The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ozaki, K.
Right arrow Articles by Leonard, W. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ozaki, K.
Right arrow Articles by Leonard, W. J.
The Journal of Immunology, 2004, 173: 5361-5371.
Copyright © 2004 by The American Association of Immunologists

Regulation of B Cell Differentiation and Plasma Cell Generation by IL-21, a Novel Inducer of Blimp-1 and Bcl-61

Katsutoshi Ozaki2,3,*, Rosanne Spolski2,*, Rachel Ettinger{dagger}, Hyoung-Pyo Kim*, Gang Wang4,{ddagger}, Chen-Feng Qi§, Patrick Hwu4,{ddagger}, Daniel J. Shaffer, Shreeram Akilesh, Derry C. Roopenian, Herbert C. Morse, III§, Peter E. Lipsky{dagger} and Warren J. Leonard5,*

* Laboratory of Molecular Immunology, National Heart, Lung, and Blood Institute; {dagger} Autoimmunity Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases; {ddagger} Surgery Branch, National Cancer Institute, § Laboratory of Immunopathology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892; and The Jackson Laboratory, Bar Harbor, ME 04609


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-21 is a type I cytokine whose receptor is expressed on T, B, and NK cells. Within the B cell lineage, IL-21 regulates IgG1 production and cooperates with IL-4 for the production of multiple Ab classes in vivo. Using IL-21-transgenic mice and hydrodynamics-based gene delivery of IL-21 plasmid DNA into wild-type mice as well as in vitro studies, we demonstrate that although IL-21 induces death of resting B cells, it promotes differentiation of B cells into postswitch and plasma cells. Thus, IL-21 differentially influences B cell fate depending on the signaling context, explaining how IL-21 can be proapoptotic for B cells in vitro yet critical for Ag-specific Ig production in vivo. Moreover, we demonstrate that IL-21 unexpectedly induces expression of both Blimp-1 and Bcl-6, indicating mechanisms as to how IL-21 can serve as a complex regulator of B cell maturation and terminal differentiation. Finally, BXSB-Yaa mice, which develop a systemic lupus erythematosus-like disease, have greatly elevated IL-21, suggesting a role for IL-21 in the development of autoimmune disease.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Interleukin 21 is a type I cytokine whose receptor is most closely related to the IL-2R {beta}-chain (1, 2, 3). Like IL-2, IL-4, IL-7, IL-9, and IL-15, IL-21 utilizes the common cytokine receptor {gamma}-chain ({gamma}c)6 (4) and signals in part through the activation of Jak1 and Jak3 as well as Stat1, Stat3, and Stat5 (1, 4). IL-21 is produced by activated CD4+ T cells and the IL-21R is expressed on T, B, and NK cells (1, 2). In vitro, IL-21 can act as a comitogen for anti-CD3-induced thymocyte and peripheral T cell proliferation (2), augment NK cell expansion and differentiation from human CD34+ cells when cultured with IL-15 and Flt-3 ligand (2), and can also activate NK cytolytic activity (2, 5). We previously demonstrated that IL-21 critically regulates Ig production (6). IL-21R–/– mice have markedly diminished IgG1 but greatly elevated IgE levels in response to Ag and, correspondingly, IL-21 can inhibit Ag-induced IgE production (7). Mice lacking expression of both IL-21R and IL-4 exhibit a dysgammaglobulinemia with severely impaired IgG and IgE responses (6). In vitro, IL-21 can enhance the proliferative response of human and murine B cells stimulated with Abs to CD40, but it inhibits B cell proliferation in response to anti-IgM plus IL-4 (2) and correspondingly can augment B cell death (8). Using IL-21-transgenic (TG) mice and hydrodynamic injection of IL-21 plasmid-based methodologies, we demonstrate that IL-21 induces apoptosis in a subset of mature B cells but increases the number of immature and postswitch B cells. Moreover, IL-21 induces plasma cell differentiation. We show that IL-21 is an inducer of both Blimp-1 and Bcl-6 and, interestingly, a down-regulator of CD23. Finally, we show greatly elevated levels of IL-21 in the BXSB-Yaa mouse model of systemic lupus erythematosus (SLE). Thus, we establish new roles for IL-21 in B cell biology, with important implications for the basis of the development of autoimmunity.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Splenic B cell preparation and proliferation assays

C57BL/6 mice were obtained from The Jackson Laboratory (Bar Harbor, ME). Splenic B cells were isolated using B220 or CD43 magnetic beads (Miltenyi Biotec, Auburn, CA) and were >95% pure as assessed by flow cytometry. B cells were plated in 96-well plates at 105 cells/well and treated as indicated with anti-CD40 (1 µg/ml; BD Pharmingen, San Diego, CA), anti-IgM (5 µg; Sigma-Aldrich, St. Louis, MO), murine IL-4 (200 U/ml), and murine IL-21 (50 ng/ml). For proliferation assays, cells were cultured for 2 days and pulsed with [3H]thymidine (1 µCi/well) for the last 18 h of culture.

Western blotting

Clarified whole cell lysates were subjected to SDS-PAGE and Western blotting with rabbit anti-Blimp1 (kind gift from Dr. M. Davis). Blots were developed with an ECL substrate (Amersham Biosciences, Piscataway, NJ).

Staining for apoptotic cells

Apoptosis was assessed using annexin V and 7-aminoactinomycin D (BD Pharmingen) and the TUNEL staining reagent (Roche Applied Science, Indianapolis, IN).

TG mice

Murine or human IL-21 cDNA constructs containing V5 and His tags were generated by PCR and inserted into pHSE, a plasmid in which the expressed cDNA is under the control of the H-2kb promoter and IgM enhancer (9, 10). TG mice were then generated by standard procedures.

In vivo transient expression of IL-21

The murine IL-21 cDNA was subcloned into the pORF expression vector (InvivoGen, San Diego, CA), and 20 µg of DNA in 2 ml of saline was injected i.v. into C57BL/6 mice within 5 s (hydrodynamics-based transfection) (11, 12). IL-21 delivered in this fashion results in a serum level of ~6 ng/ml at day 1 that disappeared by day 8 (12). Mice injected with IL-21 or control mice injected with saline or pORF were analyzed at day 7.

Flow cytometric analysis of B cell populations

Cell populations were stained with the following Abs: FITC anti-CD21, CD23, IgG and IgM, PE anti-CD23 and IgD, allophycocyanin anti-B220 (BD Pharmingen). Staining with CD19, Syndecan-1, CD1d, AA4.1, IgG1(A85-1), and CD9 Abs was revealed with either PE- or Cy-conjugated streptavidin (BD Pharmingen). Bcl-2 staining was preceded by fixation with Cytofix/Cytoperm (BD Pharmingen). Data were collected using a FACSCalibur flow cytometer and analyzed using CellQuest software (BD Immunosystems, San Jose, CA). An Ab to CD16 (24G2;,BD Pharmingen) was used to block FcR binding. In addition, splenocytes were preincubated at 37°C for 2 h before staining to further minimize the possibility of cytophilic Ig retention on the cell surface.

Immunohistochemical staining of lymphoid follicles

Spleens were analyzed by either immunohistology or flow cytometry. Tissues were embedded in Tissue-Tek/OCT compound (Sakura, Zoeterwoude, The Netherlands), frozen in liquid nitrogen, serially sectioned, immediately fixed in ice-cold acetone for 5 min, and stained for 45 min in a humid chamber with either biotinylated mucosal addressin cell adhesion molecule 1 (MAdCAM-1; Southern Biotechnology Associates, Birmingham, AL), rat Ab supernatant specific for IgD (clone 1126C), or purified rat Ab specific for MCA1849 (MARCO; Serotec, Raleigh, NC). The sections were washed and bound Abs were revealed with either streptavidin-conjugated or goat anti-rat conjugated Oregon Green (Molecular Probes, Eugene, OR). IgM was detected with goat anti-mouse IgM-Texas Red (Southern Biotechnology Associates).

EMSAs

Nuclear extracts were prepared from splenic B cells that were cultured with anti-IgM with or without IL-21 for 24 h. Five micrograms was used for DNA binding reactions with either a Blimp-1 binding site (MHC2TA) from the class II MHC promoter (13) or with a Bcl-6 consensus binding site (14).

Real-time PCR

Blimp-1, Bcl-6, and Pax5 mRNA levels were quantitated relative to GAPDH mRNA levels by real-time PCR. RNA was reverse transcribed using an Omniscript kit (Qiagen, Valencia, CA) according to the manufacturer’s directions and PCR was performed using a Quantitect Probe Detection system (Qiagen) and the following oligonucleotides: Blimp-1 forward (FW), 5'-ACAGAGGCCGAGTTTGAAGAGA-3'; reverse (RV), 5'-AAGGATGCCTCGGCTTGAA-3'; TaqMan probe (TP), 5'-[6-FAM]CCCTGGGATTCCGGCGCTG[TAMRA-6-FAM]-3'; Pax5 FW, 5'-AAACGCAAGAGGGATGAAGGT-3'; RV, 5'-AACAGGTCTCCCCGCATCT-3'; TP, 5'-[6-FAM]CACTTCCGGGCCGGGACTTCC[TAMRA6-FAM]-3'; BCL-6 FW, 5'-TCAGAGTATTCGGATTCTAGCTGTGA-3'; RV, 5'-TGCAGCGTGTGCCTCTTG-3'; TP, 5'-[6-FAM]TGCAACGAATGTGACTGCCGTTTCTCT[TAMRA-6-FAM]-3'; GAPDH FW, 5'-TTCACCACCATGGAGAAGGC-3'; RV, 5'-GGCATGGACTGTGGTCATGA-3'; and TP, 5'-[6-FAM] TGCATCCTGCACCACCAACTGCTTAG[TAMRA-6-FAM]-3'.

Analysis of gene expression in BXSB-Yaa mouse spleens by quantitative ImmunoQuantArray real-time PCR

Total RNA was prepared from BXSB/MpJ-Yaa and BXSB.B6-Yaa+/Dcr spleens and cDNA synthesis from 5–10 µg of total RNA was conducted using the Retroscript kit (Ambion, Austin, TX). This ImmunoQuantArray consisted of 384 oligonucleotide primer pairs (15) designed to specifically amplify a customized set of target gene cDNAs. Primers for the genes discussed in the text are: IgG forward, 5'-CACCTCCCAAGGAGCAGATG-3'; reverse, 5'-CCCAGTTGCTCTTCTGCACAT-3'; IgG2b forward, 5'-CATCACCCATCGAGAGAACCA-3'; reverse, 5'-ACACTGATGTCTCCAGGGTTGA-3'; IgG3 forward, 5'-CAGCCAGCAAGACTGAGTTGAT-3'; reverse, 5'-GTCATCCTCGCTCACATCCA-3'; IL-21 forward, 5'-CCTGGAGTGGTATCATCGCTTT-3'; and reverse, 5'-TGATTGTGACACTTTTCTGGGAAT-3'.

Quantatitive expression analysis was performed essentially as described (15) using SYBR Green detection (Applied Biosystems, Foster City, CA). The global pattern recognition (GPR) algorithm (15) was used to identify significant changes in gene expression. A detailed description of the GPR software is available at http://www.jax.org/staff/roopenian/labsite/gene_expression.html). In this study, 208 of the 384 genes examined qualified as normalizers; fold changes are based on one of these, 18S RNA.

Analysis of serum IL-21, IgG1, and IgG3 levels

Serum levels of murine IL-21 were measured by sandwich ELISA using a rat capture mAb (149215.111) and biotinylated goat Ab (BAF594) specific for murine IL-21 (R&D Systems, Minneapolis, MN). IgG1 and IgG3 levels were measured using capture/detection Abs from BD Pharmingen.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-21 increases immature B cell numbers and drives B cells to differentiate into postswitch cells

The proapoptotic effects of IL-21 on B cells in vitro (8) were surprising given that IL-21R expression is essential for normal Ig production in vivo (6). To help explain this apparent paradox, we generated IL-21 TG mice using a vector (9, 10) that drives expression in T, B, and NK cells. For unclear reasons, founder mice expressing murine IL-21 uniformly exhibited growth retardation and died before sexual maturity. We therefore generated TG mice expressing human IL-21, which can stimulate murine cells in vitro but which we hypothesized might bind to the murine IL-21R with lower affinity than murine IL-21. Four founders of the human IL-21 TG mice exhibited growth retardation and died before adulthood, but three viable lines were obtained (Fig. 1A). The line with the greatest IL-21 mRNA expression was lost, consistent with toxicity resulting from high expression of IL-21; therefore, we focused on the two lower expressing lines (#5 and #7).



View larger version (53K):
[in this window]
[in a new window]
 
FIGURE 1. IL-21 increases immature and postswitch B cells. A, Expression of IL-21 mRNA in IL-21 TG mice. Total RNA (10 µg) from bone marrow or spleen from WT or IL-21 TG mice was Northern blotted with human IL-21 cDNA (upper panel) or control pHe7 (lower panel) probes. The levels of IL-21 protein being produced in these animals could not be determined, as in contrast to our ability to perform ELISAs for murine IL-21 (12 ), we do not have mAbs for human IL-21 appropriate for ELISAs. B, CD23 expression is decreased by IL-21 but increased by IL-4. Purified B cells treated with LPS or anti-CD40 were additionally stimulated with medium, IL-4, or IL-21 for 10 h and then CD23 expression on viable cells was determined by flow cytometry. Shown are mean fluorescent intensities. C, Flow cytometric analysis of B cell populations. AA4.1/B220 staining of splenocytes from WT or TG mice (i and ii) is shown. D, IgM/IgD profiles are shown for AA4.1highB220+ (i and ii) and AA4.1lowB220+ (iii and iv) splenocytes. E, Cellularity in WT vs IL-21 TG mice. Shown are total cell number ± SD (from >10 animals) for splenocytes and total B cells (defined by B220) as well as AA4.1high immature and AA4.1low mature B cell subpopulations. F, B220+IgMIgD splenocytes from WT and IL-21 TG mice were analyzed for CD19, surface IgG, and Syndecan-1 staining. Shown is the absolute number of cells per mouse x 10–6. G, B220+CD19 and B220+CD19+ splenocytes from WT and IL-21 TG mice were analyzed for surface IgG. H, Summary of numbers of IgMIgD, CD19+, CD19, Syndecan-1+, and IgG+ cells from WT and IL-21 TG mice. *, p < 0.01 for TG mice compared with WT in E and H.

 
In normal mouse spleen, ~90% of B cells are mature follicular or marginal zone (MZ) cells (16). Immature or newly formed B cells are produced in the bone marrow and migrate to the spleen as transitional T1 cells where they mature into transitional T2 cells. Only 1–3% of these cells differentiate into mature B cells (17, 18), which can develop into memory B cells and Ab-forming plasma cells after Ag stimulation (19, 20). Staining of splenocytes from the human IL-21 TG and wild-type (WT) mice with Abs to IgM, CD21, and CD23 suggested that mature B cells and transitional T2/MZ B cell populations were decreased, whereas transitional T1 cells appeared to be intact or increased in the IL-21 TG mice (Fig. 2A, ii vs i). However, we found that IL-21 potently decreases CD23 expression on mature B cells (Fig. 1B) and modestly diminishes expression of CD21 (data not shown), making CD21 and CD23 unreliable as phenotypic markers of B cell subsets, similar to what has been reported in BAFF-deficient mice (21).



View larger version (56K):
[in this window]
[in a new window]
 
FIGURE 2. Analysis of IL-21 TG or WT mice injected with a murine IL-21 plasmid by hydrodynamic transfection. A and B, Lower apparent numbers of mature (M), follicular (FO), and MZ B cells in IL-21 TG mice (A) or IL-21-injected mice (B) than in control mice based on CD21/CD23 and IgM/CD21 splenic expression patterns. T1, transitional B cell 1; T2, transitional B cell 2; NF, newly formed B cells. Injected mice were analyzed at day 7. C, Increased AA4.1+ B cells in IL-21 plasmid-injected as compared with pORF-injected mice. Staining was with AA4.1 vs B220. D, Shown are IgD vs IgM profiles of either AA4.1high/B220+ (i and ii) or AA4.1low/B220+ (iii and iv) splenocytes. i and iii, Mice were injected with pORF, whereas in ii and iv, mice were injected with the murine IL-21 plasmid. E, Cellularity in control vs IL-21 plasmid-injected mice. Shown are total cell numbers ± SD (from >10 animals) for splenocytes and total B cells (defined by B220) as well as AA4.1high immature and AA4.1low mature B cell subpopulations.

 
We therefore stained cells with AA4.1 mAb, which binds to a protein expressed on immature B cells (22), as well as with IgM and IgD which are not affected by IL-21 (data not shown), to characterize B cell populations. Consistent with an increase in immature B cells, AA4.1high cells were increased in both IL-21 TG (Fig. 1C, ii vs i) and IL-21-injected mice (Fig. 2C, ii vs i), although the IgM/IgD staining pattern revealed no significant differences in the T1:T2 B cell ratio (Figs. 1D and 2D). The percentage of IgDlowIgMhighAA4.1low MZ cells in either the IL-21 TG or IL-21-injected mice (Figs. 1 and 2D, iv vs iii, lower right quadrants) were similar to those found in control WT mice. B1 B cell numbers were also similar in both the spleens and peritoneal cavities of WT and IL-21 TG mice based on CD5 and CD43 staining (data not shown). The AA4.1low mature splenic B cell population exhibited a decrease in the percentage of the most mature follicular B cell subset (IgDhighIgMlow; Fig. 1D, iv vs iii, upper left quadrant). However, the absolute number of mature cells (B220+AA4.1low) was not altered in either the IL-21 TG (Fig. 1E) or the IL-21-injected mice (Fig. 2E). Interestingly, in both IL-21 TG mice and IL-21-injected mice (Figs. 1D and 2D, iv vs iii, left lower quadrants), there was a dramatic increase in the IgDIgM population of AA4.1low splenocytes. This population was further characterized and was found to contain a significantly increased percentage of B220+CD19 cells (Fig. 1F, ii vs i). In addition, the percentage and absolute number of cells in this population which express either IgG or Syndecan-1 were markedly increased in IL-21 TG mice (Fig. 1F, iv and vi vs ii and v; the numbers indicate the absolute number of cells x 10–6/mouse), with IgG expression being increased on both B220+CD19 and B220+CD19+ cells (Fig. 1G). Overall, based on the AA4.1 and IgM/IgD staining, IL-21 increased the total number of splenocytes and total B cells, with a marked increase in the number of immature AA4.1high B cells (summarized in Figs. 1E and 2E for IL-21 TG and IL-21 plasmid-injected mice, respectively). The total number of mature B cells (including postswitch cells; together defined as AA4.1low cells), was normal (Figs. 1E and 2E). However, of these cells, the percentage of mature B cells was slightly diminished based on the decrease in IgDhigh cells in Figs. 1D and 2D (iv vs iii, upper left quadrants), whereas IgDIgM postswitch B cells were increased (Figs. 1D and 2D, iv vs iii, lower left quadrants). Thus, IL-21 stimulation increases the number of immature B cells in the periphery and drives B cell differentiation into postswitch cells. The total numbers of IgMIgD, CD19+, CD19, Syndecan-1+, and IgG+ cells in WT and IL-21 TG mice are summarized in Fig. 1H.

Maintenance of basic follicular structure in the spleen

Because of the dramatic effect of IL-21 on the differentiation of B cell subpopulations, we examined the effect of IL-21 on the architecture of the splenic white pulp. Immunostaining with Abs to IgM, IgD, MAdCAM-1 (to define marginal sinus), and MARCO (to define MZ macrophages) showed that spleens from IL-21 TG mice had intact follicular and MZ structures (Fig. 3, D–F vs A–C). Follicles were also readily identified in spleens from IL-21-injected mice, although there was a loss of MZ B cells as revealed by the lack of a bright red ring of IgMhighIgDlow B cells around the IgMlowIgDhigh"green" follicles (Fig. 3, G vs A). Nevertheless, the marginal sinus and MZ macrophages, as defined by MAdCAM-1 (Fig. 3, H vs B) and MARCO (Fig. 3, I vs C) Abs, respectively, were still present in these mice, indicating a loss of B cells from this region rather than a loss of the MZ structure. The distributions of follicular dendritic cells as well as CD4+ and CD8+ T cells were normal in both IL-21-injected and TG mice (data not shown). Thus, chronic human IL-21 signaling in the TG mice did not affect the overall MZ structure, but led to an increase in the number of immature B cells and accumulation of Ig class-switched B cells. The IL-21-injected mice had similar changes in splenic B cell populations, except that the MZ B cells were not detected in the MZ (see loss of the "red" ring of cells in Fig. 3G vs its presence in 3A). We believe that these cells in fact are still present, based on CD1d and CD9 immunostaining (data not shown), but presumably have just migrated out of the MZ. This idea is supported by the retention of IgMhighIgDlowAA4.1low cells as evaluated by flow cytometry (Fig. 2D), which likely represents this MZ population of cells. The reason for the apparent redistribution of MZ cells is unclear, but importantly, both IL-21 TG and mice injected with IL-21 plasmid otherwise gave similar results.



View larger version (112K):
[in this window]
[in a new window]
 
FIGURE 3. Basic splenic follicular structure is maintained following exposure to IL-21. Immunohistochemistry was performed on WT (control; A–C), TG (Tg #5; D–F), and IL-21-injected mice (G–I) using Abs to IgD/IgM (A, D, and G), MAdCAM-1/IgM (B, E, and H), and MARCO/IgM (C, F, and I). Data are representative of several mice examined.

 
Corresponding to the ability of IL-21 to induce apoptosis, higher annexin V staining of B220+ B cells was seen in IL-21 TG mice than in WT littermates (Fig. 4Ai) and, similarly, injection of mice with the IL-21 plasmid increased annexin V staining (Fig. 4Aii). Although FACS and cell number analysis showed that there is not an overall decrease in the number of mature B cells in the IL-21 TG mice, these annexin V staining experiments suggest that IL-21 can initiate early steps in the apoptotic process in vivo but that these do not necessarily progress to cell death. Nevertheless, as shown above in Figs. 1 and 2, IL-21 also induced an increase in Ig class-switched B cells. Correspondingly, IL-21 TG mice had increased levels of serum IgG1 and IgM (Fig. 4B), and increased numbers of surface IgG1+ expressing splenic B cells (Fig. 4C). Furthermore, IL-21-injected mice exhibited increased numbers of splenic B cells expressing cytoplasmic IgG, as evaluated by immunohistology (data not shown). The increased production of IgM as well as IgG1 is consistent with IL-21-induced differentiation of B cells into Ig-secreting cells, independent of isotype switching.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 4. IL-21 decreases viability of splenic B cells but increases Ig class-switched B cells, with increased serum IgG1 and IgM and surface IgG1 expression on splenic B cells. A, Annexin V staining of B220+ splenic B cells from TG line #5 mice (i) or IL-21 vector-injected mice (ii). B, Serum isotype levels (mean ± SD) in WT and two IL-21 TG lines; five mice were analyzed in each group. *, p < 0.01 for serum IgM and IgG1 in the TG mice as compared with WT. C, Increased surface IgG1+ B cells in IL-21 TG mice. Splenocytes from IL-21 TG mice (line #5) and WT littermates were stained with anti-IgG1 and analyzed by flow cytometry.

 
IL-21 can act directly on purified B cells

The effects of IL-21 on B cells could either be direct or indirect. We analyzed the effect of IL-21 on purified splenic B cells cultured for 48 h in the presence of anti-IgM in combination with anti-CD40, IL-4, or both stimuli (Fig. 5A). IL-21 increased B cell proliferation induced by anti-IgM, especially in the presence of anti-CD40 (Fig. 5A). Although IL-21 inhibited proliferation induced by anti-IgM plus IL-4, proliferation increased when anti-CD40 was added as a further stimulus, and the combination of anti-IgM plus IL-4 plus anti-CD40 gave slightly more proliferation in the presence than in the absence of IL-21 (Fig. 5A). Thus, in the presence of certain signals, such as the combination of B cell receptor stimulation and anti-CD40, IL-21 induced the greatest proliferation, but in the absence of either B cell receptor or anti-CD40 stimulation, IL-21 induced much less proliferation (Fig. 5). Consistent with the effect of TG IL-21 on increasing Ab production (Fig. 4B), IL-21 induced expression of Syndecan-1 (CD138, a plasma cell marker) and surface IgG1 (Fig. 5, B and C, respectively; see ii vs i and iv vs iii) in B cells stimulated with anti-IgM with or without IL-4. Only a fraction of the surface IgG1+ cells expressed Syndecan-1 (Fig. 5D), indicating that IL-21 increased postswitch cells as well as plasma cells. For these experiments, we used culture conditions similar to those reported to allow apoptotic effects of IL-21 (8). Indeed, we independently demonstrated the apoptotic effects of IL-21 in combination with LPS, anti-IgM, or anti-CD40 (Fig. 6A). Interestingly, whereas this apoptosis is correlated with IL-21-mediated down-regulation of Bcl-2 mRNA levels (8), Bcl-2 cytoplasmic protein levels did not change in response to IL-21 (Fig. 6B), suggesting that other caspase-related mechanisms are more important (Ref. 8 and Fig. 6C), given the ability of IL-21 to induce cleavage of a caspase substrate (Fig. 6C). Thus, conditions that allow IL-21-mediated apoptosis also allow IL-21 to potently induce the maturation of stimulated B cells to postswitch cells and plasma cells in vitro and in vivo. Because we used purified B cells for the in vitro experiments, at least part of the effect of IL-21 on B cell differentiation is a direct effect.



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 5. Direct effects of IL-21 on anti-IgM and/or anti-CD40-induced B cell proliferation and differentiation. A, IL-21 potently increased proliferation of B cells stimulated with anti-IgM + anti-CD40. Purified B cells from C57BL/6 WT mice were cultured with anti-IgM in the presence or absence of IL-21, IL-4, and anti-CD40 for 48 h and were then pulsed with [3H]thymidine for the last 10 h. Shown is the average proliferative response of three mice analyzed in a representative experiment. *, p < 0.01 for IL-21 stimulated proliferation compared with control. B–D, Flow cytometric analysis of B cells cultured for 48 h as described above and analyzed for expression of Syndecan-1 (B) and surface IgG1 (C) or both (D). Data are representative of three similar experiments.

 


View larger version (36K):
[in this window]
[in a new window]
 
FIGURE 6. Effect of IL-21 on death and BCL2 expression in B cells. A, IL-21 augments DNA fragmentation (measured by TUNEL staining) in B cells stimulated with anti-CD40, anti-IgM + IL-4, or LPS. Upper, middle, and lower pairs of panels correspond to cells treated with anti-CD40 with or without IL-21 for 15 h, anti-IgM + IL-4 with or without IL-21 for 48 h, and LPS with or without IL-21 for 15 h, respectively. B, Bcl-2 levels were equivalent in untreated and IL-21-treated B cells. WT B cells were cultured with or without IL-21 for 24 h and intracytoplasmic Bcl-2 protein levels were evaluated by FACS analysis. C, Caspase activation by IL-21 as indicated by cleavage of poly(ADP-ribose) polymerase (PARP), a caspase substrate. Purified B cells were not activated or activated with LPS or anti-CD40, with or without IL-21, for 6 h. Cell lysates (50 µg) were electrophoresed and Western blotted with an anti-PARP Ab. The uncleaved and cleaved forms of PARP are also shown in Jurkat T cells treated with etoposide as a positive control.

 
IL-21 induces expression of Syndecan-1, Blimp-1, and Bcl-6, but it inhibits expression of Pax5

To elucidate the mechanism of the effect of IL-21 on B cell maturation and plasma cell differentiation, we examined the effects of IL-21 on B cell differentiation factors Blimp-1, Bcl-6, and Pax5. Blimp-1 is a transcription factor that has been identified as a master regulator of plasma cell differentiation (23), whereas Bcl-6 and Pax5 are required for germinal center formation (20). Interestingly, Blimp-1 and Bcl-6 can each inhibit expression of the other protein, and Blimp-1 additionally is an inhibitor of the expression of Pax5 (20, 24). We examined expression of these proteins in BCL1 3B3 cells, a B cell lymphoma cell line in which treatment with IL-2 and IL-5 can induce differentiation into Ig-secreting cells (25). In these cells, IL-21 induced expression of Syndecan-1 (Fig. 7Ai), whereas it decreased expression of MHC class II (Fig. 7Aii), consistent with plasma cell differentiation (13, 23). Analogous to the effect of IL-21 on CD23 expression in splenic B cells (Fig. 1B), IL-21 also decreased CD23 expression in BCL-1 cells (Fig. 7Aiii). Moreover, based on real-time PCR analysis, IL-21 induced expression of mRNA for both Blimp-1 and Bcl-6, whereas it inhibited expression of Pax5 mRNA (Fig. 7B, i, ii, and iii, respectively). The induction of Blimp-1 was at least as potent as that seen with the combination of IL-2 and IL-5, the "classical" stimulus for Blimp-1 in these cells (25); as expected, the combination of IL-2 and IL-5 inhibited expression of Bcl-6. The induction of both Blimp-1 and Bcl-6 by IL-21 was confirmed in purified splenic B cells. Induction was not seen in cells treated with anti-IgM alone, but the addition of IL-21 induced Blimp-1 protein expression as confirmed by Western blotting (Fig. 7C) and Blimp-1- and Bcl-6 DNA-binding activities, as evaluated by EMSAs (Fig. 7, D and E).



View larger version (52K):
[in this window]
[in a new window]
 
FIGURE 7. IL-21 increases Blimp-1 and Bcl-6 expression but diminishes Pax5. A, IL-21 induces Syndecan-1 expression (i), but diminishes MHC II and CD23 expression (ii and iii, respectively) in BCL-1 cells. B, IL-21 induces Blimp-1 (i) and Bcl-6 (ii), but decreases expression of Pax5 (iii) mRNA, as evaluated by real-time PCR in BCL-1 cells. The effect of IL-2 + IL-5 on expression of each gene is also shown. Error bars indicate the SD of replicate samples. Where not visible, the SD merged with the bars. *, p < 0.01 for induced vs uninduced mRNA levels. C, Induction of Blimp-1 protein, as evaluated by Western blotting in BCL-1 cells with IL-21 alone and in purified splenic B cells treated for 24 h with the combination of anti-IgM + IL-21 but not with anti-IgM alone. D, IL-21-mediated induction of Blimp-1 and Bcl-6 DNA-binding activities in splenic B cells as evaluated by EMSAs. Splenic B cells were isolated and treated with anti-IgM with or without IL-21 as described in Materials and Methods, and then Blimp-1 and Bcl-6 DNA-binding activities were evaluated using specific DNA probes. An Ab to Bcl-6 abolished the complex formed with the Bcl-6-binding probe, whereas an Ab to Stat3, which can bind the same probe (14 ), did not. E, IL-21 induction of Bcl-6 DNA-binding activity in BCL-1 cells.

 
IL-21 is elevated in the BXSB-Yaa autoimmune mouse model of SLE

Given the ability of IL-21 to promote plasma cell differentiation, we speculated that this cytokine might contribute to humoral autoimmune processes. We therefore examined the BXSB-Yaa mouse model, which is characterized by severe SLE, with lymphadenopathy, splenomegaly, leukocytosis, hypergammaglobulinemia, and severe immune complex-mediated glomerulonephritis, often with a nephrotic syndrome (26). Although the basis for the disease is unknown, severe SLE is dependent on the mutant Y chromosome-linked autoimmune accelerator Yaa locus. In contrast, mice carrying a C57BL/6 (B6)-derived WT Yaa allele exhibit a slowly developing chronic form of SLE (26). The mechanism mediating the action of the Yaa locus has been unclear.

Examination of splenocytes for expression of multiple genes revealed a striking age-dependent increase in Il21 mRNA levels in BXSB-Yaa mice, compared with BXSB-Yaa+ WT male mice (Fig. 8A; see also legend to Fig. 8). Interestingly, the expression of the genes encoding IL-7 and IL-15, two other {gamma}c-dependent cytokines, did not differ significantly in BXSB-Yaa and BXSB-Yaa+ WT mice (Fig. 8A). Like Il21, Il10 mRNA levels were also elevated in the BXSB-Yaa mouse (Fig. 8A). Corresponding to the increase in IL-21 mRNA, IgG1, IgG2b, and IgG3 mRNA levels were significantly elevated in BXSB-Yaa mice (Fig. 8A), as were serum levels of IL-21, IgG1, and IgG3 (Fig. 8, B–D). Thus, in addition to elevated Ig levels, among cytokines examined, we found a substantial increase in IL-21 in this model of SLE, suggesting that elevated levels of this cytokine may be involved in the pathogenesis of this disease.



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 8. Markedly elevated IL-21 and IgG1 isotype expression in the BXSB-Yaa mouse. A, Quantitative PCR (QPCR) analysis of three BXSB-Yaa compared with three BXSB-Yaa+ 16-wk-old male mice. Of 231 expressed genes, 9 genes were differentially expressed (at p < 0.05) such that they exceeded the 0.400 GPR cutoff, and they had the following rank order: IgG2b (p < 0.02), Il10 (p < 0.02), IgG1 (p < 0.03), Il21 (p < 0.03), DNase1 (p < 0.04), IgG3 (p < 0.04), Pdcd1 (p < 0.05), Hsp70–1 (p < 0.05), and osteopontin (p < 0.02), with IgG2b being the most highly induced. The fold expression changes for IgG2b, Il10, IgG1, Il21, and IgG3 as well as Il7 and Il15 are shown based on the normalizer gene, 18S RNA. Similar results including elevated Il21 expression were obtain in two additional experiments. The genes for other cytokines that were examined, including Il1b, Il2, Il4, Il5, Il6, Il12p35, Il12p40, Il18, Il24, and Il25 did not manifest significant expression changes. mRNAs that are elevated in a small number of cells or that are present at relatively low abundance may not be detected in this assay, which further underscores the significance of the genes whose expression was induced. Although these animals clearly have plasma cells and hypergammaglobulinemia, the proportions of these cells in the whole spleen is presumably small, as classic markers of these cells, including XBP-1, CD-9, and Blimp-1 were not elevated. B–D, Markedly elevated levels of serum IL-21 (B), IgG1 (C), and IgG3 (D) in BXSB-Yaa mice, as determined by double Ab sandwich ELISA. Shown are means ± SEM. The serum IL-21 levels in male BXSB-Yaa mice ranged between 62 and 13,900 pg/ml, whereas it was not detected in BXSB female mice. Serum IgG1 ranged between 16 and 2,000 µg/ml for BXSB-Yaa males, whereas the BXSB female controls had ~3.2 µg/ml; serum IgG3 ranged between 80 and a remarkable 50,000 µg/ml for BXSB-Yaa males, whereas the BXSB female controls had ~30 µg/ml.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-21 is a pleiotropic cytokine with actions on T, B, and NK cells. To our knowledge, IL-21 is the only type I cytokine that can induce apoptosis of resting naive B cells, whereas other {gamma}c family cytokines are typically antiapoptotic. In the context of Ag activation, IL-2 can promote T cell death via a process known as activation-induced cell death (27). However, IL-21 is different in that it is proapoptotic for B and NK cells instead of T cells (Ref. 8 and our unpublished data), and whereas activation-induced cell death requires a prior activation signal, IL-21-induced apoptosis does not. In addition to apoptotic effects on mature B cells, we show that IL-21 can induce the accumulation of transitional B cells in the periphery. This could reflect physiological compensation for the IL-21-mediated reduction in peripheral mature B cells, the ability of IL-21 to increase maturation and/or survival of immature B cells from the bone marrow, and/or an ability of IL-21 to interfere with signals that promote differentiation from transitional to mature B cells.

IL-21 TG mice exhibited elevated serum IgM and IgG1 and had increased surface IgG1+ B cells in the spleen, suggesting that IL-21 could promote Ig isotype switching in vivo. A recent report demonstrates the ability of human IL-21 to promote isotype switching in CD40-activated human B cells (28). However, our data demonstrate that IL-21 can induce isotype switching and plasma cell differentiation in naive B cells before an encounter with secondary T cell signals, suggesting a role for IL-21 in early B cell responses to Ag. Strikingly, IL-21 down-regulated CD23 expression on mature B cells and promoted differentiation to Ig-secreting plasma cells both in vivo and in vitro. This contrasts to IL-4, which inhibits plasma cell differentiation (29) and induces CD23 expression on mature B cells (30). The ability of IL-21 to increase Ig-secreting cells clarifies why IgG1 Ab-forming cells are greatly decreased in Il21r knockout (KO) mice and why all Ig classes are diminished in Il21r/Il4 double KO mice (6). Interestingly, the accumulation of surface IgG1+ cells in response to IL-21 was reduced in the presence of IL-4, whereas the induction of Syndecan-1+ cells was not altered. Thus, some but not all of the effects of IL-21 on the B cell immune response can be modulated by IL-4, consistent with our finding in Il21r KO vs Il21r/Il4 double KO mice (6). The observation that IL-21 has antiapoptotic effects on some myeloma cell lines (31) is consistent with our observations that IL-21 is an inducing factor for plasma cells.

In summary, we have now elucidated some of the complex actions of IL-21 in the B cell immune response. IL-21 confers an apoptotic signal either on naive B cells or, alternatively, when bystander B cells are stimulated in an Ag-nonspecific manner by activated T cells via CD40 signaling (Ref. 8 and our unpublished observations). Following the initiation of a B cell immune response, this apoptotic signal of IL-21 might help to eliminate "bystander" B cells responsible for the nonspecific hypergammaglobulinemia that is initially observed. However, in B cells activated by B cell receptor signaling, our results indicate that IL-21 can enhance Ig production, isotype switching, and plasma cell production. We hypothesize that the effect of IL-21 on plasma cell differentiation results from its ability to increase Blimp-1 expression, whereas the induction of Bcl-6 may be important for subsequent differentiation of germinal center cells into postswitch cells. The IL-21-mediated down-regulation of Pax5 may bias responses toward plasma cell differentiation, as Pax5 is known to inhibit plasma cell differentiation but is thought to be required for memory cell maturation (20). Interestingly, IL-21 induced both Blimp-1 and Bcl-6, which exert mutually antagonistic effects (20, 24). Moreover, we demonstrate an increase in IL-21-mediated DNA-binding activity for both of these proteins, whereas no other known stimulus has been shown previously to activate the binding activity of both of these critical transcription factors. Such unprecedented actions help to explain how IL-21 can drive differentiation of B cells both into postswitch cells as well as to plasma cells. This may be another indication of the overall potency of IL-21 in stimulating multiple aspects of the differentiation of B cells, with its potentially having differential effects in a context-regulated manner.

Finally, although the genetic mutation and molecular basis for autoimmunity in the BXSB-Yaa mouse remains unknown, the possibility that elevated IL-21 accounts for the hypergammaglobulinemia and class switching to IgG isotypes characteristic of BXSB-Yaa mice is intriguing. This is consistent with the fact that the SLE-like autoimmune disease in these animals is dependent on CD4+ T cells (32), the major source of IL-21 (1, 2). It is of interest that increased expression of IL-21 mRNA has been detected in autoimmune NOD mice (33). Overall, our data support critical roles for IL-21 in apoptosis, B cell differentiation, and plasma cell generation and suggest that this cytokine may be critically involved in the pathogenesis of autoimmune disease.


    Acknowledgments
 
We thank Dr. David Raulet for the pHSE TG vector. We thank Drs. Pierre Henkart, William Paul, John Kelly, Pamela Schwartzberg, and Jian-Xin Lin for valuable discussions and/or critical comments. We thank Lisa Ng for technical assistance.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 D.C.R. was supported in part by the Alliance for Lupus Research and National Institutes of Health Grant DK56597. Back

2 K.O. and R.S. contributed equally to this study. Back

3 Current address: Institute of Medical Science, University of Tokyo, Tokyo, Japan. Back

4 Current address: Anderson Cancer Center, Houston, TX. Back

5 Address correspondence and reprint requests to Warren J. Leonard, Laboratory of Molecular Immunology, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD 20892-1674. E-mail address: wjl{at}helix.nih.gov Back

6 Abbreviations used in this paper: {gamma}c, common {gamma}-chain; TG, transgenic; MAdCAM-1, mucosal addressin cell adhesion molecule 1; FW, forward; RV, reverse; TP, TaqMan probe; GPR, global pattern recognition; MZ, marginal zone; WT, wild type; SLE, systemic lupus erythematosus; KO, knockout. Back

Received for publication May 5, 2004. Accepted for publication July 16, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ozaki, K., K. Kikly, D. Michalovich, P. R. Young, W. J. Leonard. 2000. Cloning of a type I cytokine receptor most related to the IL-2 receptor {beta} chain. Proc. Natl. Acad. Sci. USA 97:11439.[Abstract/Free Full Text]
  2. Parrish-Novak, J., S. R. Dillon, A. Nelson, A. Hammond, C. Sprecher, J. A. Gross, J. Johnston, K. Madden, W. Xu, J. West, et al 2000. Interleukin 21 and its receptor are involved in NK cell expansion and regulation of lymphocyte function. Nature 408:57.[Medline]
  3. Leonard, W. J.. 2001. Cytokines and immunodeficiency diseases. Nat. Rev. Immunol. 1:200.[Medline]
  4. Asao, H., H. C. Okuyama, S. Kumaki, N. Ishii, S. Tsuchiya, D. Foster, K. Sugamura. 2001. The common {gamma}-chain is an indispensable subunit of the IL-21 receptor complex. J. Immunol. 167:1.[Abstract/Free Full Text]
  5. Kasaian, M. T., M. J. Whitters, L. L. Carter, L. D. Lowe, J. M Jussif, B. Deng, K. A. Johnson, J. S. Witek, M. Senices, R. F. Konz, et al 2002. IL-21 limits NK cell responses and promotes antigen-specific T cell activation: a mediator of the transition from innate to adaptive immunity. Immunity 16:559.[Medline]
  6. Ozaki, K., R. Spolski, C. G. Feng, J. Cheng, A. Sher, C. Liu, P. L. Schwarzberg, W. J. Leonard. 2002. A critical role for IL-21 in regulating immunoglobulin production. Science 298:1630.[Abstract/Free Full Text]
  7. Suto, A., H. Nakajima, K. Hirose, K. Suzuki, S. Kagami, Y. Seto, A. Hoshimoto, Y. Saito, D. C. Foster, I. Iwamoto. 2002. Interleukin 21 prevents antigen-induced IgE production by inhibiting germ line C{epsilon} transcription of IL-4-stimulated B cells. Blood 100:4565.[Abstract/Free Full Text]
  8. Mehta, D. S., A. L. Wurster, M. J. Whitters, D. A. Young, M. Collins, M. J. Grusby. 2003. IL-21 induces the apoptosis of resting and activated primary B cells. J. Immunol. 170:4111.[Abstract/Free Full Text]
  9. Pircher, H., T. W. Mak, R. Lang, W. Ballhausen, E. Ruedi, H. Hengartner, R. M. Zinkernagel, K. Burki. 1989. T cell tolerance to Mlsa encoded antigens in T cell receptor V{beta}8.1 chain transgenic mice. EMBO J. 8:719.[Medline]
  10. Held, W., D. Cado, D. H. Raulet. 1996. Transgenic expression of Ly49A natural killer cell receptor confers class I major histocompatibility complex (MHC)-specific inhibition and prevents bone marrow allograft rejection. J. Exp. Med. 184:2037.[Abstract/Free Full Text]
  11. Liu, F., Y. K. Song, D. Liu. 1999. Hydrodynamics-based transfection in animals by systemic administration of plasmid DNA. Gene Ther. 6:1258.[Medline]
  12. Wang, G., M. Tschoi, R. Spolski, Y. Lou, K. Ozaki, C. Feng, G. Kim, W. J. Leonard, P. Hwu. 2003. In vivo antitumor activity of interleukin 21 mediated by natural killer cells. Cancer Res. 63:9016.[Abstract/Free Full Text]
  13. Piskurich, J. F., K.-I. Lin, Y. Wang, J. P.-Y. Ting, K. Calame. 2000. BLIMP-1 mediates extinction of major histocompatibility class II transactivator expression in plasma cells. Nat. Immunol. 1:526.[Medline]
  14. Relijc, R., S. D. Wagner, L. J. Peakman, D. T. Fearon. 2000. Suppression of signal transducer and activator of transcription 3-dependent B lymphocyte terminal differentiation by BCL-6. J. Exp. Med. 192:1841.[Abstract/Free Full Text]
  15. Akilesh, S., D. J. Shaffer, D. C. Roopenian. 2003. Customized molecular phenotyping by quantitative gene expression and pattern recognition analysis. Genome Res. 13:1719.[Abstract/Free Full Text]
  16. Martin, F., J. F. Kearney. 2002. Marginal-zone B cells. Nat. Rev. Immunol. 2:323.[Medline]
  17. Hao, Z., K. Rajewsky. 2001. Homeostasis of peripheral B cells in the absence of B cell influx from the bone marrow. J. Exp. Med. 194:1151.[Abstract/Free Full Text]
  18. Loder, F., B. Mutschler, R. J. Ray, C. J. Paige, P. Sideras, R. Torres, M. C. Lamers, R. Carsetti. 1999. B cell development in the spleen takes place in discrete steps and is determined by the quality of B cell receptor-derived signals. J. Exp. Med. 190:75.[Abstract/Free Full Text]
  19. Sze, D. M., K. M. Toellner, C. Garcia de Vinuesa, D. R. Taylor, I. C. MacLennan. 2000. Intrinsic constraint on plasmablast growth and extrinsic limits of plasma cell survival. J. Exp. Med. 192:813.[Abstract/Free Full Text]
  20. Calame, K. L., K. I. Lin, C. Tunyaplin. 2003. Regulatory mechanisms that determine the development and function of plasma cells. Annu. Rev. Immunol. 21:205.[Medline]
  21. Gorlick, L., A. H. Cutler, G. Thill, S. D. Miklasz, D. E. Shea, C. Ambrose, S. A. Bixler, L. Su, M. L. Scott, S. L. Kalled. 2004. BAFF regulates CD21/35 and CD23 expression independent of its B cell survival function. J. Immunol. 172:762.[Abstract/Free Full Text]
  22. Allman, D., R. C. Lindsley, W. DeMuth, K. Rudd, S. A. Shinton, R. R. Hardy. 2001. Resolution of three nonproliferative immature splenic B cell subsets reveals multiple selection points during peripheral B cell maturation. J. Immunol. 167:6834.[Abstract/Free Full Text]
  23. Turner, C. A., Jr, D. H. Mack, M. M. Davis. 1994. Blimp-1, a novel zinc finger-containing protein that can drive the maturation of B lymphocytes into immunoglobulin-secreting cells. Cell 77:297.[Medline]
  24. Shaffer, A. L., K. I. Lin, T. C. Kuo, X. Yu, E. M. Hurt, A. Rosenwald, J. M. Giltnane, L. Yang, H. Zhao, K. Calame, L. M. Staudt. 2002. Blimp-1 orchestrates plasma cell differentiation by extinguishing the mature B cell gene expression program. Immunity 17:51.[Medline]
  25. Messika, E. J., P. S. Lu, Y. J. Sung, T. Yaho, J. T. Chi, Y. H. Chien, M. M. Davis. 1998. Differential effect of B lymphocyte-induced maturation protein (Blimp-1) expression on cell fate during B cell development. J. Exp. Med. 188:515.[Abstract/Free Full Text]
  26. Murphy, E. D., J. B. Roths. 1979. A Y chromosome associated factor in strain BXSB producing accelerated autoimmunity and lymphoproliferation. Arthritis Rheum. 22:1188.[Medline]
  27. Lenardo, M., K. M. Chan, F. Hornung, H. McFarland, R. Siegel, J. Wang, L. Zheng. 1999. Mature T lymphocyte apoptosis–immune regulation in a dynamic and unpredictable antigenic environment. Annu. Rev. Immunol. 17:221.[Medline]
  28. Pene, J., J. Gauchat, S. Lecart, E. Drouet, P. Guglielmi, V. Boulay, A. Delwail, D. Foster, J. Lecron, H. Yssel. 2004. IL-21 is a switch factor for the production of IgG1 and IgG3 by human B cells. J. Immunol. 172:5154.[Abstract/Free Full Text]
  29. Knodel, M., A. W. Kuss, I. Berberich, A. Schimpl. 2001. Blimp-1 over-expression abrogates IL-4 and CD40-mediated suppression of terminal B cell differentiation but arrests isotype switching. Eur. J. Immunol. 31:1972.[Medline]
  30. Nelms, K., A. D. Keegan, J. Zamorano, J. J. Ryan, W. E. Paul. 1999. The IL-4 receptor: signaling mechanisms and biologic functions. Annu. Rev. Immunol. 17:701.[Medline]
  31. Brenne, A. T., T. Baade Ro, A. Waage, A. Sundan, M. Borset, H. Hjorth-Hansen. 2002. Interleukin-21 is a growth and survival factor for human myeloma cells. Blood 99:3756.[Abstract/Free Full Text]
  32. Wofsy, D.. 1986. Administration of monoclonal anti-T cell antibodies retards murine lupus in BXSB mice. J. Immunol. 136:4554.[Abstract]
  33. King, C., A. Ilic, K. Koelsch, N. Sarvetnick. 2004. Homeostatic expansion of T cells during immune insufficiency generates autoimmunity. Cell 117:265.[Medline]



This article has been cited by other articles:


Home page
Int ImmunolHome page
Y. Watanabe, T. Takahashi, A. Okajima, M. Shiokawa, N. Ishii, I. Katano, R. Ito, M. Ito, M. Minegishi, N. Minegishi, et al.
The analysis of the functions of human B and T cells in humanized NOD/shi-scid/{gamma}cnull (NOG) mice (hu-HSC NOG mice)
Int. Immunol., July 1, 2009; 21(7): 843 - 858.
[Abstract] [Full Text] [PDF]


Home page
LupusHome page
H. Wu, E. Center, G. Tsokos, and H. Weiner
Suppression of murine SLE by oral anti-CD3: inducible CD4+CD25-LAP+ regulatory T cells control the expansion of IL-17+ follicular helper T cells
Lupus, June 1, 2009; 18(7): 586 - 596.
[Abstract] [PDF]


Home page
J. Leukoc. Biol.Home page
V. Pistoia and C. Cocco
IL-21: a new player in the control of isotype switch in Peyer's patches
J. Leukoc. Biol., May 1, 2009; 85(5): 739 - 743.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
G.-Y. Seo, J. Youn, and P.-H. Kim
IL-21 ensures TGF-{beta}1-induced IgA isotype expression in mouse Peyer's patches
J. Leukoc. Biol., May 1, 2009; 85(5): 744 - 750.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
A. P.R. Sutherland, T. Van Belle, A. L. Wurster, A. Suto, M. Michaud, D. Zhang, M. J. Grusby, and M. von Herrath
Interleukin-21 Is Required for the Development of Type 1 Diabetes in NOD Mice
Diabetes, May 1, 2009; 58(5): 1144 - 1155.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Spolski, H.-P. Kim, W. Zhu, D. E. Levy, and W. J. Leonard
IL-21 Mediates Suppressive Effects via Its Induction of IL-10
J. Immunol., March 1, 2009; 182(5): 2859 - 2867.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Konforte, N. Simard, and C. J. Paige
IL-21: An Executor of B Cell Fate
J. Immunol., February 15, 2009; 182(4): 1781 - 1787.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. A. Bubier, T. J. Sproule, O. Foreman, R. Spolski, D. J. Shaffer, H. C. Morse III, W. J. Leonard, and D. C. Roopenian
A critical role for IL-21 receptor signaling in the pathogenesis of systemic lupus erythematosus in BXSB-Yaa mice
PNAS, February 3, 2009; 106(5): 1518 - 1523.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
O. Dienz, S. M. Eaton, J. P. Bond, W. Neveu, D. Moquin, R. Noubade, E. M. Briso, C. Charland, W. J. Leonard, G. Ciliberto, et al.
The induction of antibody production by IL-6 is indirectly mediated by IL-21 produced by CD4+ T cells
J. Exp. Med., January 16, 2009; 206(1): 69 - 78.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
K. Castermans, S. P. Tabruyn, R. Zeng, J. R. van Beijnum, C. Eppolito, W. J. Leonard, P. A. Shrikant, and A. W. Griffioen
Angiostatic activity of the antitumor cytokine interleukin-21
Blood, December 15, 2008; 112(13): 4940 - 4947.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
R Ettinger, S Kuchen, and P E Lipsky
Interleukin 21 as a target of intervention in autoimmune disease
Ann Rheum Dis, December 1, 2008; 67(Suppl_3): iii83 - iii86.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Menoret, S. Maiga, G. Descamps, C. Pellat-Deceunynck, C. Fraslon, M. Cappellano, P. Moreau, R. Bataille, and M. Amiot
IL-21 Stimulates Human Myeloma Cell Growth through an Autocrine IGF-1 Loop
J. Immunol., November 15, 2008; 181(10): 6837 - 6842.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Y. Wu, F. J. Quintana, and H. L. Weiner
Nasal Anti-CD3 Antibody Ameliorates Lupus by Inducing an IL-10-Secreting CD4+CD25-LAP+ Regulatory T Cell and Is Associated with Down-Regulation of IL-17+CD4+ICOS+CXCR5+ Follicular Helper T Cells
J. Immunol., November 1, 2008; 181(9): 6038 - 6050.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. Spolski, M. Kashyap, C. Robinson, Z. Yu, and W. J. Leonard
IL-21 signaling is critical for the development of type I diabetes in the NOD mouse
PNAS, September 16, 2008; 105(37): 14028 - 14033.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
W. J. Leonard, R. Zeng, and R. Spolski
Interleukin 21: a cytokine/cytokine receptor system that has come of age
J. Leukoc. Biol., August 1, 2008; 84(2): 348 - 356.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
S. Ferrari-Lacraz, R. Chicheportiche, G. Schneiter, N. Molnarfi, J. Villard, and J.-M. Dayer
IL-21 promotes survival and maintains a naive phenotype in human CD4+ T lymphocytes
Int. Immunol., August 1, 2008; 20(8): 1009 - 1018.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
K. Nie, M. Gomez, P. Landgraf, J.-F. Garcia, Y. Liu, L. H.C. Tan, A. Chadburn, T. Tuschl, D. M. Knowles, and W. Tam
MicroRNA-Mediated Down-Regulation of PRDM1/Blimp-1 in Hodgkin/Reed-Sternberg Cells: A Potential Pathogenetic Lesion in Hodgkin Lymphomas
Am. J. Pathol., July 1, 2008; 173(1): 242 - 252.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Iuchi, S. Teitz-Tennenbaum, J. Huang, B. G. Redman, S. D. Hughes, M. Li, G. Jiang, A. E. Chang, and Q. Li
Interleukin-21 Augments the Efficacy of T-Cell Therapy by Eliciting Concurrent Cellular and Humoral Responses
Cancer Res., June 1, 2008; 68(11): 4431 - 4441.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. S. Hinrichs, R. Spolski, C. M. Paulos, L. Gattinoni, K. W. Kerstann, D. C. Palmer, C. A. Klebanoff, S. A. Rosenberg, W. J. Leonard, and N. P. Restifo
IL-2 and IL-21 confer opposing differentiation programs to CD8+ T cells for adoptive immunotherapy
Blood, June 1, 2008; 111(11): 5326 - 5333.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. A. Diehl, H. Schmidlin, M. Nagasawa, S. D. van Haren, M. J. Kwakkenbos, E. Yasuda, T. Beaumont, F. A. Scheeren, and H. Spits
STAT3-Mediated Up-Regulation of BLIMP1 Is Coordinated with BCL6 Down-Regulation to Control Human Plasma Cell Differentiation
J. Immunol., April 1, 2008; 180(7): 4805 - 4815.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
A H Sawalha, K M Kaufman, J A Kelly, A J Adler, T Aberle, J Kilpatrick, E K Wakeland, Q-Z Li, A E Wandstrat, D R Karp, et al.
Genetic association of interleukin-21 polymorphisms with systemic lupus erythematosus
Ann Rheum Dis, April 1, 2008; 67(4): 458 - 461.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A.-K. Shirakawa, D. Nagakubo, K. Hieshima, T. Nakayama, Z. Jin, and O. Yoshie
1,25-Dihydroxyvitamin D3 Induces CCR10 Expression in Terminally Differentiating Human B Cells
J. Immunol., March 1, 2008; 180(5): 2786 - 2795.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. L. Bryant, C. S. Ma, D. T. Avery, Y. Li, K. L. Good, L. M. Corcoran, R. de Waal Malefyt, and S. G. Tangye
Cytokine-Mediated Regulation of Human B Cell Differentiation into Ig-Secreting Cells: Predominant Role of IL-21 Produced by CXCR5+ T Follicular Helper Cells
J. Immunol., December 15, 2007; 179(12): 8180 - 8190.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Kishida, Y. Hiromura, M. Shin-Ya, H. Asada, H. Kuriyama, M. Sugai, A. Shimizu, Y. Yokota, T. Hama, J. Imanishi, et al.
IL-21 Induces Inhibitor of Differentiation 2 and Leads to Complete Abrogation of Anaphylaxis in Mice
J. Immunol., December 15, 2007; 179(12): 8554 - 8561.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
I. D. Davis, K. Skak, M. J. Smyth, P. E.G. Kristjansen, D. M. Miller, and P. V. Sivakumar
Interleukin-21 Signaling: Functions in Cancer and Autoimmunity
Clin. Cancer Res., December 1, 2007; 13(23): 6926 - 6932.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Hiromura, T. Kishida, H. Nakano, T. Hama, J. Imanishi, Y. Hisa, and O. Mazda
IL-21 Administration into the Nostril Alleviates Murine Allergic Rhinitis
J. Immunol., November 15, 2007; 179(10): 7157 - 7165.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Kuchen, R. Robbins, G. P. Sims, C. Sheng, T. M. Phillips, P. E. Lipsky, and R. Ettinger
Essential Role of IL-21 in B Cell Activation, Expansion, and Plasma Cell Generation during CD4+ T Cell-B Cell Collaboration
J. Immunol., November 1, 2007; 179(9): 5886 - 5896.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Mora-Lopez, E. Reales, J. A. Brieva, and A. Campos-Caro
Human BSAP and BLIMP1 conform an autoregulatory feedback loop
Blood, November 1, 2007; 110(9): 3150 - 3157.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
T. Onoda, M. Rahman, H. Nara, A. Araki, K. Makabe, K. Tsumoto, I. Kumagai, T. Kudo, N. Ishii, N. Tanaka, et al.
Human CD4+ central and effector memory T cells produce IL-21: effect on cytokine-driven proliferation of CD4+ T cell subsets
Int. Immunol., October 1, 2007; 19(10): 1191 - 1199.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Fang, M. Menon, W. Kapelle, O. Bogacheva, O. Bogachev, E. Houde, S. Browne, P. Sathyanarayana, and D. M. Wojchowski
EPO modulation of cell-cycle regulatory genes, and cell division, in primary bone marrow erythroblasts
Blood, October 1, 2007; 110(7): 2361 - 2370.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. R. Barker, J. G. Parvani, D. Meyer, A. S. Hey, K. Skak, and N. L. Letvin
IL-21 Induces Apoptosis of Antigen-Specific CD8+ T Lymphocytes
J. Immunol., September 15, 2007; 179(6): 3596 - 3603.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
V. Ostiguy, E.-L. Allard, M. Marquis, J. Leignadier, and N. Labrecque
IL-21 promotes T lymphocyte survival by activating the phosphatidylinositol-3 kinase signaling cascade
J. Leukoc. Biol., September 1, 2007; 82(3): 645 - 656.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. R. Withers, C. Fiorini, R. T. Fischer, R. Ettinger, P. E. Lipsky, and A. C. Grammer
T cell dependent survival of CD20+ and CD20 plasma cells in human secondary lymphoid tissue
Blood, June 1, 2007; 109(11): 4856 - 4864.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Zeng, R. Spolski, E. Casas, W. Zhu, D. E. Levy, and W. J. Leonard
The molecular basis of IL-21-mediated proliferation
Blood, May 15, 2007; 109(10): 4135 - 4142.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
T. C. Kuo, A. L. Shaffer, J. Haddad Jr., Y. S. Choi, L. M. Staudt, and K. Calame
Repression of BCL-6 is required for the formation of human memory B cells in vitro
J. Exp. Med., April 16, 2007; 204(4): 819 - 830.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Vermijlen, P. Ellis, C. Langford, A. Klein, R. Engel, K. Willimann, H. Jomaa, A. C. Hayday, and M. Eberl
Distinct Cytokine-Driven Responses of Activated Blood {gamma}{delta} T Cells: Insights into Unconventional T Cell Pleiotropy
J. Immunol., April 1, 2007; 178(7): 4304 - 4314.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Herber, T. P. Brown, S. Liang, D. A. Young, M. Collins, and K. Dunussi-Joannopoulos
IL-21 Has a Pathogenic Role in a Lupus-Prone Mouse Model and Its Blockade with IL-21R.Fc Reduces Disease Progression
J. Immunol., March 15, 2007; 178(6): 3822 - 3830.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Ettinger, G. P. Sims, R. Robbins, D. Withers, R. T. Fischer, A. C. Grammer, S. Kuchen, and P. E. Lipsky
IL-21 and BAFF/BLyS Synergize in Stimulating Plasma Cell Differentiation from a Unique Population of Human Splenic Memory B Cells
J. Immunol., March 1, 2007; 178(5): 2872 - 2882.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Frohlich, B. J. Marsland, I. Sonderegger, M. Kurrer, M. R. Hodge, N. L. Harris, and M. Kopf
IL-21 receptor signaling is integral to the development of Th2 effector responses in vivo
Blood, March 1, 2007; 109(5): 2023 - 2031.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Huggins, T. Pellegrin, R. E. Felgar, C. Wei, M. Brown, B. Zheng, E. C. B. Milner, S. H. Bernstein, I. Sanz, and M. S. Zand
CpG DNA activation and plasma-cell differentiation of CD27- naive human B cells
Blood, February 15, 2007; 109(4): 1611 - 1619.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Konforte and C. J. Paige
Identification of Cellular Intermediates and Molecular Pathways Induced by IL-21 in Human B Cells
J. Immunol., December 15, 2006; 177(12): 8381 - 8392.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
H. Jin and T. R. Malek
Redundant and unique regulation of activated mouse B lymphocytes by IL-4 and IL-21
J. Leukoc. Biol., December 1, 2006; 80(6): 1416 - 1423.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. L. Good, V. L. Bryant, and S. G. Tangye
Kinetics of Human B Cell Behavior and Amplification of Proliferative Responses following Stimulation with IL-21
J. Immunol., October 15, 2006; 177(8): 5236 - 5247.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Rui, J. I. Healy, J. Blasioli, and C. C. Goodnow
ERK Signaling Is a Molecular Switch Integrating Opposing Inputs from B Cell Receptor and T Cell Cytokines to Control TLR4-Driven Plasma Cell Differentiation
J. Immunol., October 15, 2006; 177(8): 5337 - 5346.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Bossaller, J. Burger, R. Draeger, B. Grimbacher, R. Knoth, A. Plebani, A. Durandy, U. Baumann, M. Schlesier, A. A. Welcher, et al.
ICOS Deficiency Is Associated with a Severe Reduction of CXCR5+CD4 Germinal Center Th Cells
J. Immunol., October 1, 2006; 177(7): 4927 - 4932.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K.-I Lin, Y.-Y. Kao, H.-K. Kuo, W.-B. Yang, A. Chou, H.-H. Lin, A. L. Yu, and C.-H. Wong
Reishi Polysaccharides Induce Immunoglobulin Production through the TLR4/TLR2-mediated Induction of Transcription Factor Blimp-1
J. Biol. Chem., August 25, 2006; 281(34): 24111 - 24123.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
E. Arguni, M. Arima, N. Tsuruoka, A. Sakamoto, M. Hatano, and T. Tokuhisa
JunD/AP-1 and STAT3 are the major enhancer molecules for high Bcl6 expression in germinal center B cells
Int. Immunol., July 1, 2006; 18(7): 1079 - 1089.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
D. de Totero, R. Meazza, S. Zupo, G. Cutrona, S. Matis, M. Colombo, E. Balleari, I. Pierri, M. Fabbi, M. Capaia, et al.
Interleukin-21 receptor (IL-21R) is up-regulated by CD40 triggering and mediates proapoptotic signals in chronic lymphocytic leukemia B cells
Blood, May 1, 2006; 107(9): 3708 - 3715.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. R. Herrin and L. B. Justement
Expression of the Adaptor Protein Hematopoietic Src Homology 2 is Up-Regulated in Response to Stimuli That Promote Survival and Differentiation of B Cells
J. Immunol., April 1, 2006; 176(7): 4163 - 4172.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Comes, O. Rosso, A. M. Orengo, E. Di Carlo, C. Sorrentino, R. Meazza, T. Piazza, B. Valzasina, P. Nanni, M. P. Colombo, et al.
CD25+ Regulatory T Cell Depletion Augments Immunotherapy of Micrometastases by an IL-21-Secreting Cellular Vaccine
J. Immunol., February 1, 2006; 176(3): 1750 - 1758.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
C. H. Lee, M. Melchers, H. Wang, T. A. Torrey, R. Slota, C.-F. Qi, J. Y. Kim, P. Lugar, H. J. Kong, L. Farrington, et al.
Regulation of the germinal center gene program by interferon (IFN) regulatory factor 8/IFN consensus sequence-binding protein
J. Exp. Med., January 23, 2006; 203(1): 63 - 72.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Ettinger, G. P. Sims, A.-M. Fairhurst, R. Robbins, Y. S. da Silva, R. Spolski, W. J. Leonard, and P. E. Lipsky
IL-21 Induces Differentiation of Human Naive and Memory B Cells into Antibody-Secreting Plasma Cells
J. Immunol., December 15, 2005; 175(12): 7867 - 7879.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Z. Wu, H.-P. Kim, H.-H. Xue, H. Liu, K. Zhao, and W. J. Leonard
Interleukin-21 Receptor Gene Induction in Human T Cells Is Mediated by T-Cell Receptor-Induced Sp1 Activity
Mol. Cell. Biol., November 15, 2005; 25(22): 9741 - 9752.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H.-P. Kim, L. L. Korn, A. M. Gamero, and W. J. Leonard
Calcium-dependent Activation of Interleukin-21 Gene Expression in T Cells
J. Biol. Chem., July 1, 2005; 280(26): 25291 - 25297.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. T. Avery, J. I. Ellyard, F. Mackay, L. M. Corcoran, P. D. Hodgkin, and S. G. Tangye
Increased Expression of CD27 on Activated Human Memory B Cells Correlates with Their Commitment to the Plasma Cell Lineage
J. Immunol., April 1, 2005; 174(7): 4034 - 4042.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ozaki, K.
Right arrow Articles by Leonard, W. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ozaki, K.
Right arrow Articles by Leonard, W. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS