–CD8– T-cell deficiency and IDDM in NOD/Lt mice. Diabetes 46:572.[Abstract]
  14. Diamond, R. A., S. B. Ward, K. Owada-Makabe, H. Wang, E. V. Rothenberg. 1997. Different developmental arrest points in RAG-2–/– and SCID thymocytes on two genetic backgrounds: developmental choices and cell death mechanisms before TCR gene rearrangement. J. Immunol. 158:4052.[Abstract]
  15. Kruisbeek, A. M., M. C. Haks, M. Carleton, A. M. Michie, J. C. Zuniga-Pflucker, D. L. Wiest. 2000. Branching out to gain control: how the pre-TCR is linked to multiple functions. Immunol. Today 21:637.[Medline]
  16. Rothenberg, E. V., M. A. Yui, J. C. Telfer. 2003. T-cell developmental biology. W. E. Paul, ed. Fundamental Immunology 259. Lippincott Williams & Wilkins, Philadelphia.
  17. Prochazka, M., H. R. Gaskins, L. D. Shultz, E. H. Leiter. 1992. The nonobese diabetic scid mouse: model for spontaneous thymomagenesis associated with immunodeficiency. Proc. Natl. Acad. Sci. USA 89:3290.[Abstract/Free Full Text]
  18. Shultz, L. D., P. A. Schweitzer, S. W. Christianson, B. Gott, I. B. Schweitzer, B. Tennent, S. McKenna, L. Mobraaten, T. V. Rajan, D. L. Greiner, et al 1995. Multiple defects in innate and adaptive immunologic function in NOD/LtSz-scid mice. J. Immunol. 154:180.[Abstract]
  19. Shultz, L. D., P. A. Lang, S. W. Christianson, B. Gott, B. Lyons, S. Umeda, E. Leiter, R. Hesselton, E. J. Wagar, J. H. Leif, et al 2000. NOD/LtSz-Rag1null mice: an immunodeficient and radioresistant model for engraftment of human hematolymphoid cells, HIV infection, and adoptive transfer of NOD mouse diabetogenic T cells. J. Immunol. 164:2496.[Abstract/Free Full Text]
  20. Yui, M. A., G. Hernandez-Hoyos, E. V. Rothenberg. 2001. A new regulatory region of the IL-2 locus that confers position-independent transgene expression. J. Immunol. 166:1730.[Abstract/Free Full Text]
  21. Chiu, P. P., E. Ivakine, S. Mortin-Toth, J. S. Danska. 2002. Susceptibility to lymphoid neoplasia in immunodeficient strains of nonobese diabetic mice. Cancer Res. 62:5828.[Abstract/Free Full Text]
  22. Gratiot-Deans, J., R. Merino, G. Nunez, L. A. Turka. 1994. Bcl-2 expression during T-cell development: early loss and late return occur at specific stages of commitment to differentiation and survival. Proc. Natl. Acad. Sci. USA 91:10685.[Abstract/Free Full Text]
  23. Linette, G. P., M. J. Grusby, S. M. Hedrick, T. H. Hansen, L. H. Glimcher, S. J. Korsmeyer. 1994. Bcl-2 is upregulated at the CD4+ CD8+ stage during positive selection and promotes thymocyte differentiation at several control points. Immunity 1:197.[Medline]
  24. Grillot, D. A., R. Merino, G. Nunez. 1995. Bcl-xL displays restricted distribution during T cell development and inhibits multiple forms of apoptosis but not clonal deletion in transgenic mice. J. Exp. Med. 182:1973.[Abstract/Free Full Text]
  25. Grusby, M. J., H. Auchincloss, Jr, R. Lee, R. S. Johnson, J. P. Spencer, M. Zijlstra, R. Jaenisch, V. E. Papaioannou, L. H. Glimcher. 1993. Mice lacking major histocompatibility complex class I and class II molecules. Proc. Natl. Acad. Sci. USA 90:3913.[Abstract/Free Full Text]
  26. Anderson, S. J., K. M. Abraham, T. Nakayama, A. Singer, R. M. Perlmutter. 1992. Inhibition of T-cell receptor {beta}-chain gene rearrangement by overexpression of the non-receptor protein tyrosine kinase p56lck. EMBO J. 11:4877.[Medline]
  27. Rodewald, H. R., K. Awad, P. Moingeon, L. D’Adamio, D. Rabinowitz, Y. Shinkai, F. W. Alt, E. L. Reinherz. 1993. Fc{gamma}RII/III and CD2 expression mark distinct subpopulations of immature CD4–CD8– murine thymocytes: in vivo developmental kinetics and T cell receptor {beta} chain rearrangement status. J. Exp. Med. 177:1079.[Abstract/Free Full Text]
  28. Petrie, H. T., M. Tourigny, D. B. Burtrum, F. Livak. 2000. Precursor thymocyte proliferation and differentiation are controlled by signals unrelated to the pre-TCR. J. Immunol. 165:3094.[Abstract/Free Full Text]
  29. Di Santo, J. P., I. Aifantis, E. Rosmaraki, C. Garcia, J. Feinberg, H. J. Fehling, A. Fischer, H. von Boehmer, B. Rocha. 1999. The common cytokine receptor {gamma} chain and the pre-T cell receptor provide independent but critically overlapping signals in early {alpha}/{beta} T cell development. J. Exp. Med. 189:563.[Abstract/Free Full Text]
  30. Anderson, M. K., G. Hernandez-Hoyos, R. A. Diamond, E. V. Rothenberg. 1999. Precise developmental regulation of Ets family transcription factors during specification and commitment to the T cell lineage. Development 126:3131.[Abstract]
  31. Winandy, S., L. Wu, J. H. Wang, K. Georgopoulos. 1999. Pre-T cell receptor (TCR) and TCR-controlled checkpoints in T cell differentiation are set by Ikaros. J. Exp. Med. 190:1039.[Abstract/Free Full Text]
  32. Hernandez-Hoyos, G., M. K. Anderson, C. Wang, E. V. Rothenberg, J. Alberola-Ila. 2003. GATA-3 expression is controlled by TCR signals and regulates CD4/CD8 differentiation. Immunity 19:83.[Medline]
  33. Pai, S. Y., M. L. Truitt, C. N. Ting, J. M. Leiden, L. H. Glimcher, I. C. Ho. 2003. Critical roles for transcription factor GATA-3 in thymocyte development. Immunity 19:863.[Medline]
  34. Jacobs, H., P. Krimpenfort, M. Haks, J. Allen, B. Blom, C. Demolliere, A. Kruisbeek, H. Spits, A. Berns. 1999. PIM1 reconstitutes thymus cellularity in interleukin 7- and common {gamma} chain-mutant mice and permits thymocyte maturation in Rag- but not CD3{gamma}-deficient mice. J. Exp. Med. 190:1059.[Abstract/Free Full Text]
  35. Jiang, D., M. J. Lenardo, J. C. Zuniga-Pflucker. 1996. p53 prevents maturation to the CD4+CD8+ stage of thymocyte differentiation in the absence of T cell receptor rearrangement. J. Exp. Med. 183:1923.[Abstract/Free Full Text]
  36. Bogue, M. A., C. Zhu, E. Aguilar-Cordova, L. A. Donehower, D. B. Roth. 1996. p53 is required for both radiation-induced differentiation and rescue of V(D)J rearrangement in scid mouse thymocytes. Genes Dev. 10:553.[Abstract/Free Full Text]
  37. Levelt, C. N., A. Ehrfeld, K. Eichmann. 1993. Regulation of thymocyte development through CD3. I. Timepoint of ligation of CD3{epsilon} determines clonal deletion or induction of developmental program. J. Exp. Med. 177:707.[Abstract/Free Full Text]
  38. Schmedt, C., A. Tarakhovsky. 2001. Autonomous maturation of {alpha}/{beta} T lineage cells in the absence of COOH-terminal Src kinase (Csk). J. Exp. Med. 193:815.[Abstract/Free Full Text]
  39. Mombaerts, P., S. J. Anderson, R. M. Perlmutter, T. W. Mak, S. Tonegawa. 1994. An activated lck transgene promotes thymocyte development in RAG-1 mutant mice. Immunity 1:261.[Medline]
  40. Taniuchi, I., M. Osato, T. Egawa, M. J. Sunshine, S. C. Bae, T. Komori, Y. Ito, D. R. Littman. 2002. Differential requirements for Runx proteins in CD4 repression and epigenetic silencing during T lymphocyte development. Cell 111:621.[Medline]
  41. Chi, T. H., M. Wan, K. Zhao, I. Taniuchi, L. Chen, D. R. Littman, G. R. Crabtree. 2002. Reciprocal regulation of CD4/CD8 expression by SWI/SNF-like BAF complexes. Nature 418:195.[Medline]
  42. Guidos, C. J., C. J. Williams, I. Grandal, G. Knowles, M. T. Huang, J. S. Danska. 1996. V(D)J recombination activates a p53-dependent DNA damage checkpoint in scid lymphocyte precursors. Genes Dev. 10:2038.[Abstract/Free Full Text]
  43. Voll, R. E., E. Jimi, R. J. Phillips, D. F. Barber, M. Rincon, A. C. Hayday, R. A. Flavell, S. Ghosh. 2000. NF-{kappa}B activation by the pre-T cell receptor serves as a selective survival signal in T lymphocyte development. Immunity 13:677.[Medline]
  44. Newton, K., A. W. Harris, A. Strasser. 2000. FADD/MORT1 regulates the pre-TCR checkpoint and can function as a tumour suppressor. EMBO J. 19:931.[Medline]
  45. Ridgway, W. M., M. Fasso, A. Lanctot, C. Garvey, C. G. Fathman. 1996. Breaking self-tolerance in nonobese diabetic mice. J. Exp. Med. 183:1657.[Abstract/Free Full Text]
  46. Leiter, E.. 1998. NOD mice and related strains: origins, husbandry and biology introduction. E. Leiter, Jr, and M. Atkinson, Jr, eds. NOD Mice and Related Strains: Research Applications in Diabetes, AIDs, Cancer and Other Diseases 37. R. G. Landes, Austin.
  47. Harker, N., T. Naito, M. Cortes, A. Hostert, S. Hirschberg, M. Tolaini, K. Roderick, K. Georgopoulos, D. Kioussis. 2002. The CD8{alpha} gene locus is regulated by the Ikaros family of proteins. Mol. Cell 10:1403.[Medline]
  48. Schotte, R., M. C. Rissoan, N. Bendriss-Vermare, J. M. Bridon, T. Duhen, K. Weijer, F. Briere, H. Spits. 2003. The transcription factor Spi-B is expressed in plasmacytoid DC precursors and inhibits T-, B-, and NK-cell development. Blood 101:1015.[Abstract/Free Full Text]
  49. Bachmann, M. F., M. Barner, M. Kopf. 1999. CD2 sets quantitative thresholds in T cell activation. J. Exp. Med. 190:1383.[Abstract/Free Full Text]
  50. Sasada, T., E. L. Reinherz. 2001. A critical role for CD2 in both thymic selection events and mature T cell function. J. Immunol. 166:2394.[Abstract/Free Full Text]
  51. Serreze, D. V., E. H. Leiter, M. S. Hanson, S. W. Christianson, L. D. Shultz, R. M. Hesselton, D. L. Greiner. 1995. Emv30null NOD-scid mice: an improved host for adoptive transfer of autoimmune diabetes and growth of human lymphohematopoietic cells. Diabetes 44:1392.[Abstract]
  52. Engel, I., C. Murre. 2002. Disruption of pre-TCR expression accelerates lymphomagenesis in E2A-deficient mice. Proc. Natl. Acad. Sci. USA 99:11322.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page