The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boyartchuk, V.
Right arrow Articles by Kramnik, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boyartchuk, V.
Right arrow Articles by Kramnik, I.
The Journal of Immunology, 2004, 173: 5112-5120.
Copyright © 2004 by The American Association of Immunologists

The Host Resistance Locus sst1 Controls Innate Immunity to Listeria monocytogenes Infection in Immunodeficient Mice1

Victor Boyartchuk2,*, Mauricio Rojas2,{dagger},||, Bo-Shiun Yan{dagger}, Ousman Jobe{dagger}, Nicholas Hurt{dagger}, David M. Dorfman{ddagger}, Darren E. Higgins§, William F. Dietrich and Igor Kramnik3,{dagger}

* Program in Gene Function and Expression, University of Massachusetts Medical School, {dagger} Department of Immunology and Infectious Diseases, Harvard School of Public Health, {ddagger} Department of Pathology, Harvard Medical School, Brigham and Women’s Hospital, Departments of § Microbiology and Molecular Genetics and Genetics, Harvard Medical School, Boston, MA 02115; and || Grupo de Inmunología Celular e Inmunogenética, Facultad de Medicina, Universidad de Antioquia, Medellín, Colombia


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Epidemiological, clinical, and experimental approaches have convincingly demonstrated that host resistance to infection with intracellular pathogens is significantly influenced by genetic polymorphisms. Using a mouse model of infection with virulent Mycobacterium tuberculosis (MTB), we have previously identified the sst1 locus as a genetic determinant of host resistance to tuberculosis. In this study we demonstrate that susceptibility to another intracellular pathogen, Listeria monocytogenes, is also influenced by the sst1 locus. The contribution of sst1 to anti-listerial immunity is much greater in immunodeficient scid mice, indicating that this locus controls innate immunity and becomes particularly important when adaptive immunity is significantly depressed. Similar to our previous observations using infection with MTB, the resistant allele of sst1 prevents formation of necrotic infectious lesions in vivo. We have shown that macrophages obtained from sst1-resistant congenic mice possess superior ability to kill L. monocytogenes in vitro. The bactericidal effect of sst1 is dependent on IFN-{gamma} activation and reactive oxygen radical production by activated macrophages after infection, but is independent of NO production. It is possible that there is a single gene that controls common IFN-dependent macrophage function, which is important in the pathogenesis of infections caused by both MTB and L. monocytogenes. However, host resistance to the two pathogens may be controlled by two different polymorphic genes encoded within the sst1 locus. The polymorphic gene(s) encoded within the sst1 locus that controls macrophage interactions with the two intracellular pathogens remains to be elucidated.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Host populations are heterogeneous in terms of their susceptibility to infectious agents. A variety of epidemiological, clinical, and experimental approaches have convincingly demonstrated a significant contribution of host heredity in resistance to infection (reviewed in Refs. 1, 2, 3). From those studies it has become increasingly clear that genetic control of immunity to infection is a complex genetic trait (4, 5). Therefore, the focus of this field has shifted from the search for major qualitative genetic regulators of immunity (6) toward identification of multiple genetic factors, in which polymorphisms have a smaller, quantitative effect on the outcome of host-parasite interactions (7).

The contribution of genetic polymorphisms to human variation in tuberculosis resistance has been amply demonstrated in twin, association, and linkage studies (8). As a result of this ongoing work, several genes (NRAMP1 (SLC11A1), vitamin D receptor, and HLA-DQ) have been shown to contribute to variation in tuberculosis susceptibility in human populations. However, the effect of these genes is accountable for only a small proportion of the overall genetic variation, justifying the need for multiple approaches for identifying additional host resistance factors. As suggested by the work performed with NRAMP1, the identification of gene polymorphisms in mouse models of infection susceptibility can provide a ready resource of gene candidates to evaluate in human models of infection (9, 10).

Recently, experimental tuberculosis infections of C57BL/6J (resistant) and C3HeB/FeJ (susceptible) inbred strains of mice have been used to define a region that encodes a genetic determinant of tuberculosis susceptibility (11). This locus (sst1, supersusceptibility to tuberculosis) has been mapped to a 5-cM interval (49–54 cM) on mouse chromosome 1. A C3H.B6-sst1 congenic mouse strain that carries the C57BL/6J-derived resistant allele at the sst1 locus (sst1B6) was generated by introgressing a 20-cM interval (43–64 cM) of mouse chromosome 1 from C57BL/6J to the C3HeB/FeJ background in a series of 10 backcrosses.4 Using this congenic strain we have demonstrated that the presence of sst1B6 on the susceptible C3HeB/FeJ genetic background results in better control of multiplication of virulent Mycobacterium tuberculosis (MTB),5 prevention of formation of necrotic lesions in the lungs and prolonged survival of mice after both i.v. and aerosol challenges with MTB. The identity of the tuberculosis resistance gene encoded within the sst1 locus and its precise function remain unknown. At this step, it is important to determine whether the sst1 effect is specific for MTB and whether this locus controls innate or adaptive immunity to an intracellular pathogen(s).

Infection of mice with Listeria monocytogenes is widely used for studies of innate and adaptive immunity (12, 13, 14). Intravenous challenge with this pathogen causes acute disseminated infection, and inbred mouse strains differ in their ability to control the acute primary infection (15, 16). Previously, deficiency of the C5 component of complement, located on mouse chromosome 2, was found to influence the susceptibility of some mouse strains (17, 18). More recently, genetic studies of differential sensitivity to infection with L. monocytogenes using BALB/cByJ and C57BL/6ByJ strains of mice identified two resistance loci on chromosomes 5 and 13 (19). In addition, in those studies a minor locus was mapped to a distal part of chromosome 1, in close proximity to the sst1 locus.

In this study we assessed whether alleles of sst1 could affect natural host resistance to L. monocytogenes. Natural resistance to systemic infection with L. monocytogenes was tested using a set of sst1 congenic strains on a scid background. Mice that carry the scid mutation lack mature T and B cells because of an inactivating mutation in the DNA-activated protein kinase Prkdc gene (20, 21). We have found that the resistant allele of sst1 (sst1B6) confers an increase in resistance to L. monocytogenes, especially in the scid background, where the effects of the adaptive immune response are greatly, if not completely, removed. These findings establish that the sst1 locus controls innate immunity, and its effect is independent of the function of T and B cells in the L. monocytogenes model in vivo. We have also demonstrated that the presence of the B6-derived resistant allele at the sst1 locus (sst1B6) correlates with the superior ability of the congenic bone marrow-derived macrophages to kill the bacteria in vitro. Activation of macrophages by IFN-{gamma} before infection was necessary to reveal the effect of the sst1 locus in vitro. The effect of the sst1 locus correlated with higher production of reactive oxygen intermediates (ROI) by the sst1B6 (resistant) macrophages, and the sst1-dependent killing of L. monocytogenes in our model was mediated by ROIs, but was not dependent on NO production.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals

C3HeB/FeJ, C3Smn.CB17-Prkdcscid/J mice were obtained from The Jackson Laboratory (Bar Harbor, ME). The C3H.B6-sst1 and C3H.B6-sst1,scid mouse strains were generated in our laboratory. The C3H.B6-sst1 mice were obtained by introgression of an ~20-cM interval of C57BL/6J-derived chromosome 1 (43–64 cM) encompassing the mouse tuberculosis susceptibility locus sst1 (11) on the C3HeB/FeJ genetic background using 10 backcrosses.4 To obtain the C3H.B6-sst1,scid mouse strain, C3HSmn.C-Prkdcscid/J mice that carry the scid mutation in the Prkdc gene on the C3H genetic background were crossed to C3H.B6-sst1 mice. The resulting F1 hybrids were backcrossed on the C3HSmn.C-Prkdcscid, and the backcross progeny were intercrossed to produce immunodeficient C3H.B6-sst1,scid mice homozygous for both the resistant allele at the sst1 locus and a mutant allele of the Prkdc gene. The abbreviations used for the congenic inbred strains used in this study are as follows: C3HeB/FeJ, C3H; C3Smn.CB17-Prkdcscid, C3H-scid; C3H.B6-sst1, C3H-sst1B6; and C3H.B6-sst1,scid, C3H-sst1B6,scid. Mice were housed under specific-pathogen-free conditions in barrier animal facilities at the Harvard Medical School and were provided autoclaved chow and water ad libitum. All experiments were performed with the full knowledge and approval of the standing committee on animals at Harvard Medical School.

