|
|
||||||||
Enhancer Requires Functional Collaboration among Proteins Bound Inside and Outside the Core Enhancer1



* Centro de Biología Molecular Severo Ochoa, Universidad Autónoma de Madrid, Madrid, Spain;
Basel Institute for Immunology, Basel, Switzerland; and
Department of Immunology, Duke University Medical Center, Durham, NC 27710
| Abstract |
|---|
|
|
|---|
enhancer (E
) and TCR
enhancer (E
) play critical roles in the temporal and lineage-specific control of V(D)J recombination and transcription at the TCR 
locus, working as a developmental switch controlling a transition from TCR
to TCR
activity during thymocyte development. Previous experiments using a transgenic reporter substrate revealed that substitution of the 116-bp minimal E
, denoted T
1-T
2, for the entire 1.4-kb E
led to a premature activation of V(D)J recombination. This suggested that binding sites outside of T
1-T
2 are critical for the strict developmental regulation of TCR
rearrangement. We have further analyzed E
to better understand the mechanisms responsible for appropriate developmental regulation in vivo. We found that a 275-bp E
fragment, denoted T
1-T
4, contains all binding sites required for proper developmental regulation in vivo. This suggests that developmentally appropriate enhancer activation results from a functional interaction between factors bound to T
1-T
2 and T
3-T
4. In support of this, EMSAs reveal the formation of a large enhanceosome complex that reflects the cooperative assembly of proteins bound to both T
1-T
2 and T
3-T
4. Our data suggest that enhanceosome assembly is critical for developmentally appropriate activation of E
in vivo, and that transcription factors, Sp1 and pCREB, may play unique roles in this process. | Introduction |
|---|
|
|
|---|
and
loci (4, 5). DN-III thymocytes display extensive rearrangement at these loci and actively undergo rearrangements at the TCR
locus (4, 5, 6, 7, 8). At this stage, cells that successfully rearrange their TCR
and
genes express a 
TCR and normally differentiate along the 
T cell pathway, whereas those that do not, but have rearranged the TCR
gene in-frame, normally differentiate along the 
T cell pathway via the DN-IV and double-positive (DP) CD4+CD8+ stages (9). Development along the 
pathway depends on signaling through the pre-TCR, composed of a TCR
-chain and a pre-T
-chain, on DN-III thymocytes (10). Rearrangement of the TCR
gene is not detected until the DN-IV stage and occurs extensively at the DP stage (2, 7, 11, 12, 13).
|

locus, with the TCR
gene embedded between TCR
gene sequences, ensures that the TCR
gene is deleted from the chromosome upon V
to J
recombination at the DP stage (14). This process irreversibly commits DP thymocytes to the 
-T cell lineage. Hence, developmental ordering of TCR
and
gene rearrangements is a critical component of 
vs 
T cell lineage commitment. Two enhancers at the TCR 
locus, E
and E
, are responsible for orchestrating the distinct developmental programs for V(D)J recombination and transcription of the TCR
and
genes (13, 15, 16, 17, 18). These enhancers do so by promoting developmental stage-specific changes in chromatin structure due to their ability to recruit unique combinations of transcription factors and histone-modifying activities (19). During thymocyte development, E
and E
work as a developmental switch, with E
"off" and E
"on" at the DN-III stage, and E
on and E
off at the DP stage (13). Although activation of E
does not start until the DN-IV and DP stages, E
occupancy in DN-III and in DP thymocytes was found to be indistinguishable by genomic footprinting (13, 20). It is not known how E
is activated during T cell development.
E
consists of four protein binding regions, T
1 to T
4 (21, 22) (Fig. 1B). The minimal E
, T
1-T
2, contains critical binding sites for activation transcription factor (ATF)/CREB, T cell factor-1 (TCF-1)/lymphocyte enhancer-binding factor-1 (LEF-1), Runx1 (a member of the Runt family of transcription factors, also known as core binding factor), polyoma enhancer-binding protein-2 or acute myeloid protein-1, and Ets proteins (21, 23, 24, 25, 26, 27, 28, 29). Outside of the minimal E
, genomic footprinting experiments of the endogenous murine enhancer have revealed occupancy of an Ets site, an Ikaros site, a GC box upstream of T
1 (the GC-I box), a GATA-3 site and an E box in T
3, a GC box between T
3 and T
4, a Runx site and another E box in T
4, and two GC boxes downstream of T
4 (13, 20) (Fig. 1B). All these sites are highly conserved between human and mouse enhancers, except for the GC-I box. This site can bind Sp1 in the human enhancer, but is substituted by an E box in the mouse enhancer.
To identify essential binding sites required for the proper activation of V(D)J recombination by E
during T cell development, we previously initiated a functional dissection of the enhancer using a recombination reporter construct in transgenic mice (16, 29). These experiments revealed a premature activation of the recombination reporter construct directed by the 116-bp human T
1-T
2 enhancer fragment, compared with that directed by the entire 1.4-kb human E
. More recently, substitution of the 1.4-kb E
by T
1-T
2 at the endogenous murine locus revealed that T
1-T
2 cannot direct V(D)J recombination over long distances (30). Combined, the two approaches emphasize that areas outside of the core enhancer are required for appropriate enhancer effects on V(D)J recombination in vivo. Using our previous reported transgenic system, we have now found that a 275-bp enhancer fragment, including the human T
1-T
4 elements, contains all the binding sites required for the correct developmental activation of E
. These data indicate the need for a specific collaboration between proteins bound to T
1-T
2 and proteins bound to T
3-T
4 for proper developmental activation of the enhancer in vivo. We also provide molecular support for such an interaction by documenting a multicomponent complex on T
1-T
4 that corresponds to an E
enhanceosome containing proteins bound to both T
1-T
2 and T
3-T
4. These results suggest that interactions between T
1-T
2- and T
3-T
4-bound factors may contribute to developmentally appropriate activation of the enhancer in vivo. In addition, we provide evidence that proper developmental activation of E
might depend on exclusion of phosphorylated CREB-1 from the enhanceosome in DP thymocytes.
| Materials and Methods |
|---|
|
|
|---|
For the T
1-T
4 minilocus, an E
0.7 pUC plasmid (21) was digested with BamHI and ApaI to obtain a 275-bp fragment containing the human T
1-T
4 region. This fragment was blunted by treatment with T4 polymerase and then ligated into pBluescript carrying the previously described enhancerless human TCR
minilocus (31) after XbaI digestion, blunting with the Klenow fragment of Escherichia coli DNA polymerase I, and phosphatase treatment. Minilocus structure was confirmed by dideoxynucleotide sequence analysis.
Minilocus DNA was purified as described previously (31) and was microinjected into fertilized C57BL/6xSJL F2 eggs by the Duke University Comprehensive Cancer Center Transgenic Mouse Shared Resource. Progeny tail DNA samples were analyzed on Southern blots as previously described (31). Transgenes were maintained on a mixed C57BL/6 x SJL background. Copy number was determined by analysis of tail DNA on a slot blot (Schleicher & Schuell, Keene, NH) using radiolabeled C
cDNA probe. Hybridization signals were quantified relative to previously identified single copy integrants using a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).
Analysis of V(D)J recombination in unfractionated thymocytes
Genomic DNA was prepared from thymi of 4- to 6-wk-old mice using standard techniques. For single-copy transgenic lines, 12 ng of genomic DNA was used as a template for PCRs. For multicopy integrants, the quantity of DNA used was reduced to account for copy number to insure that the PCR amplifications were in the linear range. All PCRs, gel electrophoresis, blotting, and hybridization with 32P-labeled probes were performed as previously described (31). Hybridization signals were quantified using a PhosphorImager, and reported values for VDJ recombination were normalized to the C
signal for each PCR template.
Analysis of V(D)J recombination in sorted thymocyte populations
For cell sorting, thymocyte populations were obtained as previously described (13), with minor modifications. All Abs were purchased from BD Pharmingen (San Diego, CA). Briefly, to sort DN subpopulations, DN-enriched thymocytes were incubated with anti-CD4-CyChrome, anti-CD8-CyChrome, anti-CD3-CyChrome, anti-CD24-biotin, anti-CD25-FITC, anti-CD44-PE, and unlabeled anti-CD16, followed by streptavidin-PharRed. DN subpopulations were sorted on the basis of CD25 and CD44 staining of CD4CD8CD3CD24+ gated cells. To sort DP cells, total thymocytes were incubated with anti-CD4-FITC, anti-CD8-PE, and unlabeled anti-CD16. To sort 
T cells, DN-enriched thymocytes were incubated with anti-
TCR-PE, anti-
TCR-FITC, and unlabeled anti-CD16. To sort 
T cells, total thymocytes were incubated with anti-
TCR-PE, anti-
TCR-FITC, and unlabeled anti-CD16. Labeled cells gated by forward and side scatter were sorted using a MoFlow sorter (DakoCytomation, Fort Collins, CO). Reanalysis of sorted populations confirmed cell purity. Preparation of cell templates for PCR analysis, conditions for PCR, and primers and probes used to analyze V(D)J recombination of both the murine TCR
gene and the human TCR
minilocus were previously described (13, 31).
DNase I in vivo footprinting
DNase I treatments were performed as previously described (13). Linker A (32) was annealed to 2 µg of purified thymic DNA from RAG-1/ or RAG-2/ (R) mice (33) and RAG-2-deficient mice carrying a functionally rearranged TCR
transgene (Rx
) (34). DNA was precipitated and subjected to PCR as previously described (32). The oligonucleotides used for E
top strand analysis were GGGTGTTACCACCAAGACCTGCAA and CCACCAAGACCTGCAAGCCCCAC. Those used for E
bottom strand analysis were GTTTCCCACTTCCCTCCAGGTGTTT and CCCACTTCCCTCCAGGTGTTTGGGTC.
EMSAs
Preparation of nuclear extracts from Jurkat cells was performed as previously described (35). Extracts from DN-III and DP cells were prepared from total thymocytes obtained from R and Rx
mice (34, 36), respectively. In brief, after a PBS wash, thymocytes were lysed at 0.5 x 106 cells/ml in 50 mM HEPES (pH 7), 250 mM NaCl, 1 mM EDTA, 0.5 mM DTT, 0.5% Triton X-100, 1 mM PMSF, 1 µg/ml pepstatin, 1 µg/ml leupeptin, and 1 µg/ml aprotinin and were incubated for 30 min on ice. Lysates were then centrifuged at 15,000 x g for 15 min at 4°C to separate soluble material from debris, and glycerol was added to a concentration of 20%. Protein concentrations were determined by Bradford assay using a protein assay (Bio-Rad, Munich, Germany). Binding reactions with pure Sp1 contained 0.1 U of human recombinant Sp1 (Promega, Madison, WI).
Binding sites were obtained by PCR using a plasmid containing human 1.4-kb E
(KpnI-BamHI fragment) inserted in a version of pBluescript KS+ that had previously been modified to eliminate plasmid backbone BstXI sites, generated by J. L. Roberts (Duke University, Durham, NC) as a template, and different combinations of the oligonucleotides T
1(5')PCR (TTGGGGGCTGGGGCG), T
2(3')PCR (AAACTCTTCTTTCCAGAGGA),T
3(5')PCR (AAAATACTGAGTTAGAGATAGC), and T
4(3')PCR (CGGTGCAAGTCACCGA). Binding sites were radiolabeled using polynucleotide T4 kinase and [
-32P]ATP. Radiolabeled DNA fragments were purified using Nuc Trap probe purification columns (Stratagene, Cedar Creek, TX). EMSAs were performed as described previously (37) with some modifications. Jurkat nuclear extracts (2 µg) or thymocyte cell extracts (20 µg) were incubated with 2 µg of poly(dI-dC) carrier (Amersham Biosciences, Piscataway, NJ) and 5 µg of BSA in a 30-µl reaction mix containing 10 mM Tris-HCl (pH 7.9), 50 mM NaCl, 33 mM KCl, 5 mM MgCl2, 1 mM DTT, and 5% glycerol for 30 min at room temperature. Reactions also included, as appropriate, 2 µg of purified Abs or 1 µl of rabbit sera. Anti-Sp1 serum was provided by J. Horowitz (North Carolina State University, Raleigh, NC); anti-pCREB, anti-Ets-1, anti-Fli-1, and anti-GATA-3 Abs were obtained from Santa Cruz Biotechnology (Santa Cruz, CA); anti-TCF-1/LEF-1 Abs were obtained from Santa Cruz Biotechnology and from Kamiya Biomedical (Seattle, WA); purified control Abs were obtained from Sigma-Aldrich (St. Louis, MO); and normal rabbit serum was obtained from DakoCytomation (Carpinteria, CA). Labeled binding site probes (15 fmol,
3 x 104 cpm) were then added for an additional 30 min of incubation at room temperature. Samples were electrophoresed through a 4% polyacrylamide gel containing 22.5 mM Tris-borate and 0.5 mM EDTA at 4°C.
| Results |
|---|
|
|
|---|
, E
, and T
1-T
2 during thymocyte development in adult mice
Previous experiments using a reporter construct consisting of an unrearranged human TCR
minilocus in transgenic mice have demonstrated the enhancer dependence of developmentally appropriate V(D)J recombination at the TCR 
locus (13, 16). The TCR
minilocus used in these experiments contains V
1, V
2, D
3, J
1, and J
3 gene segments; C
; and an enhancer within the J
3-C
intron (31) (Fig. 2A). V gene segments within the construct carry a mutation to avoid expression of a transgene-derived TCR
-chain that could interfere with normal T cell development (31). Analysis of the transgenic minilocus driven by human E
revealed that the enhancer-dependent V
D
to J
rearrangement step occurs on fetal day 14.5 and at similar levels in both 
and 
T cells in adult mice, suggesting that E
-dependent V(D)J recombination is activated in early precursors of both 
and 
T cells (16). By contrast, in the presence of human E
, transgene V
D
to J
recombination was delayed to fetal day 16.5 and was detected exclusively in 
T cells, suggesting that enhancer-dependent V(D)J recombination is activated exclusively in more mature cells committing to the 
T cell lineage (16).
|
1D
3 to J
1 minilocus rearrangement in sorted thymocyte populations from 4- to 6-wk-old E
, E
, and T
1-T
2 transgenic mice (Fig. 3). Analysis of minilocus V(D)J recombination was performed by PCR from thymus genomic DNA templates using V
1 primers in conjunction with J
1 primers as described previously (31) (Fig. 2B). This PCR strategy amplifies 0.3-kb fragments corresponding to complete V
D
J
rearrangements and 1.2-kb fragments corresponding to V
D
rearrangements. PCRs were also performed in parallel with a pair of C
primers as an internal control. All PCR experiments were performed under conditions previously established to yield linear amplification (31, 38). PCR products were electrophoresed through agarose gels, blotted, and detected by hybridization with appropriate 32P-labeled V
1 or C
probes. In agreement with previous analysis of the E
transgenic line A (13, 16), we detected high levels of V
1-D
3-J
1 rearrangement in both 
and 
T cells. Relative to rearrangement in 
T cells (arbitrarily set at 100%), rearrangement in 
T cells was only slightly higher (111%). Rearrangement was essentially complete in DN-III thymocytes (84%), results that are consistent with previous analyses of endogenous murine TCR
gene rearrangements (4, 5). As an internal control for cell purity, we examined endogenous murine V
to J
rearrangements in the same sorted cells. As expected, endogenous V
J
rearrangement was undetectable in DN-I, DN-II, and DN-III thymocytes and 
T cells; was detected at low levels in DN-IV thymocytes (6% of the level in DP thymocytes); and was detected at high levels in both DP thymocytes (set at 100%) and 
T cells (87%).
|
in the developmental activation of TCR
gene rearrangement (17), the pattern of minilocus rearrangement in E
transgenic lines J, L, and M paralleled that of the endogenous TCR
gene, with high levels of V
1-D
3-J
1 rearrangement in DP and 
T cells compared with DN-III and 
T cells (13, 16) (Fig. 3). Despite this, we detected low level, premature initiation of minilocus rearrangement in all E
transgenic lines (Fig. 3). Specifically, enhancer-dependent minilocus V
1-D
3-J
1 rearrangement was detected in DN-III thymocytes (8% for line J, 4% for line L, and 4% for line M) and in 
T cells (19% for line J, 5% for line L, and 3% for line M), whereas endogenous V
J
rearrangement was not. Moreover, V
1-D
3-J
1 rearrangement in DN-IV thymocytes was higher at the transgenic minilocus than was V
J
rearrangement at the endogenous locus in all E
-transgenic lines (26 vs 7% in line J, 26 vs 6% in line L, and 15 vs 10% in line M). Despite the low level dysregulation, the minilocus provides a useful approach to evaluate how changes in E
structure impact its ability to developmentally regulate V(D)J recombination in vivo.
Previous experiments indicated that the T
1-T
2 fragment of the human 1.4-kb E
directed a premature activation of enhancer-dependent V
D
to J
rearrangement, on the basis of elevated rearrangement in 
T cells and in fetal day 15.5 thymocytes (29). These results were interpreted to indicate that T
1-T
2 became active in a thymocyte population that is developmentally intermediate between those in which E
and E
are normally activated. Consistent with this, we found enhancer-dependent V
1D
3 to J
1 rearrangement to be clearly detected in DN-III thymocytes and 
T cells of T
1-T
2 transgenic lines T2 and T5 (Fig. 3). Levels of V
1-D
3-J
1 rearrangement in DN-III thymocytes were 26% for line T2 and 22% for line T5. Consistent with a potential for DN-III thymocytes to differentiate to 
T cells, comparable levels of minilocus rearrangement were detected in 
T cells (19 and 42% for lines T2 and T5, respectively). In addition, the levels of complete V
1-D
3-J
1 rearrangements were higher in DN-IV thymocytes from T
1-T
2 lines than from E
lines (36 and 67% for lines T2 and T5, respectively). These results confirm the previous supposition that E
binding sites outside T
1-T
2 are critical for the fine control of enhancer function because they restrict activation of the core enhancer until the DN-IV to DP stages of thymocyte development (29).
Chromatin structural changes at E
during the transition from DN-III to DP thymocytes
Previous genomic footprinting analysis using dimethylsulfate at the endogenous murine E
revealed that T
1-T
4 elements and flanking areas within E
are extensively occupied in DN-III thymocytes, before enhancer activation, with no major differences in enhancer occupancy between DN-III and DP thymocytes (13, 20). Furthermore, analysis of E
chromatin structure in DN-III and DP thymocytes, as measured by its sensitivity to DNase I digestion on Southern blots, did not reveal any major differences between the two populations (13), although high resolution analysis did reveal some subtle changes both within the core enhancer, at the edges of the of the TCF/LEF motif, and outside of the minimal E
, at the 5' end of T
1 and in T
3 (20). To further investigate possible changes in chromatin structure that may occur at the DN-III to DP transition and correlate with E
activation, we mapped DNase I sensitivity at nucleotide resolution using ligation mediated-PCR (Fig. 4). This technique permits detection of minor changes in chromatin structure resulting from DNA bending as a consequence of protein-DNA interactions (39). As a source of DN-III cells, we used total thymocytes from R mice (33), of which 90% are DN-III and 10% are DN-I and -II (6). As a source of DP cells, we used total thymocytes from Rx
mice, essentially all of which are DP (34). We found stage-specific differences in enhancer structure at E
sequences both within and outside T
1-T
2 (Fig. 4). E
chromatin was generally more sensitive to DNase I digestion in DN-III thymocytes than in DP thymocytes (bottom strand analysis), suggesting that the protein complex formed on E
may be more compact in DP cells than in DN-III cells. Furthermore, we found striking differences in DNase I sensitivity at particular nucleotides. Consistent with the previous analysis (20), we detected diminished DNase I sensitivity at the 5' edge of the TCF/LEF binding site (top strand) in DP compared with DN-III thymocytes. In addition, we identified additional sites of reduced DNase sensitivity at nucleotides in the 5' T
1 GC-I box, in the T
3 GATA-3 binding site and E box, and in the region between the T
4 E box and the downstream GC box. Hence, E
undergoes specific chromatin structure changes at the DN-III to DP transition at 5' T
1, at T
2, at T
3, and downstream of T
4 that correlate with functional activation of the enhancer. These data are consistent with the idea that precise developmental control relies on enhancer elements situated both within and outside the minimal enhancer.
|
1-T
4 enhancer fragment is sufficient for proper developmental regulation of E
To ask whether the enhancer fragment analyzed above, spanning from T
1 to downstream of T
4, contains all the transcription factor binding sites required for proper developmental activation of V(D)J recombination by E
, we generated new lines of transgenic mice in which minilocus recombination is under control of a human 275-bp BstXI-ApaI E
fragment, denoted T
1-T
4 (Figs. 1B and 2A). The 5' end of this fragment is shared with the 116-bp T
1-T
2 fragment present in lines T2 and T5, whereas the 3' end includes the additional sites in T
3 and downstream of T
4 that undergo structural changes on transition from DN-III to DP (Figs. 1B and 4). We characterized four independent transgenic lines, designated C2, C3, C4, and C9. Transgene copy numbers were 10, 13, 1 and 5 for lines C2, C3, C4, and C9, respectively. Analysis of minilocus V(D)J recombination in total thymocytes revealed low levels of V
1-D
3 and high levels of V
1-D
3-J
1 rearrangements in all four transgenic lines, indicating that T
1-T
4 induces activation of enhancer-dependent V
1D
3 to J
1 rearrangement with an efficiency comparable to E
(line A), E
(lines J, L, and M) and T
1-T
2 (lines T2 and T5; Fig. 5). Similar results were obtained in the analysis of rearrangements involving V
2 (Fig. 5).
|
1-T
4 transgenic lines (Fig. 6). We found that minilocus V(D)J recombination driven by T
1-T
4 was essentially indistinguishable from that driven by the entire 1.4-kb E
. Thus, in three of four lines, V
1D
3J
1 rearrangement was detected at relatively low levels in DN-IV cells and at high levels in DP and 
T cells, but was only barely detected in DN-III and 
T cells. The elevated levels of V
1D
3J
1 rearrangement in DN-III, DN-IV, and 
T cells of line C4 appear unique to this line and reflect unique properties of the integration site (Fig. 6). Taken together, the results suggest that the T
1-T
4 region contains all binding sites that are required for proper developmental activation of V(D)J recombination by E
in vivo. Ets-1 and Ikaros binding sites situated 5' of T
1 (20) and outside of the 275-bp T
1-T
4 fragment are therefore unlikely to play an important role in developmental regulation as previously suggested (20).
|
enhanceosome
Precise developmental control by the T
1-T
4 fragment suggests that E
sequences in the T
3-T
4 region function to prevent the premature activation of V(D)J recombination that would otherwise be directed by T
1-T
2 (Figs. 3 and 6). In an attempt to analyze the molecular mechanism for functional collaboration between T
1-T
2 and T
3-T
4 binding proteins, we performed EMSAs using T
1-T
2, T
3-T
4, and T
1-T
4 (BstXI-DraI, DraI-ApaI, and BstXI-ApaI enhancer fragments, respectively) in the presence of extracts from Jurkat cells or mouse thymocytes (Figs. 1B and 7).
|
1-T
2 probe resulted in the formation of a series of complexes (Fig. 7). One of them displayed a very slow mobility and potentially corresponded to a T
1-T
2 enhanceosome (labeled E12). Consistent with this, formation of complex E12 was inhibited by anti-TCF-1/LEF-1, anti-Ets1, and anti-Fli1 Abs, indicating that E12 results from simultaneous binding of TCF-1/LEF-1 and Ets-1 or Fli-1 to the same DNA molecule (Fig. 7A). Both Ets-1 and Fli-1 have been implicated in enhancer activation through their direct binding to an Ets-binding site present within T
2 (23, 28). Therefore, partial inhibitions with anti-Ets-1 and anti-Fli-1 Abs are consistent with the presence of different enhanceosome complexes containing Ets-1 or Fli-1. Ab inhibitions of enhanceosome formation were highly reproducible.
Incubation of extracts from Jurkat cells or mouse thymocytes with a T
1-T
4 probe also resulted in the formation of a series of complexes. Similar to T
1-T
2, we detected a very slow migrating complex with Jurkat, DN-III, and DP extracts that corresponded to formation of a T
1-T
4 enhanceosome (labeled as E1234; Fig. 7). The identity of this complex was confirmed by inhibition of its formation in the presence of anti-TCF-1/LEF-1, anti-Ets1, anti-Fli1, and anti-GATA-3 Abs (Fig. 7A and data not shown). Inhibition was specific, because anti-GATA-3 Ab did not affect formation of the enhanceosome formed on T
1-T
2 (data not shown). The low mobility complex formed on T
1-T
4 is therefore a consequence of simultaneous binding of TCF-1/LEF-1, Ets-1, and GATA-3 or TCF-1/LEF-1, Fli-1, and GATA-3 to the same DNA molecule. These data support the concept that cooperative assembly of a multiprotein complex on T
1-T
4 is responsible for developmental activation of E
.
T
1-T
2 contains two GC boxes (the GC-I box located 5' of T
1, and the GC-II box located upstream of the cAMP response element (CRE) site within T
1)) that can both serve as Sp1 binding sites in vitro (40) (Fig. 1B). Binding of purified Sp1 to T
1-T
2 was clearly detected by the formation of two complexes, called Sp1 and Sp1* (Fig. 7B), that were supershifted to the top of the well in presence of anti-Sp1 serum (data not shown). Hence, complex Sp1 is probably the result of binding of Sp1 to the GC-I box, whereas complex Sp1* may result from binding of Sp1 to both the GC-I box and the GC-II box within the same DNA molecule. Incubation of T
1-T
2 with nuclear extracts from Jurkat cells resulted in the formation of several complexes. Two of them displayed the same mobility as the Sp1 complexes. That these complexes are probably identical with the Sp1 complexes detected with purified Sp1 protein was demonstrated by supershift experiments in the presence of anti-Sp1 serum (Fig. 7B). No clear differences were detected in the level of the Sp1 complex formed on T
1-T
2 in the presence of DN-III or DP cell extracts, indicating that Sp1 from Jurkat cells or thymocytes can bind similarly to the T
1-T
2 enhancer fragment in vitro (data not shown). Interestingly, although Sp1 from Jurkat or thymocyte cell extracts can bind independently to T
1-T
2, Sp1 does not seem to be required for formation of E12, because E12 formation is not inhibited by anti-Sp1 (Fig. 7B).
In addition to GC-I and GC-II, T
1-T
4 contains three GC boxes (III, IV, and V) within T
3-T
4 (Fig. 1B) that might also serve as binding sites for Sp1. In fact, incubation of purified Sp1 with a T
3-T
4 probe revealed the formation of two Sp1-containing complexes (Fig. 7B). The more abundant one contains a single molecule of Sp1 (marked Sp1), whereas the other probably contains two Sp1 molecules bound to the same DNA molecule (marked Sp1*). As for E12, the T
3-T
4 enhanceosome (E34) does not seem to require Sp1, because its formation is not inhibited by anti-Sp1. Thus, Sp1 binds independently to T
1-T
2 and T
3-T
4, but is not required for the formation of either E12 or E34. However, in contrast with E12 and E34, the T
1-T
4 enhanceosome (E1234) contains Sp1, because its formation was dramatically inhibited by anti-Sp1 (Fig. 7B). We conclude that the E1234 results from cooperative assembly of Sp1 with other DNA-binding proteins on T
1-T
4. The fact that Sp1 is not required for formation of E12 and E34 suggests that Sp1 plays a unique role in the cooperative assembly of E1234.
The composition of the enhanceosome formed on T
1-T
4 should differ between DN-III and DP cells to account for E
activation during T cell development. However, we found no evidence for differential binding of TCF-1/LEF-1, Ets factors, GATA-3, and Sp1 between DN-III and DP cells (data not shown). One possibility is that developmental activation of E
is regulated by post-translational modifications of prebound factors. Previous work had suggested that the phosphorylated form of CREB-1 bound to the isolated T
1 CRE site in DN-III, but not DP, extracts (20). Therefore, we performed EMSAs to analyze pCREB-1 binding to T
1-T
4 during thymocyte development (Fig. 7C). We found that anti-pCREB-1 inhibited formation of E1234 only in DN-III, but not in DP, thymocytes. These data support a model in which dephosphorylation of pCREB-1 might be involved in activation of E
during the DN-III to DP transition in vivo.
| Discussion |
|---|
|
|
|---|
(T
1-T
4) as the minimal enhancer fragment required for correct developmental activation in vivo. Precise developmental activation must therefore be orchestrated by the specific array of transcription factors and coactivators recruited to the region. As we previously found, the T
1-T
2 fragment seems to be subject to premature activation in vivo, and our results indicate that the T
3-T
4 region functions to enforce developmentally appropriate activation to T
1-T
2. Based on the extensive occupancy of T
1-T
4 in DN-III thymocytes before its activation as well as our current EMSA data, we conclude that T
1-T
2- and T
3-T
4-bound factors interact to form a stable multiprotein complex and to precisely regulate the enhancer in vivo. Our data suggest that Sp1 may play a distinctive role in coordinating interactions between T
1-T
2- and T
3-T
4-bound factors. Furthermore, our data suggest that dephosphorylation of CREB-1-bound to E
might be involved in enhancer activation in the transition from DN-III to DP cells.
An enhanceosome is a compact nucleoprotein structure created by stereospecific interactions between transactivators bound to their cognate sites within an enhancer. This high level of structural organization ensures high level functional cooperativity of the various enhanceosome components (41). In general, architectural proteins are believed to orchestrate the formation of such complexes by facilitating interactions between distantly bound factors to form a specific surface for recruitment of coactivator proteins. T
1-T
2 has been considered a paradigm for enhanceosome structure (28, 42). TCF-1/LEF-1-induced DNA bending is thought to play an organizing role that promotes specific interactions between ATF/CREB factors and Ets factors bound to distal ends of the enhancer (28), and that helps to recruit non-DNA-binding proteins that provide additional bridges between the various DNA-bound factors (43, 44). Consistent with this model, in vivo studies of T
1-T
2 occupancy revealed that factor binding occurs in a highly cooperative fashion (40). In agreement with these results, we have been able to detect the formation of a T
1-T
2 enhanceosome in vitro, as shown by the cooperative assembly of multiple DNA-binding proteins to the same DNA molecule. However, our data also suggest the formation of a higher order enhanceosome structure that extends to regions outside the minimal enhancer. This would be consistent with the chromatin structural changes at the 5' T
1 GC-I box, at T
3, and downstream of T
4 detected during the transition from DN-III to DP thymocytes. Hence, functional interaction between factors bound to T
3-T
4 and factors bound to T
1-T
2 provides an additional layer of complexity to the organization of an E
enhanceosome that has functional relevance in vivo.
Our data revealed that equivalent levels of TCF-1/LEF-1, Ets factors, GATA-3, and Sp1 are present at the T
1-T
4 enhanceosome in both DN-III and DP thymocytes (data not shown), suggesting that none of these factors directly triggers activation of E
at the DN-III to DP transition. However, these factors have the potential to act as either repressors or activators depending on different developmental or cellular contexts through specific interactions with coactivators or corepressors, or contain autoinhibitory domains (43, 44, 45, 46, 47, 48, 49, 50). Thus, none of these factors can truly be eliminated as mediators of a developmental switch in E
function. Other factors, such as early growth response (Egr) factors 1 and 3 have been suggested as potential regulators of E
function, because they are induced in the transition from DN-III to DN-IV thymocytes, and they can activate TCR
transcription in retrovirally transduced cells (51). Although we have evidence for Egr-1 and Egr-3 binding to the enhancer, anti-Egr Abs did not disrupt enhanceosome assembly (data not shown). Functional experiments are currently in progress to better address a role for Egr factors in E
activation.
In addition, E
activity may depend on post-translational modifications of prebound factors. CREB/ATF factors are basic leucine zipper transcriptional regulators that have been involved in E
function in vitro and in vivo through the T
1 CRE site (28, 42). CREB-1 binds to its cognate site as a homodimer or as a heterodimer in association with other members of the CREB/ATF family, including ATF-1 and CRE modulator-1 (CREM-1). This factor is directly coupled to the activation of signal transduction pathways through its phosphorylation at Ser133. CREB-1 is mostly present in an unphosphorylated state in resting thymocytes, and its phosphorylation is induced by different pharmacological stimuli that activate different signaling pathways resembling TCR engagement (52). Although CREB-1 is the major factor that binds to an isolated CRE site in both DN-III and DP cells, pCREB-1 binding has been detected in DN-III cells, but not in DP cells (20). Because phosphorylation of CREB-1 does not affect its affinity for DNA, differences in pCREB-1 binding in DN-III and DP cells should parallel the levels of this protein present in these two populations. Consistent with this, Western blot analysis revealed that pCREB-1 is more abundant in DN-III than in DP thymocytes (data not shown). In agreement with this, our data with T
1-T
4 indicate that pCREB-1 is an important component for the T
1-T
4 enhanceosome formed in DN-III cells, but not in DP cells. Although unphosphorylated CREB-1 is the major form of this factor present in both DN-III and DP thymocytes (20, 52), our data with T
1-T
4 show that pCREB-1 is a major component of the enhanceosome in DN-III cells. These results indicate that pressure must exist for binding of the phosphorylated form of CREB-1 to this enhancer fragment to form a stable multiprotein complex in DN-III thymocytes.
CREB-1 phosphorylation at Ser133 allows specific interaction with the coactivator CREB-binding protein (CBP) and its paralogue p300 (53). These coactivators contain different domains for interaction with transcription factors, and act as integrators for the assembly of the IFN-
and TNF-
enhanceosomes (54, 55, 56). In both instances, these coactivators are recruited through their interaction with a surface composed by the specific arrangement of CBP/p300-interacting, DNA-bound factors. In fact, it has been demonstrated that cooperative assembly of these enhanceosomes through CBP/p300 recruitment results in functional synergy among several nuclear factors bound to these regions. Interestingly, in addition to pCREB-1, other T
1-T
4-binding proteins, such as Runx, Ets-1, Sp1, and GATA-3, which are essential for E
enhanceosome formation, also interact with CBP/p300 (53). Similar to the IFN-
and TNF-
enhanceosomes, assembly of a T
1-T
4 enhanceosome in DN-III cells may require the recruitment of CBP/p300 through a specific surface formed by pCREB-1 and the other CBP/p300-interacting proteins that specifically bind to the enhancer. In agreement with this possibility, stable occupancy of the enhancer in vitro depends on a specific helical phasing relationship between the CRE site and Runx and Ets binding sites (28). In addition, these studies also indicated that recombinant forms of CREB/ATF factors could not generate a stable multiprotein complex on T
1-T
2, suggesting that these factors might need to be modified or interact with specific coactivators to support enhanceosome assembly (28). Hence, phosphorylation of CREB-1 (and possibly ATF-1 or CREM-1, which are also recognized by the Abs used in our experiments) might be a requirement for the recruitment of CBP/p300 in combination with other enhancer-binding proteins and for the assembly of a stable enhanceosome on T
1-T
4 in DN-III cells.
Our data suggest that enhancer activation may depend on substitution of pCREB-1 by CREB-1 at E
in the transition from DN-III to DP thymocytes. pCREB-1 might be excluded from T
1-T
4 in DP cells because it may have negative effects on enhancer activity. It has been proposed that pCREB-1 may repress transcription depending on the nucleoprotein context (53). Our results might suggest a different conformation of the T
1-T
4 enhanceosome that specifically excludes the binding of pCREB-1 in DP cells or that eliminates the pressure for binding of pCREB-1 to form a stable complex.
Our experiments show that although Sp1 can bind independently to both T
1-T
2 and T
3-T
4 sequences, it binds preferentially as part of the E
enhanceosome in the context of the specific multiprotein complex formed on T
1-T
4. Sp1-induced DNA bending has been proposed to have an essential role in the architecture and assembly of the TNF-
enhanceosome (55), much in the way that TCF-1/LEF-1 functions at the E
enhanceosome and HMG-I(Y) proteins function at the IFN-
enhanceosome (28, 57). Within the TNF-
enhanceosome, Sp1 interacts with proteins bound to abutting sequences and must be in phase with other activators to interact with the basal transcription complex (56). Correctly aligned proteins are thought to form a specific surface to efficiently recruit the coactivator proteins CBP/p300.
Our studies using a human TCR
minilocus as a recombination reporter construct in transgenic mice indicate that T
1-T
2 can stimulate accessibility of recombination signal sequences to the V(D)J recombinase at distances of at least 2 kb, albeit with reduced developmental specificity (Ref. 29 and this study). However, recent studies using gene-targeted mutation at the endogenous TCR 
locus found that T
1-T
2 cannot replace E
to stimulate the accessibility of J
recombination signal sequences over 70 kb (30). Therefore, interactions among T
1-T
2- and T
3-T
4-bound factors are probably critical not only for developmental stage specificity, but also for qualitative or quantitative differences in enhancer activity that are required for long-range functions in vivo. Additional gene-targeted mutations of E
at the endogenous locus will be required to address these issues in greater detail.
| Acknowledgments |
|---|
| Footnotes |
|---|
1 This work was supported by a grant from the Spanish Ministry of Science and Technology (BCM200201446), a grant from the National Institutes of Health (GM41052), and the Basel Institute for Immunology, which was founded and supported by Hoffman-La Roche. C.H.M. is supported by the Ramón y Cajal Program from the Spanish Ministry of Education and Science. ![]()
2 N.B. and N.Z. contributed equally to this work. ![]()
3 Current address: Basilea Pharmaceuticals. Grenzacherstrasse 487, 4005 Basel, Switzerland. ![]()
4 Address correspondence and reprint requests to Dr. Cristina Hernández-Munain at the current address: Centro Nacional de Biotecnología, Consejo Superior de Investigaciones Científicas, Universidad Autónoma de Madrid, C/ Darwin 3, Cantoblanco, 28049 Madrid, Spain. E-mail address: chdez{at}cnb.uam.es ![]()
5 Abbreviations used in this paper: DN, double negative, CD4CD8 thymocyte; ATF, activation transcription factor; bHLH, basic helix-loop-helix; CBP, CREB-binding protein; CRE, cAMP response element; CREM-1, CRE modulator-1; DP, double positive, CD4+CD8+ thymocyte; E
, TCR
enhancer; E
, TCR
enhancer; Egr, early growth response; LEF-1, lymphocyte enhancer-binding factor-1; TCF-1, T cell factor-1. ![]()
Received for publication September 24, 2003. Accepted for publication August 12, 2004.
| References |
|---|
|
|
|---|
,
, and
rearrangements during adult thymic development: T cell receptor rearrangements are present in CD44+CD25+ pro-T thymocytes. Proc. Natl. Acad. Sci. USA 95:12522.
gene rearrangement and role of TCR-
expression during CD3CD4CD8 thymocyte differentiation. J. Immunol. 152:4783.[Abstract]
gene recombination: dissociation from cell cycle regulation and developmental progression during T cell ontogeny. J. Exp. Med. 185:1549.
chain gene rearrangement and selection during thymocyte development in adult mice. Immunity 1:83.[Medline]
gene in development of 
but not 
T cells. Nature 375:795.[Medline]
gene rearrangement and T early
(TEA) expression in immature 
lineage thymocytes: implications for 
/
lineage commitment. Immunity 4:37.[Medline]
enhancer to TCR
enhancer function during thymocyte maturation. Immunity 10:723.[Medline]
/
locus. Immunol. Rev. 165:131.[Medline]
and TCR
gene enhancers confer tissue- and stage-specificity on V(D)J recombination events. EMBO J. 12:4335.[Medline]
/
gene rearrangement by T cell receptor
and
enhancers. J. Exp. Med. 179:1913.
enhancer in 
and 
T cells. Immunity 7:505.[Medline]
locus accessibility and expression by the TCR
enhancer. Immunity 10:503.[Medline]
enhancer activation occurs via a conformational change of a pre-assembled nucleo-protein complex. EMBO J. 19:2034.[Medline]
in the human T-cell receptor
locus. Proc. Natl. Acad. Sci. USA 86:6714.
locus. EMBO J. 8:729.[Medline]
gene enhancer. Science 250:814.
enhancer function. Genes Dev. 5:880.
enhancer. Genes Dev. 5:656.
enhancer complex is dependent on LEF-1-induced DNA bending and multiple protein-protein interactions. Genes Dev. 9:995.
enhancer. J. Exp. Med. 185:131.
/
locus enhancer identity and position are critical for the assembly of TCR
and
variable region genes. Proc. Natl. Acad. Sci. USA 100:2598.
transgene. J. Exp. Med. 179:43.
enhancer. Mol. Cell. Biol. 11:5671.
enhancer by functional cooperation between c-Myb and core-binding factors. Mol. Cell. Biol. 14:473.
gene rearrangement by CBF/PEBP2. J. Exp. Med. 185:1193.
-enhancer chromatin in vivo. Mol. Cell. Biol. 18:3223.
enhancer assembly and activation on chromatin templates in vitro. Genes Dev. 11:887.
enhancer function. Genes Dev. 11:640.
enhanceosome is required for synergistic activation of transcription. Mol. Cell 1:277.[Medline]
gene expression in T lymphocytes. Mol. Cell. Biol. 22:2620.
gene expression by mycobacteria involves the assembly of a unique enhanceosome dependent on the coactivator proteins CBP/p300. Mol. Cell. Biol. 23:526.
gene enhancer by transcription factors and the architectural protein HMG I(Y). Cell 83:1101.[Medline]
/C
) region: organization, sequence, and evolution of 97.6 kb of DNA. Genomics 19:478.[Medline]This article has been cited by other articles:
![]() |
B. del Blanco, J. L. Roberts, N. Zamarreno, N. Balmelle-Devaux, and C. Hernandez-Munain Flexible Stereospecific Interactions and Composition within Nucleoprotein Complexes Assembled on the TCR{alpha} Gene Enhancer J. Immunol., August 1, 2009; 183(3): 1871 - 1883. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Aifantis, C. H. Bassing, A. I. Garbe, K. Sawai, F. W. Alt, and H. von Boehmer The E{delta} enhancer controls the generation of CD4-CD8- {alpha}{beta}TCR-expressing T cells that can give rise to different lineages of {alpha}{beta} T cells J. Exp. Med., June 12, 2006; 203(6): 1543 - 1550. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Harrow and B. D. Ortiz The TCR{alpha} Locus Control Region Specifies Thymic, But Not Peripheral, Patterns of TCR{alpha} Gene Expression J. Immunol., November 15, 2005; 175(10): 6659 - 6667. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |