|
|
||||||||






* Laboratory of Molecular Immunology, National Heart, Lung, and Blood Institute;
Autoimmunity Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases;
Surgery Branch, National Cancer Institute,
Laboratory of Immunopathology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892; and
¶ The Jackson Laboratory, Bar Harbor, ME 04609
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
-chain (1, 2, 3). Like IL-2, IL-4, IL-7, IL-9, and IL-15, IL-21 utilizes the common cytokine receptor
-chain (
c)6 (4) and signals in part through the activation of Jak1 and Jak3 as well as Stat1, Stat3, and Stat5 (1, 4). IL-21 is produced by activated CD4+ T cells and the IL-21R is expressed on T, B, and NK cells (1, 2). In vitro, IL-21 can act as a comitogen for anti-CD3-induced thymocyte and peripheral T cell proliferation (2), augment NK cell expansion and differentiation from human CD34+ cells when cultured with IL-15 and Flt-3 ligand (2), and can also activate NK cytolytic activity (2, 5). We previously demonstrated that IL-21 critically regulates Ig production (6). IL-21R/ mice have markedly diminished IgG1 but greatly elevated IgE levels in response to Ag and, correspondingly, IL-21 can inhibit Ag-induced IgE production (7). Mice lacking expression of both IL-21R and IL-4 exhibit a dysgammaglobulinemia with severely impaired IgG and IgE responses (6). In vitro, IL-21 can enhance the proliferative response of human and murine B cells stimulated with Abs to CD40, but it inhibits B cell proliferation in response to anti-IgM plus IL-4 (2) and correspondingly can augment B cell death (8). Using IL-21-transgenic (TG) mice and hydrodynamic injection of IL-21 plasmid-based methodologies, we demonstrate that IL-21 induces apoptosis in a subset of mature B cells but increases the number of immature and postswitch B cells. Moreover, IL-21 induces plasma cell differentiation. We show that IL-21 is an inducer of both Blimp-1 and Bcl-6 and, interestingly, a down-regulator of CD23. Finally, we show greatly elevated levels of IL-21 in the BXSB-Yaa mouse model of systemic lupus erythematosus (SLE). Thus, we establish new roles for IL-21 in B cell biology, with important implications for the basis of the development of autoimmunity. | Materials and Methods |
|---|
|
|
|---|
C57BL/6 mice were obtained from The Jackson Laboratory (Bar Harbor, ME). Splenic B cells were isolated using B220 or CD43 magnetic beads (Miltenyi Biotec, Auburn, CA) and were >95% pure as assessed by flow cytometry. B cells were plated in 96-well plates at 105 cells/well and treated as indicated with anti-CD40 (1 µg/ml; BD Pharmingen, San Diego, CA), anti-IgM (5 µg; Sigma-Aldrich, St. Louis, MO), murine IL-4 (200 U/ml), and murine IL-21 (50 ng/ml). For proliferation assays, cells were cultured for 2 days and pulsed with [3H]thymidine (1 µCi/well) for the last 18 h of culture.
Western blotting
Clarified whole cell lysates were subjected to SDS-PAGE and Western blotting with rabbit anti-Blimp1 (kind gift from Dr. M. Davis). Blots were developed with an ECL substrate (Amersham Biosciences, Piscataway, NJ).
Staining for apoptotic cells
Apoptosis was assessed using annexin V and 7-aminoactinomycin D (BD Pharmingen) and the TUNEL staining reagent (Roche Applied Science, Indianapolis, IN).
TG mice
Murine or human IL-21 cDNA constructs containing V5 and His tags were generated by PCR and inserted into pHSE, a plasmid in which the expressed cDNA is under the control of the H-2kb promoter and IgM enhancer (9, 10). TG mice were then generated by standard procedures.
In vivo transient expression of IL-21
The murine IL-21 cDNA was subcloned into the pORF expression vector (InvivoGen, San Diego, CA), and 20 µg of DNA in 2 ml of saline was injected i.v. into C57BL/6 mice within 5 s (hydrodynamics-based transfection) (11, 12). IL-21 delivered in this fashion results in a serum level of
6 ng/ml at day 1 that disappeared by day 8 (12). Mice injected with IL-21 or control mice injected with saline or pORF were analyzed at day 7.
Flow cytometric analysis of B cell populations
Cell populations were stained with the following Abs: FITC anti-CD21, CD23, IgG and IgM, PE anti-CD23 and IgD, allophycocyanin anti-B220 (BD Pharmingen). Staining with CD19, Syndecan-1, CD1d, AA4.1, IgG1(A85-1), and CD9 Abs was revealed with either PE- or Cy-conjugated streptavidin (BD Pharmingen). Bcl-2 staining was preceded by fixation with Cytofix/Cytoperm (BD Pharmingen). Data were collected using a FACSCalibur flow cytometer and analyzed using CellQuest software (BD Immunosystems, San Jose, CA). An Ab to CD16 (24G2;,BD Pharmingen) was used to block FcR binding. In addition, splenocytes were preincubated at 37°C for 2 h before staining to further minimize the possibility of cytophilic Ig retention on the cell surface.
Immunohistochemical staining of lymphoid follicles
Spleens were analyzed by either immunohistology or flow cytometry. Tissues were embedded in Tissue-Tek/OCT compound (Sakura, Zoeterwoude, The Netherlands), frozen in liquid nitrogen, serially sectioned, immediately fixed in ice-cold acetone for 5 min, and stained for 45 min in a humid chamber with either biotinylated mucosal addressin cell adhesion molecule 1 (MAdCAM-1; Southern Biotechnology Associates, Birmingham, AL), rat Ab supernatant specific for IgD (clone 1126C), or purified rat Ab specific for MCA1849 (MARCO; Serotec, Raleigh, NC). The sections were washed and bound Abs were revealed with either streptavidin-conjugated or goat anti-rat conjugated Oregon Green (Molecular Probes, Eugene, OR). IgM was detected with goat anti-mouse IgM-Texas Red (Southern Biotechnology Associates).
EMSAs
Nuclear extracts were prepared from splenic B cells that were cultured with anti-IgM with or without IL-21 for 24 h. Five micrograms was used for DNA binding reactions with either a Blimp-1 binding site (MHC2TA) from the class II MHC promoter (13) or with a Bcl-6 consensus binding site (14).
Real-time PCR
Blimp-1, Bcl-6, and Pax5 mRNA levels were quantitated relative to GAPDH mRNA levels by real-time PCR. RNA was reverse transcribed using an Omniscript kit (Qiagen, Valencia, CA) according to the manufacturers directions and PCR was performed using a Quantitect Probe Detection system (Qiagen) and the following oligonucleotides: Blimp-1 forward (FW), 5'-ACAGAGGCCGAGTTTGAAGAGA-3'; reverse (RV), 5'-AAGGATGCCTCGGCTTGAA-3'; TaqMan probe (TP), 5'-[6-FAM]CCCTGGGATTCCGGCGCTG[TAMRA-6-FAM]-3'; Pax5 FW, 5'-AAACGCAAGAGGGATGAAGGT-3'; RV, 5'-AACAGGTCTCCCCGCATCT-3'; TP, 5'-[6-FAM]CACTTCCGGGCCGGGACTTCC[TAMRA6-FAM]-3'; BCL-6 FW, 5'-TCAGAGTATTCGGATTCTAGCTGTGA-3'; RV, 5'-TGCAGCGTGTGCCTCTTG-3'; TP, 5'-[6-FAM]TGCAACGAATGTGACTGCCGTTTCTCT[TAMRA-6-FAM]-3'; GAPDH FW, 5'-TTCACCACCATGGAGAAGGC-3'; RV, 5'-GGCATGGACTGTGGTCATGA-3'; and TP, 5'-[6-FAM] TGCATCCTGCACCACCAACTGCTTAG[TAMRA-6-FAM]-3'.
Analysis of gene expression in BXSB-Yaa mouse spleens by quantitative ImmunoQuantArray real-time PCR
Total RNA was prepared from BXSB/MpJ-Yaa and BXSB.B6-Yaa+/Dcr spleens and cDNA synthesis from 510 µg of total RNA was conducted using the Retroscript kit (Ambion, Austin, TX). This ImmunoQuantArray consisted of 384 oligonucleotide primer pairs (15) designed to specifically amplify a customized set of target gene cDNAs. Primers for the genes discussed in the text are: IgG forward, 5'-CACCTCCCAAGGAGCAGATG-3'; reverse, 5'-CCCAGTTGCTCTTCTGCACAT-3'; IgG2b forward, 5'-CATCACCCATCGAGAGAACCA-3'; reverse, 5'-ACACTGATGTCTCCAGGGTTGA-3'; IgG3 forward, 5'-CAGCCAGCAAGACTGAGTTGAT-3'; reverse, 5'-GTCATCCTCGCTCACATCCA-3'; IL-21 forward, 5'-CCTGGAGTGGTATCATCGCTTT-3'; and reverse, 5'-TGATTGTGACACTTTTCTGGGAAT-3'.
Quantatitive expression analysis was performed essentially as described (15) using SYBR Green detection (Applied Biosystems, Foster City, CA). The global pattern recognition (GPR) algorithm (15) was used to identify significant changes in gene expression. A detailed description of the GPR software is available at http://www.jax.org/staff/roopenian/labsite/gene_expression.html). In this study, 208 of the 384 genes examined qualified as normalizers; fold changes are based on one of these, 18S RNA.
Analysis of serum IL-21, IgG1, and IgG3 levels
Serum levels of murine IL-21 were measured by sandwich ELISA using a rat capture mAb (149215.111) and biotinylated goat Ab (BAF594) specific for murine IL-21 (R&D Systems, Minneapolis, MN). IgG1 and IgG3 levels were measured using capture/detection Abs from BD Pharmingen.
| Results |
|---|
|
|
|---|
The proapoptotic effects of IL-21 on B cells in vitro (8) were surprising given that IL-21R expression is essential for normal Ig production in vivo (6). To help explain this apparent paradox, we generated IL-21 TG mice using a vector (9, 10) that drives expression in T, B, and NK cells. For unclear reasons, founder mice expressing murine IL-21 uniformly exhibited growth retardation and died before sexual maturity. We therefore generated TG mice expressing human IL-21, which can stimulate murine cells in vitro but which we hypothesized might bind to the murine IL-21R with lower affinity than murine IL-21. Four founders of the human IL-21 TG mice exhibited growth retardation and died before adulthood, but three viable lines were obtained (Fig. 1A). The line with the greatest IL-21 mRNA expression was lost, consistent with toxicity resulting from high expression of IL-21; therefore, we focused on the two lower expressing lines (#5 and #7).
|
90% of B cells are mature follicular or marginal zone (MZ) cells (16). Immature or newly formed B cells are produced in the bone marrow and migrate to the spleen as transitional T1 cells where they mature into transitional T2 cells. Only 13% of these cells differentiate into mature B cells (17, 18), which can develop into memory B cells and Ab-forming plasma cells after Ag stimulation (19, 20). Staining of splenocytes from the human IL-21 TG and wild-type (WT) mice with Abs to IgM, CD21, and CD23 suggested that mature B cells and transitional T2/MZ B cell populations were decreased, whereas transitional T1 cells appeared to be intact or increased in the IL-21 TG mice (Fig. 2A, ii vs i). However, we found that IL-21 potently decreases CD23 expression on mature B cells (Fig. 1B) and modestly diminishes expression of CD21 (data not shown), making CD21 and CD23 unreliable as phenotypic markers of B cell subsets, similar to what has been reported in BAFF-deficient mice (21).
|
Maintenance of basic follicular structure in the spleen
Because of the dramatic effect of IL-21 on the differentiation of B cell subpopulations, we examined the effect of IL-21 on the architecture of the splenic white pulp. Immunostaining with Abs to IgM, IgD, MAdCAM-1 (to define marginal sinus), and MARCO (to define MZ macrophages) showed that spleens from IL-21 TG mice had intact follicular and MZ structures (Fig. 3, DF vs AC). Follicles were also readily identified in spleens from IL-21-injected mice, although there was a loss of MZ B cells as revealed by the lack of a bright red ring of IgMhighIgDlow B cells around the IgMlowIgDhigh"green" follicles (Fig. 3, G vs A). Nevertheless, the marginal sinus and MZ macrophages, as defined by MAdCAM-1 (Fig. 3, H vs B) and MARCO (Fig. 3, I vs C) Abs, respectively, were still present in these mice, indicating a loss of B cells from this region rather than a loss of the MZ structure. The distributions of follicular dendritic cells as well as CD4+ and CD8+ T cells were normal in both IL-21-injected and TG mice (data not shown). Thus, chronic human IL-21 signaling in the TG mice did not affect the overall MZ structure, but led to an increase in the number of immature B cells and accumulation of Ig class-switched B cells. The IL-21-injected mice had similar changes in splenic B cell populations, except that the MZ B cells were not detected in the MZ (see loss of the "red" ring of cells in Fig. 3G vs its presence in 3A). We believe that these cells in fact are still present, based on CD1d and CD9 immunostaining (data not shown), but presumably have just migrated out of the MZ. This idea is supported by the retention of IgMhighIgDlowAA4.1low cells as evaluated by flow cytometry (Fig. 2D), which likely represents this MZ population of cells. The reason for the apparent redistribution of MZ cells is unclear, but importantly, both IL-21 TG and mice injected with IL-21 plasmid otherwise gave similar results.
|
|
The effects of IL-21 on B cells could either be direct or indirect. We analyzed the effect of IL-21 on purified splenic B cells cultured for 48 h in the presence of anti-IgM in combination with anti-CD40, IL-4, or both stimuli (Fig. 5A). IL-21 increased B cell proliferation induced by anti-IgM, especially in the presence of anti-CD40 (Fig. 5A). Although IL-21 inhibited proliferation induced by anti-IgM plus IL-4, proliferation increased when anti-CD40 was added as a further stimulus, and the combination of anti-IgM plus IL-4 plus anti-CD40 gave slightly more proliferation in the presence than in the absence of IL-21 (Fig. 5A). Thus, in the presence of certain signals, such as the combination of B cell receptor stimulation and anti-CD40, IL-21 induced the greatest proliferation, but in the absence of either B cell receptor or anti-CD40 stimulation, IL-21 induced much less proliferation (Fig. 5). Consistent with the effect of TG IL-21 on increasing Ab production (Fig. 4B), IL-21 induced expression of Syndecan-1 (CD138, a plasma cell marker) and surface IgG1 (Fig. 5, B and C, respectively; see ii vs i and iv vs iii) in B cells stimulated with anti-IgM with or without IL-4. Only a fraction of the surface IgG1+ cells expressed Syndecan-1 (Fig. 5D), indicating that IL-21 increased postswitch cells as well as plasma cells. For these experiments, we used culture conditions similar to those reported to allow apoptotic effects of IL-21 (8). Indeed, we independently demonstrated the apoptotic effects of IL-21 in combination with LPS, anti-IgM, or anti-CD40 (Fig. 6A). Interestingly, whereas this apoptosis is correlated with IL-21-mediated down-regulation of Bcl-2 mRNA levels (8), Bcl-2 cytoplasmic protein levels did not change in response to IL-21 (Fig. 6B), suggesting that other caspase-related mechanisms are more important (Ref. 8 and Fig. 6C), given the ability of IL-21 to induce cleavage of a caspase substrate (Fig. 6C). Thus, conditions that allow IL-21-mediated apoptosis also allow IL-21 to potently induce the maturation of stimulated B cells to postswitch cells and plasma cells in vitro and in vivo. Because we used purified B cells for the in vitro experiments, at least part of the effect of IL-21 on B cell differentiation is a direct effect.
|
|
To elucidate the mechanism of the effect of IL-21 on B cell maturation and plasma cell differentiation, we examined the effects of IL-21 on B cell differentiation factors Blimp-1, Bcl-6, and Pax5. Blimp-1 is a transcription factor that has been identified as a master regulator of plasma cell differentiation (23), whereas Bcl-6 and Pax5 are required for germinal center formation (20). Interestingly, Blimp-1 and Bcl-6 can each inhibit expression of the other protein, and Blimp-1 additionally is an inhibitor of the expression of Pax5 (20, 24). We examined expression of these proteins in BCL1 3B3 cells, a B cell lymphoma cell line in which treatment with IL-2 and IL-5 can induce differentiation into Ig-secreting cells (25). In these cells, IL-21 induced expression of Syndecan-1 (Fig. 7Ai), whereas it decreased expression of MHC class II (Fig. 7Aii), consistent with plasma cell differentiation (13, 23). Analogous to the effect of IL-21 on CD23 expression in splenic B cells (Fig. 1B), IL-21 also decreased CD23 expression in BCL-1 cells (Fig. 7Aiii). Moreover, based on real-time PCR analysis, IL-21 induced expression of mRNA for both Blimp-1 and Bcl-6, whereas it inhibited expression of Pax5 mRNA (Fig. 7B, i, ii, and iii, respectively). The induction of Blimp-1 was at least as potent as that seen with the combination of IL-2 and IL-5, the "classical" stimulus for Blimp-1 in these cells (25); as expected, the combination of IL-2 and IL-5 inhibited expression of Bcl-6. The induction of both Blimp-1 and Bcl-6 by IL-21 was confirmed in purified splenic B cells. Induction was not seen in cells treated with anti-IgM alone, but the addition of IL-21 induced Blimp-1 protein expression as confirmed by Western blotting (Fig. 7C) and Blimp-1- and Bcl-6 DNA-binding activities, as evaluated by EMSAs (Fig. 7, D and E).
|
Given the ability of IL-21 to promote plasma cell differentiation, we speculated that this cytokine might contribute to humoral autoimmune processes. We therefore examined the BXSB-Yaa mouse model, which is characterized by severe SLE, with lymphadenopathy, splenomegaly, leukocytosis, hypergammaglobulinemia, and severe immune complex-mediated glomerulonephritis, often with a nephrotic syndrome (26). Although the basis for the disease is unknown, severe SLE is dependent on the mutant Y chromosome-linked autoimmune accelerator Yaa locus. In contrast, mice carrying a C57BL/6 (B6)-derived WT Yaa allele exhibit a slowly developing chronic form of SLE (26). The mechanism mediating the action of the Yaa locus has been unclear.
Examination of splenocytes for expression of multiple genes revealed a striking age-dependent increase in Il21 mRNA levels in BXSB-Yaa mice, compared with BXSB-Yaa+ WT male mice (Fig. 8A; see also legend to Fig. 8). Interestingly, the expression of the genes encoding IL-7 and IL-15, two other
c-dependent cytokines, did not differ significantly in BXSB-Yaa and BXSB-Yaa+ WT mice (Fig. 8A). Like Il21, Il10 mRNA levels were also elevated in the BXSB-Yaa mouse (Fig. 8A). Corresponding to the increase in IL-21 mRNA, IgG1, IgG2b, and IgG3 mRNA levels were significantly elevated in BXSB-Yaa mice (Fig. 8A), as were serum levels of IL-21, IgG1, and IgG3 (Fig. 8, BD). Thus, in addition to elevated Ig levels, among cytokines examined, we found a substantial increase in IL-21 in this model of SLE, suggesting that elevated levels of this cytokine may be involved in the pathogenesis of this disease.
|
| Discussion |
|---|
|
|
|---|
c family cytokines are typically antiapoptotic. In the context of Ag activation, IL-2 can promote T cell death via a process known as activation-induced cell death (27). However, IL-21 is different in that it is proapoptotic for B and NK cells instead of T cells (Ref. 8 and our unpublished data), and whereas activation-induced cell death requires a prior activation signal, IL-21-induced apoptosis does not. In addition to apoptotic effects on mature B cells, we show that IL-21 can induce the accumulation of transitional B cells in the periphery. This could reflect physiological compensation for the IL-21-mediated reduction in peripheral mature B cells, the ability of IL-21 to increase maturation and/or survival of immature B cells from the bone marrow, and/or an ability of IL-21 to interfere with signals that promote differentiation from transitional to mature B cells. IL-21 TG mice exhibited elevated serum IgM and IgG1 and had increased surface IgG1+ B cells in the spleen, suggesting that IL-21 could promote Ig isotype switching in vivo. A recent report demonstrates the ability of human IL-21 to promote isotype switching in CD40-activated human B cells (28). However, our data demonstrate that IL-21 can induce isotype switching and plasma cell differentiation in naive B cells before an encounter with secondary T cell signals, suggesting a role for IL-21 in early B cell responses to Ag. Strikingly, IL-21 down-regulated CD23 expression on mature B cells and promoted differentiation to Ig-secreting plasma cells both in vivo and in vitro. This contrasts to IL-4, which inhibits plasma cell differentiation (29) and induces CD23 expression on mature B cells (30). The ability of IL-21 to increase Ig-secreting cells clarifies why IgG1 Ab-forming cells are greatly decreased in Il21r knockout (KO) mice and why all Ig classes are diminished in Il21r/Il4 double KO mice (6). Interestingly, the accumulation of surface IgG1+ cells in response to IL-21 was reduced in the presence of IL-4, whereas the induction of Syndecan-1+ cells was not altered. Thus, some but not all of the effects of IL-21 on the B cell immune response can be modulated by IL-4, consistent with our finding in Il21r KO vs Il21r/Il4 double KO mice (6). The observation that IL-21 has antiapoptotic effects on some myeloma cell lines (31) is consistent with our observations that IL-21 is an inducing factor for plasma cells.
In summary, we have now elucidated some of the complex actions of IL-21 in the B cell immune response. IL-21 confers an apoptotic signal either on naive B cells or, alternatively, when bystander B cells are stimulated in an Ag-nonspecific manner by activated T cells via CD40 signaling (Ref. 8 and our unpublished observations). Following the initiation of a B cell immune response, this apoptotic signal of IL-21 might help to eliminate "bystander" B cells responsible for the nonspecific hypergammaglobulinemia that is initially observed. However, in B cells activated by B cell receptor signaling, our results indicate that IL-21 can enhance Ig production, isotype switching, and plasma cell production. We hypothesize that the effect of IL-21 on plasma cell differentiation results from its ability to increase Blimp-1 expression, whereas the induction of Bcl-6 may be important for subsequent differentiation of germinal center cells into postswitch cells. The IL-21-mediated down-regulation of Pax5 may bias responses toward plasma cell differentiation, as Pax5 is known to inhibit plasma cell differentiation but is thought to be required for memory cell maturation (20). Interestingly, IL-21 induced both Blimp-1 and Bcl-6, which exert mutually antagonistic effects (20, 24). Moreover, we demonstrate an increase in IL-21-mediated DNA-binding activity for both of these proteins, whereas no other known stimulus has been shown previously to activate the binding activity of both of these critical transcription factors. Such unprecedented actions help to explain how IL-21 can drive differentiation of B cells both into postswitch cells as well as to plasma cells. This may be another indication of the overall potency of IL-21 in stimulating multiple aspects of the differentiation of B cells, with its potentially having differential effects in a context-regulated manner.
Finally, although the genetic mutation and molecular basis for autoimmunity in the BXSB-Yaa mouse remains unknown, the possibility that elevated IL-21 accounts for the hypergammaglobulinemia and class switching to IgG isotypes characteristic of BXSB-Yaa mice is intriguing. This is consistent with the fact that the SLE-like autoimmune disease in these animals is dependent on CD4+ T cells (32), the major source of IL-21 (1, 2). It is of interest that increased expression of IL-21 mRNA has been detected in autoimmune NOD mice (33). Overall, our data support critical roles for IL-21 in apoptosis, B cell differentiation, and plasma cell generation and suggest that this cytokine may be critically involved in the pathogenesis of autoimmune disease.
| Acknowledgments |
|---|
| Footnotes |
|---|
1 D.C.R. was supported in part by the Alliance for Lupus Research and National Institutes of Health Grant DK56597. ![]()
2 K.O. and R.S. contributed equally to this study. ![]()
3 Current address: Institute of Medical Science, University of Tokyo, Tokyo, Japan. ![]()
4 Current address: Anderson Cancer Center, Houston, TX. ![]()
5 Address correspondence and reprint requests to Warren J. Leonard, Laboratory of Molecular Immunology, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD 20892-1674. E-mail address: wjl{at}helix.nih.gov ![]()
6 Abbreviations used in this paper:
c, common
-chain; TG, transgenic; MAdCAM-1, mucosal addressin cell adhesion molecule 1; FW, forward; RV, reverse; TP, TaqMan probe; GPR, global pattern recognition; MZ, marginal zone; WT, wild type; SLE, systemic lupus erythematosus; KO, knockout. ![]()
Received for publication May 5, 2004. Accepted for publication July 16, 2004.
| References |
|---|
|
|
|---|
chain. Proc. Natl. Acad. Sci. USA 97:11439.
-chain is an indispensable subunit of the IL-21 receptor complex. J. Immunol. 167:1.
transcription of IL-4-stimulated B cells. Blood 100:4565.
8.1 chain transgenic mice. EMBO J. 8:719.[Medline]
This article has been cited by other articles:
![]() |
R. Spolski, M. Kashyap, C. Robinson, Z. Yu, and W. J. Leonard IL-21 signaling is critical for the development of type I diabetes in the NOD mouse PNAS, September 16, 2008; 105(37): 14028 - 14033. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. J. Leonard, R. Zeng, and R. Spolski Interleukin 21: a cytokine/cytokine receptor system that has come of age J. Leukoc. Biol., August 1, 2008; 84(2): 348 - 356. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ferrari-Lacraz, R. Chicheportiche, G. Schneiter, N. Molnarfi, J. Villard, and J.-M. Dayer IL-21 promotes survival and maintains a naive phenotype in human CD4+ T lymphocytes Int. Immunol., August 1, 2008; 20(8): 1009 - 1018. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nie, M. Gomez, P. Landgraf, J.-F. Garcia, Y. Liu, L. H.C. Tan, A. Chadburn, T. Tuschl, D. M. Knowles, and W. Tam MicroRNA-Mediated Down-Regulation of PRDM1/Blimp-1 in Hodgkin/Reed-Sternberg Cells: A Potential Pathogenetic Lesion in Hodgkin Lymphomas Am. J. Pathol., July 1, 2008; 173(1): 242 - 252. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Iuchi, S. Teitz-Tennenbaum, J. Huang, B. G. Redman, S. D. Hughes, M. Li, G. Jiang, A. E. Chang, and Q. Li Interleukin-21 Augments the Efficacy of T-Cell Therapy by Eliciting Concurrent Cellular and Humoral Responses Cancer Res., June 1, 2008; 68(11): 4431 - 4441. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Hinrichs, R. Spolski, C. M. Paulos, L. Gattinoni, K. W. Kerstann, D. C. Palmer, C. A. Klebanoff, S. A. Rosenberg, W. J. Leonard, and N. P. Restifo IL-2 and IL-21 confer opposing differentiation programs to CD8+ T cells for adoptive immunotherapy Blood, June 1, 2008; 111(11): 5326 - 5333. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Diehl, H. Schmidlin, M. Nagasawa, S. D. van Haren, M. J. Kwakkenbos, E. Yasuda, T. Beaumont, F. A. Scheeren, and H. Spits STAT3-Mediated Up-Regulation of BLIMP1 Is Coordinated with BCL6 Down-Regulation to Control Human Plasma Cell Differentiation J. Immunol., April 1, 2008; 180(7): 4805 - 4815. [Abstract] [Full Text] [PDF] |
||||
![]() |
A H Sawalha, K M Kaufman, J A Kelly, A J Adler, T Aberle, J Kilpatrick, E K Wakeland, Q-Z Li, A E Wandstrat, D R Karp, et al. Genetic association of interleukin-21 polymorphisms with systemic lupus erythematosus Ann Rheum Dis, April 1, 2008; 67(4): 458 - 461. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-K. Shirakawa, D. Nagakubo, K. Hieshima, T. Nakayama, Z. Jin, and O. Yoshie 1,25-Dihydroxyvitamin D3 Induces CCR10 Expression in Terminally Differentiating Human B Cells J. Immunol., March 1, 2008; 180(5): 2786 - 2795. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. L. Bryant, C. S. Ma, D. T. Avery, Y. Li, K. L. Good, L. M. Corcoran, R. de Waal Malefyt, and S. G. Tangye Cytokine-Mediated Regulation of Human B Cell Differentiation into Ig-Secreting Cells: Predominant Role of IL-21 Produced by CXCR5+ T Follicular Helper Cells J. Immunol., December 15, 2007; 179(12): 8180 - 8190. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kishida, Y. Hiromura, M. Shin-Ya, H. Asada, H. Kuriyama, M. Sugai, A. Shimizu, Y. Yokota, T. Hama, J. Imanishi, et al. IL-21 Induces Inhibitor of Differentiation 2 and Leads to Complete Abrogation of Anaphylaxis in Mice J. Immunol., December 15, 2007; 179(12): 8554 - 8561. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. D. Davis, K. Skak, M. J. Smyth, P. E.G. Kristjansen, D. M. Miller, and P. V. Sivakumar Interleukin-21 Signaling: Functions in Cancer and Autoimmunity Clin. Cancer Res., December 1, 2007; 13(23): 6926 - 6932. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Hiromura, T. Kishida, H. Nakano, T. Hama, J. Imanishi, Y. Hisa, and O. Mazda IL-21 Administration into the Nostril Alleviates Murine Allergic Rhinitis J. Immunol., November 15, 2007; 179(10): 7157 - 7165. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kuchen, R. Robbins, G. P. Sims, C. Sheng, T. M. Phillips, P. E. Lipsky, and R. Ettinger Essential Role of IL-21 in B Cell Activation, Expansion, and Plasma Cell Generation during CD4+ T Cell-B Cell Collaboration J. Immunol., November 1, 2007; 179(9): 5886 - 5896. [Abstract] [Full Text] [PDF] |
||||