Bacterial strains

In this study virulent L. monocytogenes strain 10403S was used for in vivo infection and in vitro experiments, and a listeriolysin O (LLO) mutant strain of L. monocytogenes containing in-frame deletion of the hly gene (DP-L2161) was used for in vitro experiments (22). Bacteria were stored as frozen aliquots at ~108 CFU/ml.

Infection of mice and determination of the bacterial load

Before infection, a frozen aliquot of L. monocytogenes strain 10403S was thawed, diluted 10-fold in tryptic soy broth medium (Difco, Detroit, MI), and recovered at 37°C for 1 h and 15 min. The resulting bacterial culture was diluted 200-fold in sterile PBS to obtain 3–10 x 104 CFU/ml. Three hundred microliters of diluted culture containing 1–3 x 104 CFU of L. monocytogenes was injected via lateral tail vein. The dose of bacteria allowing reliable differentiation between resistant C57BL/6J and susceptible animals of the C3H background was determined in a dose-response experiment. Intravenous infection of animals by tail vein injection of 1–3 x 104 CFU of L. monocytogenes 10403S led to death of C3HeB/FeJ, C3H/HeJ, and C3H.SmnJ mice at ~94 h, whereas all animals of the C57BL/6ByJ background were able to recover. Our observation schedule defined an 8-h window for determination of the death time point. Livers and spleens of infected animals were harvested at defined time points. Before organ harvest, infected animals were euthanized by CO2 asphyxiation. Spleens and 0.3-g fragments of liver were removed using a sterile technique and were placed in 2.5 ml of sterile 0.02% Nonidet P-40. After determination of the precise weight of the removed tissue, cell lysis was induced by homogenization using a Polytron homogenizer (Brinkmann Instruments, West Orange, NJ). Five microliters of tissue homogenates and serial 5-fold dilutions were plated in triplicate on TSB agar (Difco) plates containing 100 µg/ml streptomycin. After overnight incubation, the number of bacteria per milligram of tissue was determined by counting colonies at the appropriate dilution.

Histology

Livers and spleens were removed aseptically after death from infected animals and were fixed in 10% buffered formalin. The sections were prepared and stained with H&E according to established techniques at the Harvard Rodent Histopathology Core Facility.

FACS analysis

Splenocyte isolation. For FACS analysis, mice were infected with 1 x 105 L. monocytogenes i.v. Single cell suspensions were prepared from the spleens 48 h after the infection. The spleens were removed, and half of each spleen was fragmented in 5 ml of DMEM containing 1% FCS, followed by filtration through a 100-µm pore size mesh cell strainer (BD Biosciences, Mountain View, CA) to obtain a single-cell suspension. The suspension was treated with ACK lysis buffer (Quality Biological, Gaithersburg, MD) to remove erythrocytes and was washed three times in PBS supplemented with 1% FCS. The viability of the cells, as determined by trypan blue exclusion, was >98%.

Peritoneal exudate cell (PEC) isolation. Mice were infected with 106 CFU of L. monocytogenes i.p. as previously described (23). Cells were isolated from peritoneal cavity of mice 6 h after the infection by flushing with 10 ml of PBS plus 5 µg/ml gentamicin. Cells were stained with Gr-1, Ly-6C-specific Abs. For the analysis of superoxide anion production by myeloid cells in vivo, PECs isolated from the infected mice were stained with hydroethidine (HE; described below), either alone or in combination with Gr-1-specific (clone RB6-8C5) and Ly6C-specific (clone AL-21) mAbs, as described below.

Surface staining for FACS analysis. Cells were washed in PBS containing 0.05% BSA and 0.01% NaN3 and were incubated for 30 min at 4°C in the same buffer containing FcR-blocking Ab (CD16/CD32; BD Pharmingen, San Diego, CA). After an additional wash, cells were triple-stained with directly or indirectly conjugated Abs according to the manufacturer’s instructions. All Abs, except Tri-color-anti-F4/80 (Caltag Laboratories, Burlingame, CA), were purchased from BD Pharmingen: FITC-anti-CD4, FITC-anti-B220/CD45R, FITC-anti-CD8a, FITC-anti-Gr1, FITC-anti-CD11c, FITC-anti-F4/80, PE-anti-CD3, PE-anti-CD11b, PerCP-anti-CD8, biotin-anti-NK, biotin-anti-I-A, and PerCP-anti-streptavidin. Stained cells were washed three times with PBS containing 0.05% BSA and 0.01% NaN3, fixed in PBS containing 2% paraformaldehyde, and analyzed using a FACSCalibur flow cytometer (BD Biosciences). The absolute numbers of cells in individual populations were calculated by multiplication of the absolute number of cells per organ by the percentage of corresponding cells in the total population, as determined by FACS.

Quantitation of cytokine mRNA expression in vivo by real time RT-PCR

RNA was isolated from the spleens of L. monocytogenes-infected and noninfected C3H-scid and C3H.sst1B6,scid mice. Spleens were aseptically removed and snap-frozen in liquid nitrogen. Frozen organs were homogenized using a Polytron homogenizer (Brinkmann Instruments, West Orange, NY) in TRIzol (Invitrogen Life Technologies, Carlsbad, CA) according to the TRIzol protocol for isolation of RNA from tissues. Isolated RNA was dissolved in 50 µl of RNase-free water (Ambion, Austin, TX). DNase treatment of RNA was then performed using an RNeasy Mini kit according to the manufacturer’s protocol (Qiagen, Valencia, CA). RNA integrity was checked by running denatured samples on a formaldehyde gel. After DNase I treatment and cleanup, 2 µg of RNA/sample was reverse transcribed to cDNA using an Ambion RETROscript kit. The cDNA was diluted 1/25 in nuclease-free H2O to use in quantitative PCR.

Quantitative PCR was performed on each sample in duplicate for each gene using a 50-µl reaction mixture with SYBR Green as the reporter. Hypoxanthine phosphoribosyltransferase (HPRT) was used as an internal standard, and known dilutions of control RNA were also run to test the efficiency of each primer during the reaction. Each reaction mixture contained the following reagent concentrations: 1.25 U ABI AmpliTaq Gold (Applied Biosystems, Foster City, CA), ABI 1x PCR buffer (2.5 mM MgCl2, 0.125 mM dNTPs, and 0.25 nM primers), 1/60,000 dilution of 10,000x SYBR Green nucleic acid stain (FMC Bioproducts, Rockland, ME), and 5 µl of cDNA sample. The reaction was run using DNA Engine Opticon 2 (MJ Research, Cambridge, MA). After denaturation at 95°C for 10 min, a three-step PCR cycle was used as follows: 95°C for 20 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min for 35 cycles, followed by a 5-min extension at 72°C. Because nonspecific fluorescence reporter was used, DNA was run on an agarose gel to confirm the presence of a single band to ensure accurate results. The threshold cycle of each sample was obtained using MJ Research Opticon 2 software by subtracting the baseline fluorescence from each sample’s curve and measuring the threshold cycle slightly above the threshold of the curve. Relative values of expression between samples were then calculated using the standard curve of diluted samples representing the efficiency of each primer pair, corrected by expression values of the internal control, HPRT.

Primers were designed to produce an ~100-bp product and to have an annealing temp of 55–60°C. The following primer sequences were used: IFN-{gamma}: forward, ACAGCACTCGAATGTGTCAGGTAG; reverse, TTCAGCTGTATAGGGAAGCACCAG; TNF-{alpha}: forward, GCACCACCATCAAGGACTCAAATG; reverse, ATTCTGAGACAGAGGCAACCTGAC; IL-10: forward, GCTTCTATTCTAAGGCTGGCCACA; reverse, TAGGAGCTCTGAACTCAGGGATGA; IL-12p40: forward, GTGGGAGCTGGAGAAAGACGTTTA; reverse, TCATCTTCTTCAGGCGTGTCACAG; and HPRT: forward, TACGAGGAGTCCTGTTGATGTTGC; reverse, GGGACGCAGCAACTGACATTTCTA.

Infection of murine bone marrow-derived macrophages (BMDM) in vitro

BMDM were isolated from femurs and tibias of male C3H and C3H.B6-sst1 mice (6–10 wk old). The cells were grown in a complete culture medium (1/1 mix of DMEM and Ham’s F-12 (HyClone, Logan, UT)) supplemented with 10% of FCS (HyClone), 1 ng/ml rIL-3 (Sigma-Aldrich, St. Louis, MO), and 20% L929 fibroblast-conditioned medium as a source of M-CSF in 75-cm2 tissue culture flasks (Falcon; BD Biosciences, Franklin Lakes, NJ) for 2 days for enrichment of macrophage precursors and depletion of mature adherent cells. Cells were collected and seeded onto circular 12-mm diameter glass coverslips placed in a 60-mm diameter petri dish and differentiated into macrophages in medium containing 40% L929 fibroblast-conditioned medium for 4 days, and maintained in complete medium containing 20% L929 fibroblast-conditioned medium. Cells were stimulated with 50 U/ml murine rIFN-{gamma} (R&D Systems, Minneapolis, MN) 18 h before infection. Macrophage monolayers were infected with L. monocytogenes for 30 min at a multiplicity of infection (MOI) of one bacterium per 10 macrophages (MOI, 1:10). After 30 min, the cells were washed with PBS containing 1% FCS (PBS-1% FCS) and incubated for an additional 30 min in complete medium without antibiotics to allow for internalization of the bacteria. After that, the cells were incubated in complete medium containing 10% FCS and 20% L929-conditioned medium and gentamicin (10 µg/ml). Three coverslips were removed from the culture at appropriate time intervals and separately placed in 15-ml conical polypropylene tubes containing 5 ml of sterile distilled H2O with 0.1% Triton X-100. The tubes were vortexed for 15 s to lyse macrophages, and dilutions of lysates were plated on Luria-Bertoni agar to determine the number of intracellular bacteria. The colonies were counted after 24-h incubation at 37°C. Macrophage monolayers were stained using Diff-Quik (VWR, West Chester, PA) directly on coverslips.

Superoxide anion and NO production by BMDM

To measure nitrite production in vitro, 50 µl of culture supernatants were mixed with 50 µl of Griess reagent (N-1-naphthylethylenediamine hydrochloride (0.1%); Sigma-Aldrich) and prepared with distilled water, and 1% sulfanilamide (Sigma-Aldrich) was prepared with 5% H3PO4 as described previously (24). Absorbance was measured after 10 min at 550 nm in an ELISA microreader (Molecular Devices, Sunnyvale, CA). A standard curve of NaNO2 was used to establish the NO2 concentration in the samples.

Superoxide anion production was measured by FACS using oxidation of HE (Molecular Probes, Eugene, OR). HE is a nonfluorescent lipophylic molecule that is oxidized by superoxide anion alone or by hydrogen peroxide in the presence of peroxidases to produce ethidium, which is a hydrophilic fluorescent compound (25). The stock solution of HE was prepared in N,N-dimethylformamide (ICN Biochemicals, Cleveland, OH). To determine superoxide anion production by BMDM, coverslips containing infected macrophages were transferred into 24-well plates containing medium with 2.5 µM HE (Molecular Probes) for 15 min at 37°C at the indicated time points after infection. After incubation, the cells were removed with cold PBS-EDTA (0.37 mg/ml), and the ethidium fluorescence was determined in a FACSCalibur (BD Biosciences, Mountain View, CA) using CellQuest software (BD Biosciences).

Inhibitors

To inhibit superoxide production, BMDM were treated with superoxide dismutase (SOD; 100 U/ml; Sigma-Aldrich) and N-acetyl-L-cysteine (NAC; 10 µM; Sigma-Aldrich) for the duration of infection. Aminoguanidine hemisulfate (AMG; 2 mM; Sigma-Aldrich) and NG-monomethyl-L-arginine (NGMMA; 10 µM; Sigma-Aldrich) were used to inhibit NO production.

Statistical analysis

Bacterial burdens were compared using Student’s t test (PRISM 4; GraphPad, San Diego, CA). Cytometric analyses were made using the Windows Multiple Document Interface (WinMDI, from http://facs.scripps.edu/) software (release 2.8). All in vitro experiments were performed in triplicate and independently repeated at least three times. Results are presented as the mean ± 95% confidence interval for the mean. Data were analyzed by ANOVA. Statistical significance was considered to be p < 0.05. For all analyses, Statgraphics Plus (release 2, 1996; Statgraphics, Rockville, MD) was used.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The sst1 locus controls innate immunity to L. monocytogenes

The sst1 locus controls multiplication of L. monocytogenes and lesion morphology in vivo. According to the literature, the standard inbred strains of mice, C57BL/6 (B6) and C3H, can be classified as relatively resistant to i.v. infection with L. monocytogenes compared with the genetically susceptible BALB/c inbred strain (19). Thus, in our experiments the effect of the sst1 locus was studied on a relatively resistant genetic background (C3H). The bacterial loads in the livers and spleens of an sst1-congenic pair of inbred strains C3H (sst1-susceptible) and C3H-sst1B6 (sst1-resistant) were determined at 48 and 72 h after i.v. infection with 1–3 x 104 CFU of L. monocytogenes in three independent experiments. We observed three to eight times lesser bacterial loads in the spleens and livers of the sst1-resistant congenic mice C3H-sst1B6 compared with the sst1-susceptible C3H mice (data not shown). However, the bacterial burden even in the sst1-susceptible C3H mice was much less than that in susceptible BALB/c inbred mice infected with a similar dose of the bacteria. Thus, the sst1-attributable difference in immunocompetent C3H mice was small, but statistically significant, and was reproducible in three independent experiments.

To test the role of the sst1 locus in innate immunity, we have generated a pair of the sst1 congenic inbred strains that also carry the scid mutation, C3H-scid and C3H-sst1B6,scid (see Materials and Methods). These strains were infected with 1 x 104 CFU of L. monocytogenes i.v. As shown in Fig. 1, the bacterial loads in the spleens and livers 72 h after i.v. infection were 500- to 1000-fold less in the organs of the sst1-resistant scid mice (C3H-sst1B6,scid). A similar difference was observed at 48 h in an independent experiment using the same strains and dose of infection. In this experiment, histologic sections of liver and spleen 48 h after i.v. challenge were compared in addition to CFU counts. Representative findings are shown in Fig. 2. Histologic sections of liver contained 6–17 microabscesses/representative cross-section in C3H-scid animals (Fig. 2A). At these foci, there were central zones of necrosis containing inflammatory cells as well as tissue debris. Often there were intact neutrophils on the periphery or adjacent to the necrotic foci. In contrast, three of four C3H-sst1B6,scid mice had no microabscess formation, whereas one mouse had only a single microabscess (Fig. 2B). Representative splenic tissue from four C3H-scid mice contained multiple microabscesses similar in appearance to those seen in liver (Fig. 2C), whereas no microabscesses were noted in splenic tissue from four C3H-sst1B6,scid mice (Fig. 2D). Thus, formation of the necrotic lesions in spleens and livers was a hallmark of L. monocytogenes infection in sst1-susceptible scid mice (C3H-scid).



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 1. Bacterial loads in organs of the sst1-susceptible C3H-scid and the sst1-resistant C3H-sst1B6,scid immunodeficient mice 72 h after i.v. infection with 1 x 104 CFU of L. monocytogenes (p < 0.05).

 


View larger version (171K):
[in this window]
[in a new window]
 
FIGURE 2. Resistant allele of the sst1 prevents formation of abscesses in the livers and spleens of L. monocytogenes-infected scid mice. Histologic sections of livers (A and B) and spleens (C and D) of the C3H-scid (A and C) and C3H.B6-sst1,scid (B and D) mice 48 h after i.v. infection with 1 x 104 CFU of L. monocytogenes. H&E staining. Magnification, x100; insets in A and C, x400.

 
These results demonstrate that the sst1 polymorphism plays a role in control of L. monocytogenes infection. In the presence of the sst1-resistant allele, the development of massive necrosis in C3H-sst1B6,scid animals was prevented. However, prevention of the development of necrotic lesions might result from a direct effect of the sst1-encoded polymorphic gene on mechanisms of cell death or might be due to an indirect effect of the sst1 locus via more efficient control of L. monocytogenes by the sst1-resistant phagocytic cells. The sst1 contribution to host resistance is much more pronounced in immunodeficient scid animals. From the genetic perspective, this phenomenon can be described as an interaction of the scid and the sst1 genetic loci, in which phenotypic expression of the sst1 locus is enhanced by the scid mutation.

The sst1 locus does not correct the T and B lymphocyte deficiency conferred by the scid mutation. Next, we determined whether the sst1 polymorphism might affect the phenotypic expression of the scid mutation. Despite the mutation in Pkrdc, low numbers of T and B lymphocytes might be present in C3Smn.CB17-Prkdcscid (C3H-scid) mice, due to the "leakiness" of the scid mutation (26, 27). To address the possibility that the presence of the B6-derived resistant allele at the sst1 locus alleviated the effect of the scid mutation and thus increased the resistance to the infection, we tested the sst1-congenic scid mice (Materials and Methods) for the presence of T and B cells before and after infection with L. monocytogenes. The numbers of T and B lymphocytes in the spleens and peripheral blood of noninfected sst1 congenic scid mice were similar and greatly diminished compared with their immunocompetent counterparts. As shown in Table I, the proportion of CD3+ T cells in the total population of splenocytes in noninfected mice was 0.5–1%, i.e., reduced 50- to 100-fold as compared with that in normal immunocompetent mice. The number of B220-positive cells, of which B cells are a dominant subset, was also drastically reduced.


View this table:
[in this window]
[in a new window]
 
Table I. Proportion of lymphoid populations in the spleens of the sst1 congenic scid mice before and after infection with 1 x 105 CFU of L. monocytogenesa

 
After infection with L. monocytogenes, the proportion of CD3-positive cells slightly increased (Table I). However, no statistically significant differences in the numbers of total and activated (CD69-positive) T cells were observed between the sst1-resistant and the sst1-susceptible scid mice. We concluded that the increased resistance to L. monocytogenes of the sst1-resistant scid mice was not due to correction of the immunodeficiency conferred by the Pkrdc mutation.

Taken together, our results demonstrated that the sst1 polymorphism plays a role in control of L. monocytogenes infection, and its contribution to host resistance is much more pronounced in immunodeficient scid animals. Therefore, the sst1 locus mediates a mechanism(s) of innate immunity to this pathogen. A subsequent series of experiments was performed to identify the cellular mechanism(s) of the sst1 action.

Effects of the sst1 locus on inflammatory cells in vivo

Activation of NK cells is not affected by the sst1 allelic polymorphism. IFN-{gamma}-producing NK cells and phagocytic myeloid cells are known to be the major cell types that contribute to control of L. monocytogenes in scid mutants (28, 29, 30, 31). Therefore, we determined whether there were any differences between the sst1-resistant and -susceptible scid mice in the numbers or activation status of corresponding cell types in vivo. The proportion of Dx5+CD3 NK cells in the spleens were similar in noninfected sst1 congenic scid mice, and the total numbers of NK cells in the spleens did not significantly increase after infection (Table I). However, we have observed a significant increase in activated Dx5+CD69+ NK cells 48 h after infection (Table I). At that time, the proportion of the CD69+ activated NK cells in the total pool of NK cells increased from ~40 to 77% and became significantly higher in the sst1-susceptible scid mice compared with the sst-resistant congenics (p < 0.002; Table I). In the scid mice, activated NK cells are major producers of IFN-{gamma}, which is necessary for activation of listeriocidal activity of phagocytic cells (32). Determination of levels of IFN-{gamma} mRNA expression in the infected spleens of the sst1 congenic scid mice demonstrated that the sst1-susceptible splenocytes expressed significantly higher levels of mRNA encoding this cytokine. Although the absolute numbers of activated (CD69+) NK cells was only 2-fold higher in the sst1-susceptible mice, the IFN-{gamma} mRNA levels in the spleens of those mice were ~6-fold higher (Table II), which probably reflects higher bacterial loads in the susceptible animals at this time. These data suggest that in both genetic backgrounds, NK cells become activated and are capable of producing IFN-{gamma} after L. monocytogenes infection in vivo. Therefore, the availability of IFN-{gamma} for macrophage activation is not likely to be affected by the sst1 polymorphism. We hypothesized that the sst1 locus may, instead, affect the responsiveness of phagocytic cells to this cytokine or other inflammatory mediators.


View this table:
[in this window]
[in a new window]
 
Table II. Induction of cytokine mRNA expression in spleens of the sst1 congenic scid mice 48 h after i.v. infection with 1 x 105 CFU of L. monocytogenesa

 
Recruitment and activation of phagocytic cells in vivo. Levels of mRNA expression of several cytokines were used to monitor the functional status of inflammatory myeloid cells in spleens of the infected sst1 congenic scid mice in vivo. The levels of TNF-{alpha}, IL-10, and IL-12 mRNAs were increased in the spleens as a result of infection (Table II). The expression of TNF-{alpha} and IL-12mRNAs was several-fold higher in the spleens of the sst1-susceptible scid mice. The expression of IL-10 mRNA was also higher in the infected spleens, but the differences between the resistant and susceptible congenic mice were not statistically significant due to high individual variation in the expression of this cytokine (Table II). Therefore, the effect of the sst1 locus could not be accounted for by decreased levels of protective (TNF-{alpha} and IL-12) or increased levels of suppressive (IL-10) cytokines in the susceptible animals. The higher expression of IFN-{gamma}, TNF-{alpha}, IL-10, and IL-12 is, perhaps, a function of a higher bacterial burden in the susceptible animals. This approach does not allow measurement of the production of these cytokines at the individual cell level. However, it does demonstrate that there is no overt deficiency of these cytokines that might explain the dramatic differences in susceptibility to L. monocytogenes conferred by the sst1 locus on the scid genetic background.

To test whether the sst1 polymorphism affected recruitment of phagocytic cells to the site of infection and their activation in vivo, we have performed experiments in which the sst1 congenic scid mice were infected i.p. with 106 CFU of L. monocytogenes. The inflammatory cells were isolated 6 h after the infection and analyzed by FACS for the myeloid lineage-specific surface markers and production of ROIs (Fig. 3). The composition of resident peritoneal cells in noninfected mice was identical on both genetic backgrounds, and the majority of the cells were represented by Ly6C,Gr-1low resident macrophages (Fig. 3A, gate R2), which also were F4/80+ (not shown). Rapid recruitment of inflammatory cells to the peritoneal cavity at 6 h postinfection was detected on both genetic backgrounds (Fig. 3B). The inflammatory cells were represented mostly by Gr-1highLy6C neutrophils (gate R3) and Ly6C+,Gr-1low monocytes (gate R1). Influx of granulocytes and monocytes at 6 h was similar in the sst1-resistant and -susceptible mice. At later time points, more neutrophils were present in the sst1-susceptible mice (data not shown). We also studied recruitment of neutrophils to the spleens after systemic i.v. infection and found no defect in neutrophil recruitment to the spleens in sst1-susceptible animals (data not shown).



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 3. Recruitment of inflammatory cells and production of ROIs by the inflammatory cells after i.p. infection with L. monocytogenes. The sst1-congenic scid mice were infected with 1 x 106 Listeria i.p. Six hours later, PEC were collected by flashing with cold PBS containing gentamicin (5 µg/ml). Cells (1 x 106) were stained with HE and/or Ly6C- and Gr-1-specific Abs. The production of superoxide anion was analyzed in the indicated gates. We have determined in a separate experiment using four-color FACS analysis with lineage-specific markers that R1-gated (Gr-1low,Ly6Chigh) and R2-gated (Gr1low,Ly6Cneg) populations corresponded to monocytes and macrophages, respectively, and neutrophils were in the R3 population (Gr1high,Ly6Cneg).

 
To assess early activation of different populations of inflammatory myeloid cells, we isolated PEC from the i.p. infected scid animals and measured the production of superoxide by HE staining in combination with lineage-specific markers Gr-1 and Ly-6C (Fig. 3B). We observed that the highest level of ROI production was by neutrophils (gate R3); however, it was identical on both genetic backgrounds. On the contrary, both the resident macrophages (gate R2) and the newly recruited monocytes (gate R3) produced higher levels of ROIs in the sst1-resistant mice. From these data we concluded that the sst1-resistant macrophages were activated more readily at early times postinfection, and the effect of the sst1 locus on innate immunity was due to differential activation of macrophages for bactericidal or bacteriostatic activities.

The sst1 locus controls activation of macrophages for killing of L. monocytogenes by BMDM in vitro

To investigate the role of the sst1 polymorphism in controlling intrinsic macrophage functions, we tested highly purified BMDM isolated from mice that differed at the sst1 locus, C3H and C3H-sst1B6. Those macrophages were obtained from immunocompetent mice, because there was no possibility of contamination with T or B lymphocytes in our cultures (see Materials and Methods). In one experiment, BMDM obtained from a pair of the sst1 congenic scid mice were tested, and the results were identical with those obtained using macrophages obtained from immunocompetent mice (M. Rojas, unpublished observations).

The sst1 locus controls IFN-{gamma}-inducible ability of macrophages to kill L. monocytogenes. BMDM obtained from the sst1 congenic C3H and C3H.B6-sst1 mice were infected with L. monocytogenes in vitro (Fig. 4). The macrophages were either naive or pretreated with rIFN-{gamma} for 18 h before the infection. The experiments were performed at a low MOI of approximately one bacterium per 10 macrophages in the presence of a bacteriostatic concentration of gentamicin (Materials and Methods) to inhibit extracellular multiplication of the bacteria. The rate of bacterial multiplication in nontreated BMDM was equal regardless of the macrophage sst1 genotype (Fig. 4A, {square} and {circ}). Pretreatment of macrophages with IFN-{gamma} decreased the bacterial loads on both genetic backgrounds. At 2 and 4 h postinfection, the bacterial load of corresponding macrophage cultures was equal on both genetic backgrounds (Fig. 4A, {blacksquare} and •). A statistically significant difference in bacterial loads between the IFN-{gamma}-treated sst1 congenic macrophages was first observed 6 h after infection, and the difference was highly significant 8–24 h after infection.



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 4. Intracellular growth of L. monocytogenes in BMDM obtained from the sst1 congenic susceptible (C3H) and resistant (C3H-sst1B6) mice. A, Macrophages were infected with wild-type L. monocytogenes 10403S at an MOI of one bacterium per 10 macrophages; B, macrophages were infected with an LLO mutant of L. monocytogenes at an MOI of 1:10. Intracellular bacteria (y-axis) were enumerated at the indicated time points (x-axis). A statistically significant difference is indicated: *, C3H vs C3H plus IFN-{gamma}, p < 0.05; **, C3H plus IFN-{gamma} vs C3H.B6-sst1 plus IFN-{gamma} (C3H-sst1B6), p < 0.01.

 
To determine whether the sst1 affects bactericidal or bacteriostatic activity of IFN-{gamma}-treated macrophages, we performed similar experiments using the LLO mutant of L. monocytogenes. This mutant has been shown to remain in the phagosome and is therefore unable to multiply intracellularly (33, 34). If the host cell does not kill the microorganism, the number of intracellular mutant bacteria remains constant, but it will decrease due to bactericidal effects displayed by the host cells. The experiments presented in Fig. 4B demonstrated that BMDM pretreated with IFN-{gamma} (50 U/ml) acquired bactericidal activity. Initially, this activity appeared to be independent of the sst1 allelic polymorphism, because ~90% of LLO-L. monocytogenes were eliminated by the IFN-{gamma}-activated macrophages of both genetic backgrounds. These data are in agreement with our observations using the wild-type bacteria described above. However, at 6 h postinfection, sst1-resistant macrophages demonstrated superior bactericidal activity, and the number of viable bacteria inside sst1-resistant macrophages continued to decline until the end of the experiment at 24 h postinfection. In contrast, the number of LLO mutant bacteria did not decrease significantly in the sst1-susceptible, IFN-{gamma}-treated macrophages between 2 and 24 h postinfection (Fig. 4B).

Production of ROI, but not production of NO, is responsible for differential killing of L. monocytogenes by the IFN-{gamma}-activated, sst1 congenic macrophages in vitro

To identify the effector mechanism that accounts for differential killing of L. monocytogenes by the sst1 congenic macrophages in vitro, we used inhibitors of NO and scavengers of ROI. As shown in Fig. 5A, inhibitors of ROI (NAC and SOD; see Materials and Methods) significantly reduced killing of the bacteria by the IFN-{gamma}-treated macrophages, whereas the inhibitors of NO production (AMG and NGMMA) had no effect. Moreover, differential killing of the bacteria by the IFN-{gamma}-treated sst1 congenic macrophages was preserved in the presence of NO inhibitors and was completely ablated by the inhibitors of ROIs. These findings are consistent with greater production of ROIs by the sst1-resistant peritoneal macrophages in vivo, as described above (Fig. 3B).



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 5. Intracellular growth of L. monocytogenes (A) and NO production (B) by BMDM obtained from the sst1 congenic susceptible (C3H) and resistant (C3H-sst1B6) mice in the presence of NO and ROI inhibitors. The inhibitors of NO (AMG and NGMMA) and ROI (NAC and SOD) were added at the indicated concentrations for the duration of infection (24 h): SOD, 100 IU/ml; NAC, 10 µM; AMG, 2 mM; and NGMMA, 10 µM (see also Materials and Methods).

 
Next we wanted to determine whether differential production of ROIs by the sst1 congenic macrophages infected with L. monocytogenes was macrophage cell autonomous. Therefore, we determined the kinetics of ROI production by BMDM after infection in vitro. As shown in Fig. 6, nontreated macrophages, which were unable to control the bacterial multiplication, produced the lowest amount of ROIs. The IFN-{gamma}-pretreated sst1-resistant and -susceptible macrophages produced equal amounts of ROIs 2 h postinfection and killed approximately the same proportion of the initial bacterial inoculum. At 2 h, the proportion of macrophages producing ROI, as determined by FACS analysis, was ~16%, i.e., roughly equal to the proportion of the infected macrophages at a 1:10 MOI, which was used in this experiment. At 8 h postinfection, however, a significant difference between the IFN-{gamma}-treated, sst1 congenic macrophages was observed in both the amount of ROI per cell, as determined by the mean fluorescence intensity (x-axis; p < 0.001), as well as the number of ROI-producing cells (y-axis; p < 0.001). Of note, the proportion of ROI-producing cells among the IFN-treated macrophages was considerably higher than the number of L. monocytogenes-infected macrophages, as determined by differential staining of macrophage monolayers, indicating that the sst1-dependent activity may be mediated by soluble mediators.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 6. Production of superoxide anion by BMDM obtained from the sst1 congenic mice C3H and C3H.B6-sst1 (C3H-sst1B6) was measured at 0, 2. and 8 h after infection in vitro. Untreated or IFN-{gamma}-treated BMDM were infected with wild-type L. monocytogenes at an MOI of 1:10. At the indicated time points the cells were incubated for 15 min with HE before FACS analysis, as described in Materials and Methods. The x-axis shows ethidium fluorescence (FL3).

 
The above experiments using purified macrophage populations indicate that the effect of the sst1 polymorphism can be expressed by macrophages in a cell autonomous manner. The Prkdcscid mutation is not necessary for phenotypic expression of sst1-mediated macrophage function.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Genetic studies of host susceptibility to infections in experimental models as well as in human populations have demonstrated that host resistance to a number of intracellular pathogens is a complex genetic trait (reviewed in Ref. 7). The contribution of an individual polymorphic genetic locus to host defense may vary with the virulence strategy of a particular pathogen, the nature of a genetic polymorphism (quantitative vs qualitative effects), its interaction with other polymorphic host genes, and environmental factors.

Similarities in genetic control may reveal new pathogenic mechanisms shared by dissimilar microorganisms. Genetic polymorphisms controlling innate mechanisms of resistance to several intracellular pathogens have been identified previously (35, 36). Sometimes those polymorphisms control resistance to several taxonomically unrelated pathogens (37, 38). Perhaps this is a result of common pathogenic mechanisms used by different microorganisms. For example, the Slc11a1 gene (formerly known as Nramp1) encodes a member of the proton-coupled divalent metal ion transporter family that is recruited to the bacterial phagosome (39). Several intracellular bacteria (Mycobacterium bovis BCG, Mycobacterium lepraemurium, and Salmonella typhimurium) and protozoa (Leishmania donovani) that are known to reside and multiply within the phagocytic vacuole are affected by the Slc11a1 polymorphism. However, pathogens that are capable of destroying the phagosomal membrane, such as L. monocytogenes, and gain access to the cytoplasm of the host cell are unlikely to be dependent on this transporter; indeed, the Slc11a1 polymorphisms do not affect intracellular multiplication of L. monocytogenes.

In this study we have determined that genetic polymorphism at the sst1 locus, which has been identified by our group as a genetic determinant of host resistance to tuberculosis, significantly affects natural host resistance to L. monocytogenes. To elucidate the cellular mechanism of sst1-mediated resistance, we have generated a pair of the sst1 congenic strains that lacked mature lymphocytes by introducing the sst1-resistant allele from C3H-sst1R into the C3H-scid mouse strain, in which maturation of T and B lymphocytes is disrupted by a mutation in the Prkdc gene. The scid mutation confers a very high degree of susceptibility to virulent MTB and eliminates the effect of the sst1 locus on host resistance to this pathogen. However, during primary infection with L. monocytogenes (40) within the initial 3-day period, the infection is primarily controlled by mechanisms of innate immunity, and no help of T and B lymphocytes is necessary for the initial containment of the pathogen (12, 32, 41). Adaptive immunity is implicated in clearance of the bacteria at later time points as well as in the recall response (42, 43). The ability to control L. monocytogenes infection within the first 2–3 days after primary infection serves as a classical test of macrophage function (13, 44). In our studies, systemic infection of sst1 congenic scid mice with a sublethal dose of L. monocytogenes demonstrated a very significant effect of the sst1 locus. In contrast to MTB infection, the effect of the sst1 locus was not only preserved on the scid genetic background, but its effect was markedly enhanced compared with that in mice that carry the wild-type allele of the Pkrdc gene. These data suggest that the sst1 locus controls a mechanism of innate immunity that is responsible for clearance of L. monocytogenes in scid mice.

Neutrophils, NK cells, and macrophages are the major effector cells of innate immunity to L. monocytogenes (45). It has been demonstrated that in scid mice protection is mediated by IFN-{gamma}, which is produced by NK cells. The NK cell-generated IFN-{gamma} activates macrophages, which clear the bacteria. Neutrophils represent the first line of defense against L. monocytogenes (45, 46). However, we found no evidence of neutrophil deficiency in sst1-susceptible scid animals. Instead, our data indicate that the sst1 locus affects the macrophage cell-autonomous mechanism of resistance. Experiments using the LLO mutant indicate that sst1 affects the ability of the macrophage to kill bacteria, and the effect of the sst1 locus in vitro was dependent on macrophage activation by IFN-{gamma}. Recently, we have found that the listeriocidal activity of the sst1-resistant macrophages was also induced more efficiently by type I IFNs, both {alpha} and {beta}, which contribute to early macrophage activation (M. Rojas, unpublished observation).

It has been demonstrated that IFN-{gamma}-activated BMDM and macrophage cell lines infected with L. monocytogenes become bactericidal (12) and produce TNF-{alpha}, IL-1{beta}, and IL-6 (47). These cytokines can also enhance the resistance to the pathogen when administered before infection (48), and their blockade increased the growth of bacteria (49). The mechanisms by which these cytokines modulate the growth of L. monocytogenes involve the production of toxic compounds, such as ROI, NO, and peroxynitrite (50). The mechanism of the sst1-mediated control of host resistance to L. monocytogenes appeared to be IFN-{gamma}-dependent, but NO-independent, because only treatment with scavengers of ROI (NAC and SOD) significantly increased bacterial multiplication in the resistant macrophages, whereas inhibition of NO production had no effect on sst1 function. However, production of ROIs may not be the only mechanism responsible for the sst1-mediated control of L. monocytogenes in vivo. The differences in ROI production may reflect differential activation of the sst1 congenic macrophages in general.

High bacterial loads in spleens and livers of sst1-susceptible scid mice correlated with the formation of necrotic lesions in these organs. Previously, it has been shown that the death of L. monocytogenes-infected murine BMDM follows the necrotic, not the apoptotic, pathway (51). More recently, signaling through type I IFNs was implicated in sensitizing macrophages to L. monocytogenes-induced cell death, which also requires production of LLO by the bacteria (52). Thus, both bacterial products and signals generated from within the host environment may participate in L. monocytogenes-induced cell death and may be counterbalanced by an unknown sst1-dependent mechanism in sst-resistant congenic mice. Formation of necrotic lesions in the lungs is also a hallmark of tuberculosis infection in sst1-susceptible mice. Thus, both intracellular pathogens, L. monocytogenes and MTB, share this pathogenic mechanism on the sst1-susceptible background. In both cases the presence of the sst1-resistant allele prevents formation of necrotic lesions. However, prevention of the development of necrotic lesions might result from a direct effect of the sst1-encoded polymorphic gene on mechanisms of cell death or might be due to an indirect effect of the sst1 locus via more efficient control of the intracellular pathogens by the sst1-resistant phagocytic cells.

We have observed that the importance of the sst1 locus in control of L. monocytogenes is greatly increased in the absence of adaptive immunity. It is not totally unexpected, because enhancement of several mechanisms of innate immunity to L. monocytogenes has been reported in scid mice. Until identification of the candidate gene(s) encoded within the sst1 locus, it may not be possible to determine whether this locus controls one of the known functions of myeloid cells or a novel mechanism of innate immunity. Understanding the sst1-mediated mechanism of innate resistance may suggest approaches to protect immunocompromised individuals, who are particularly susceptible to L. monocytogenes infection.

It is possible that there is a single gene encoded within the sst1 locus that controls common IFN-dependent macrophage function, which is important in the pathogenesis of infections caused by both MTB and L. monocytogenes. However, the host resistance to the two pathogens may also be controlled by two different polymorphic genes encoded within the sst1 locus. Ultimately, identification of the gene(s) that controls host resistance to intracellular pathogens within the sst1 locus will provide excellent candidates for study of a potential role in human infectious diseases.


    Acknowledgments
 
We are grateful to Drs. Barry R. Bloom and Michael Starnbach for helpful discussions.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grant R01AI49421 (to I.K.). Back

2 V.B. and M.R. contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Igor Kramnik, Department of Immunology and Infectious Diseases, Harvard School of Public Health, 667 Huntington Avenue, Building 1, Room 909, Boston, MA 02115. E-mail address: ikramnik{at}hsph.harvard.edu Back

4 Y. V. Shebzukhov, L. Kobzik, B. R. Bloom, and I, Kramnik. Control of anti-tuberculosis immunity in the lung by the mouse tuberculosis susceptibility locus sst1. Submitted for publication. Back

5 Abbreviations used in this paper: MTB, Mycobacterium tuberculosis; AMG, aminoguanidine hemisulfate; BMDM, bone marrow-derived macrophage; HE, hydroethidine; HPRT, hypoxanthine phosphoribosyltransferase; LLO, listeriolysin O; MOI, multiplicity of infection; NAC, N-acetyl-L-cysteine; NGMMA, NG-monomethyl-L-arginine; PEC, peritoneal exudate cell; ROI, reactive oxygen intermediate; SOD, superoxide dismutase. Back

Received for publication February 6, 2004. Accepted for publication August 13, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Skamene, E.. 1998. Genetic control of susceptibility to infections with intracellular pathogens. Pathol. Biol. 46:689.[Medline]
  2. Casanova, J. L., L. Abel. 2002. Genetic dissection of immunity to mycobacteria: the human model. Annu. Rev. Immunol. 20:581.[Medline]
  3. Hill, A. V.. 2001. The genomics and genetics of human infectious disease susceptibility. Annu. Rev. Genomics Hum. Genet. 2:373.[Medline]
  4. Kramnik, I., P. Demant, B. B. Bloom. 1998. Susceptibility to tuberculosis as a complex genetic trait: analysis using recombinant congenic strains of mice. Novartis Found. Symp. 217:120.[Medline]
  5. Bellamy, R., N. Beyers, K. P. McAdam, C. Ruwende, R. Gie, P. Samaai, D. Bester, M. Meyer, T. Corrah, M. Collin, et al 2000. Genetic susceptibility to tuberculosis in Africans: a genome-wide scan. Proc. Natl. Acad. Sci. USA 97:8005.[Abstract/Free Full Text]
  6. Skamene, E., E. Schurr, P. Gros. 1998. Infection genomics: Nramp1 as a major determinant of natural resistance to intracellular infections. Annu. Rev. Med. 49:275.[Medline]
  7. Kramnik, I., V. Boyartchuk. 2002. Immunity to intracellular pathogens as a complex genetic trait. Curr. Opin. Microbiol. 5:111.[Medline]
  8. Bellamy, R., A. V. Hill. 1998. Genetic susceptibility to mycobacteria and other infectious pathogens in humans. Curr. Opin. Immunol. 10:483.[Medline]
  9. Bellamy, R., C. Ruwende, T. Corrah, K. P. McAdam, H. C. Whittle, A. V. Hill. 1998. Assessment of the interleukin 1 gene cluster and other candidate gene polymorphisms in host susceptibility to tuberculosis. Tuber. Lung Dis. 79:83.[Medline]
  10. Bellamy, R., C. Ruwende, T. Corrah, K. P. McAdam, H. C. Whittle, A. V. Hill. 1998. Variations in the NRAMP1 gene and susceptibility to tuberculosis in West Africans. N. Engl. J. Med. 338:640.[Abstract/Free Full Text]
  11. Kramnik, I., W. F. Dietrich, P. Demant, B. R. Bloom. 2000. Genetic control of resistance to experimental infection with virulent Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. USA 97:8560.[Abstract/Free Full Text]
  12. Portnoy, D. A., V. Auerbuch, I. J. Glomski. 2002. The cell biology of Listeria monocytogenes infection: the intersection of bacterial pathogenesis and cell-mediated immunity. J. Cell Biol. 158:409.[Abstract/Free Full Text]
  13. North, R. J.. 1970. The relative importance of blood monocytes and fixed macrophages to the expression of cell-mediated immunity to infection. J. Exp. Med. 132:521.[Abstract]
  14. North, R. J., P. L. Dunn, J. W. Conlan. 1997. Murine listeriosis as a model of antimicrobial defense. Immunol. Rev. 158:27.[Medline]
  15. Cheers, C., I. F. McKenzie. 1978. Resistance and susceptibility of mice to bacterial infection: genetics of listeriosis. Infect. Immun. 19:755.[Abstract/Free Full Text]
  16. Stevenson, M. M., P. A. Kongshavn, E. Skamene. 1981. Genetic linkage of resistance to Listeria monocytogenes with macrophage inflammatory responses. J. Immunol. 127:402.[Abstract]
  17. Gervais, F., C. Desforges, E. Skamene. 1989. The C5-sufficient A/J congenic mouse strain: inflammatory response and resistance to Listeria monocytogenes. J. Immunol. 142:2057.[Abstract]
  18. Gervais, F., M. Stevenson, E. Skamene. 1984. Genetic control of resistance to Listeria monocytogenes: regulation of leukocyte inflammatory responses by the Hc locus. J. Immunol. 132:2078.[Abstract]
  19. Boyartchuk, V. L., K. W. Broman, R. E. Mosher, S. E. D’Orazio, M. N. Starnbach, W. F. Dietrich. 2001. Multigenic control of Listeria monocytogenes susceptibility in mice. Nat. Genet. 27:259.[Medline]
  20. Bosma, G. C., R. P. Custer, M. J. Bosma. 1983. A severe combined immunodeficiency mutation in the mouse. Nature 301:527.[Medline]
  21. Araki, R., A. Fujimori, K. Hamatani, K. Mita, T. Saito, M. Mori, R. Fukumura, M. Morimyo, M. Muto, M. Itoh, et al 1997. Nonsense mutation at Tyr-4046 in the DNA-dependent protein kinase catalytic subunit of severe combined immune deficiency mice. Proc. Natl. Acad. Sci. USA 94:2438.[Abstract/Free Full Text]
  22. Jones, S., D. A. Portnoy. 1994. Characterization of Listeria monocytogenes pathogenesis in a strain expressing perfringolysin O in place of listeriolysin O. Infect. Immun. 62:5608.[Abstract/Free Full Text]
  23. Edelson, B. T., E. R. Unanue. 2001. Intracellular antibody neutralizes Listeria growth. Immunity 14:503.[Medline]
  24. Green, L. C., D. A. Wagner, J. Glogowski, P. L. Skipper, J. S. Wishnok, S. R. Tannenbaum. 1982. Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids. Anal. Biochem. 126:131.[Medline]
  25. Rothe, G., G. Valet. 1990. Flow cytometric analysis of respiratory burst activity in phagocytes with hydroethidine and 2',7'-dichlorofluorescin. J. Leukocyte Biol. 47:440.[Abstract]
  26. Bosma, G. C., M. Fried, R. P. Custer, A. Carroll, D. M. Gibson, M. J. Bosma. 1988. Evidence of functional lymphocytes in some (leaky) scid mice. J. Exp. Med. 167:1016.[Abstract/Free Full Text]
  27. Bosma, M. J.. 1992. B and T cell leakiness in the scid mouse mutant. Immunodefic. Rev. 3:261.[Medline]
  28. Bancroft, G. J., J. P. Kelly. 1994. Macrophage activation and innate resistance to infection in SCID mice. Immunobiology 191:424.[Medline]
  29. Dunn, P. L., R. J. North. 1991. Early {gamma} interferon production by natural killer cells is important in defense against murine listeriosis. Infect. Immun. 59:2892.[Abstract/Free Full Text]
  30. Huang, S., W. Hendriks, A. Althage, S. Hemmi, H. Bluethmann, R. Kamijo, J. Vilcek, R. M. Zinkernagel, M. Aguet. 1993. Immune response in mice that lack the interferon-{gamma} receptor 1. Science 259:1742.[Abstract/Free Full Text]
  31. Tripp, C. S., M. K. Gately, J. Hakimi, P. Ling, E. R. Unanue. 1994. Neutralization of IL-12 decreases resistance to Listeria in SCID and C.B-17 mice: reversal by IFN-{gamma}. J. Immunol. 152:1883.[Abstract]
  32. Bancroft, G. J., R. D. Schreiber, E. R. Unanue. 1991. Natural immunity: a T-cell-independent pathway of macrophage activation, defined in the scid mouse. Immunol. Rev. 124:5.[Medline]
  33. Gaillard, J. L., P. Berche, P. Sansonetti. 1986. Transposon mutagenesis as a tool to study the role of hemolysin in the virulence of Listeria monocytogenes. Infect. Immun. 52:50.[Abstract/Free Full Text]
  34. Portnoy, D. A., P. S. Jacks, D. J. Hinrichs. 1988. Role of hemolysin for the intracellular growth of Listeria monocytogenes. J. Exp. Med. 167:1459.[Abstract/Free Full Text]
  35. Vidal, S. M., D. Malo, K. Vogan, E. Skamene, P. Gros. 1993. Natural resistance to infection with intracellular parasites: isolation of a candidate for Bcg. Cell 73:469.[Medline]
  36. Leveque, G., V. Forgetta, S. Morroll, A. L. Smith, N. Bumstead, P. Barrow, J. C. Loredo-Osti, K. Morgan, D. Malo. 2003. Allelic variation in TLR4 is linked to susceptibility to Salmonella enterica serovar Typhimurium infection in chickens. Infect. Immun. 71:1116.[Abstract/Free Full Text]
  37. Vidal, S., M. L. Tremblay, G. Govoni, S. Gauthier, G. Sebastiani, D. Malo, E. Skamene, M. Olivier, S. Jothy, P. Gros. 1995. The Ity/Lsh/Bcg locus: natural resistance to infection with intracellular parasites is abrogated by disruption of the Nramp1 gene. J. Exp. Med. 182:655.[Abstract/Free Full Text]
  38. Skamene, E., P. Gros, A. Forget, P. A. Kongshavn, C. St. Charles, B. A. Taylor. 1982. Genetic regulation of resistance to intracellular pathogens. Nature 297:506.[Medline]
  39. Forbes, J. R., P. Gros. 2001. Divalent-metal transport by NRAMP proteins at the interface of host-pathogen interactions. Trends Microbiol. 9:397.[Medline]
  40. Flesch, I. E., S. H. Kaufmann. 1994. Role of macrophages and {alpha}{beta} T lymphocytes in early interleukin 10 production during Listeria monocytogenes infection. Int. Immunol. 6:463.[Abstract/Free Full Text]
  41. Unanue, E. R.. 1997. Studies in listeriosis show the strong symbiosis between the innate cellular system and the T-cell response. Immunol. Rev. 158:11.[Medline]
  42. Bhardwaj, V., O. Kanagawa, P. E. Swanson, E. R. Unanue. 1998. Chronic Listeria infection in SCID mice: requirements for the carrier state and the dual role of T cells in transferring protection or suppression. J. Immunol. 160:376.[Abstract/Free Full Text]
  43. Serbina, N., E. G. Pamer. 2003. Quantitative studies of CD8+ T-cell responses during microbial infection. Curr. Opin. Immunol. 15:436.[Medline]
  44. Mackaness, G. B.. 1970. The monocyte in cellular immunity. Semin. Hematol. 7:172.[Medline]
  45. Unanue, E. R.. 1997. Inter-relationship among macrophages, natural killer cells and neutrophils in early stages of Listeria resistance. Curr. Opin. Immunol. 9:35.[Medline]
  46. Miyamoto, M., M. Emoto, Y. Emoto, V. Brinkmann, I. Yoshizawa, P. Seiler, P. Aichele, E. Kita, S. H. Kaufmann. 2003. Neutrophilia in LFA-1-deficient mice confers resistance to listeriosis: possible contribution of granulocyte-colony-stimulating factor and IL-17. J. Immunol. 170:5228.[Abstract/Free Full Text]
  47. Bancroft, G. J., J. P. Kelly, P. M. Kaye, V. McDonald, C. E. Cross. 1994. Pathways of macrophage activation and innate immunity. Immunol. Lett. 43:67.[Medline]
  48. Roll, J. T., K. M. Young, R. S. Kurtz, C. J. Czuprynski. 1990. Human rTNF{alpha} augments anti-bacterial resistance in mice: potentiation of its effects by recombinant human rIL-1{alpha}4. Immunology 69:316.[Medline]
  49. Liu, W., R. J. Kurlander. 1995. Analysis of the interrelationship between IL-12, TNF-{alpha}, and IFN-{gamma} production during murine listeriosis. Cell. Immunol. 163:260.[Medline]
  50. Muller, M., R. Althaus, D. Frohlich, K. Frei, H. P. Eugster. 1999. Reduced antilisterial activity of TNF-deficient bone marrow-derived macrophages is due to impaired superoxide production. Eur. J. Immunol. 29:3089.[Medline]
  51. Barsig, J., S. H. Kaufmann. 1997. The mechanism of cell death in Listeria monocytogenes-infected murine macrophages is distinct from apoptosis. Infect. Immun. 65:4075.[Abstract]
  52. Stockinger, S., T. Materna, D. Stoiber, L. Bayr, R. Steinborn, T. Kolbe, H. Unger, T. Chakraborty, D. E. Levy, M. Muller, et al 2002. Production of type I IFN sensitizes macrophages to cell death induced by Listeria monocytogenes. J. Immunol. 169:6522.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
CVIHome page
G. I. Forte, L. Scola, G. Misiano, S. Milano, P. Mansueto, G. Vitale, F. Bellanca, M. Sanacore, L. Vaccarino, G. B. Rini, et al.
Relevance of Gamma Interferon, Tumor Necrosis Factor Alpha, and Interleukin-10 Gene Polymorphisms to Susceptibility to Mediterranean Spotted Fever
Clin. Vaccine Immunol., June 1, 2009; 16(6): 811 - 815.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
A. V. Pichugin, B.-S. Yan, A. Sloutsky, L. Kobzik, and I. Kramnik
Dominant Role of the sst1 Locus in Pathogenesis of Necrotizing Lung Granulomas during Chronic Tuberculosis Infection and Reactivation in Genetically Resistant Hosts
Am. J. Pathol., June 1, 2009; 174(6): 2190 - 2201.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. E. F. D'Orazio, M. J. Troese, and M. N. Starnbach
Cytosolic Localization of Listeria monocytogenes Triggers an Early IFN-{gamma} Response by CD8+ T Cells That Correlates with Innate Resistance to Infection
J. Immunol., November 15, 2006; 177(10): 7146 - 7154.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boyartchuk, V.
Right arrow Articles by Kramnik, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boyartchuk, V.
Right arrow Articles by Kramnik, I.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS