HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Balmelle, N. Articles by Hernández-Munain, C. Search for Related Content PubMed PubMed Citation Articles by Balmelle, N. Articles by Hernández-Munain, C.

Developmental Activation of the TCR Enhancer Requires Functional Collaboration among Proteins Bound Inside and Outside the Core Enhancer¹

Nadège Balmelle^2,3,, Noelia Zamarreño^2,*, Michael S. Krangel and Cristina Hernández-Munain^4,*,

^* Centro de Biología Molecular Severo Ochoa, Universidad Autónoma de Madrid, Madrid, Spain; Basel Institute for Immunology, Basel, Switzerland; and Department of Immunology, Duke University Medical Center, Durham, NC 27710

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
The TCR enhancer (E) and TCR enhancer (E) play critical roles in the temporal and lineage-specific control of V(D)J recombination and transcription at the TCR locus, working as a developmental switch controlling a transition from TCR to TCR activity during thymocyte development. Previous experiments using a transgenic reporter substrate revealed that substitution of the 116-bp minimal E, denoted T1-T2, for the entire 1.4-kb E led to a premature activation of V(D)J recombination. This suggested that binding sites outside of T1-T2 are critical for the strict developmental regulation of TCR rearrangement. We have further analyzed E to better understand the mechanisms responsible for appropriate developmental regulation in vivo. We found that a 275-bp E fragment, denoted T1-T4, contains all binding sites required for proper developmental regulation in vivo. This suggests that developmentally appropriate enhancer activation results from a functional interaction between factors bound to T1-T2 and T3-T4. In support of this, EMSAs reveal the formation of a large enhanceosome complex that reflects the cooperative assembly of proteins bound to both T1-T2 and T3-T4. Our data suggest that enhanceosome assembly is critical for developmentally appropriate activation of E in vivo, and that transcription factors, Sp1 and pCREB, may play unique roles in this process.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
T cell development involves discrete maturation events defined by the expression of specific surface Ags and the V(D)J recombination status of TCR loci (1) (Fig. 1A). The most immature thymocytes do not express the surface markers CD4 and CD8 and are known as double-negative (DN)⁵ thymocytes. Based on the expression of the surface markers CD25 and CD44 (2, 3), four different DN subpopulations can be distinguished: DN-I (CD25^–CD44⁺), DN-II (CD25⁺CD44⁺), DN-III (CD25⁺CD44^–), and DN-IV (CD25^–CD44^–), each with a distinct developmental potential (1). Commitment to the T cell lineage seems to occur during the transition from DN-II to DN-III and coincides with initiation of V(D)J recombination at the TCR and loci (4, 5). DN-III thymocytes display extensive rearrangement at these loci and actively undergo rearrangements at the TCR locus (4, 5, 6, 7, 8). At this stage, cells that successfully rearrange their TCR and genes express a TCR and normally differentiate along the T cell pathway, whereas those that do not, but have rearranged the TCR gene in-frame, normally differentiate along the T cell pathway via the DN-IV and double-positive (DP) CD4⁺CD8⁺ stages (9). Development along the pathway depends on signaling through the pre-TCR, composed of a TCR -chain and a pre-T-chain, on DN-III thymocytes (10). Rearrangement of the TCR gene is not detected until the DN-IV stage and occurs extensively at the DP stage (2, 7, 11, 12, 13).

View larger version (15K): [in this window] [in a new window]   FIGURE 1. Thymocyte maturation and E structure. A, A schematic diagram of thymocyte development depicts the various developmental stages, pre-TCR and TCR expression, and periods of TCR gene recombination. The percentage of thymocytes in each population is indicated. B, The diagram depicts the transcription factors that bind to murine/human E, the locations of the defined T1 to T4 protein binding regions, and the human T1-T2 and T1-T4 enhancer fragments used in this study.

E consists of four protein binding regions, T1 to T4 (21, 22) (Fig. 1B). The minimal E, T1-T2, contains critical binding sites for activation transcription factor (ATF)/CREB, T cell factor-1 (TCF-1)/lymphocyte enhancer-binding factor-1 (LEF-1), Runx1 (a member of the Runt family of transcription factors, also known as core binding factor), polyoma enhancer-binding protein-2 or acute myeloid protein-1, and Ets proteins (21, 23, 24, 25, 26, 27, 28, 29). Outside of the minimal E, genomic footprinting experiments of the endogenous murine enhancer have revealed occupancy of an Ets site, an Ikaros site, a GC box upstream of T1 (the GC-I box), a GATA-3 site and an E box in T3, a GC box between T3 and T4, a Runx site and another E box in T4, and two GC boxes downstream of T4 (13, 20) (Fig. 1B). All these sites are highly conserved between human and mouse enhancers, except for the GC-I box. This site can bind Sp1 in the human enhancer, but is substituted by an E box in the mouse enhancer.

To identify essential binding sites required for the proper activation of V(D)J recombination by E during T cell development, we previously initiated a functional dissection of the enhancer using a recombination reporter construct in transgenic mice (16, 29). These experiments revealed a premature activation of the recombination reporter construct directed by the 116-bp human T1-T2 enhancer fragment, compared with that directed by the entire 1.4-kb human E. More recently, substitution of the 1.4-kb E by T1-T2 at the endogenous murine locus revealed that T1-T2 cannot direct V(D)J recombination over long distances (30). Combined, the two approaches emphasize that areas outside of the core enhancer are required for appropriate enhancer effects on V(D)J recombination in vivo. Using our previous reported transgenic system, we have now found that a 275-bp enhancer fragment, including the human T1-T4 elements, contains all the binding sites required for the correct developmental activation of E. These data indicate the need for a specific collaboration between proteins bound to T1-T2 and proteins bound to T3-T4 for proper developmental activation of the enhancer in vivo. We also provide molecular support for such an interaction by documenting a multicomponent complex on T1-T4 that corresponds to an E enhanceosome containing proteins bound to both T1-T2 and T3-T4. These results suggest that interactions between T1-T2- and T3-T4-bound factors may contribute to developmentally appropriate activation of the enhancer in vivo. In addition, we provide evidence that proper developmental activation of E might depend on exclusion of phosphorylated CREB-1 from the enhanceosome in DP thymocytes.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Transgenic mice

For the T1-T4 minilocus, an E 0.7 pUC plasmid (21) was digested with BamHI and ApaI to obtain a 275-bp fragment containing the human T1-T4 region. This fragment was blunted by treatment with T4 polymerase and then ligated into pBluescript carrying the previously described enhancerless human TCR minilocus (31) after XbaI digestion, blunting with the Klenow fragment of Escherichia coli DNA polymerase I, and phosphatase treatment. Minilocus structure was confirmed by dideoxynucleotide sequence analysis.

Minilocus DNA was purified as described previously (31) and was microinjected into fertilized C57BL/6xSJL F₂ eggs by the Duke University Comprehensive Cancer Center Transgenic Mouse Shared Resource. Progeny tail DNA samples were analyzed on Southern blots as previously described (31). Transgenes were maintained on a mixed C57BL/6 x SJL background. Copy number was determined by analysis of tail DNA on a slot blot (Schleicher & Schuell, Keene, NH) using radiolabeled C cDNA probe. Hybridization signals were quantified relative to previously identified single copy integrants using a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).

Analysis of V(D)J recombination in unfractionated thymocytes

Genomic DNA was prepared from thymi of 4- to 6-wk-old mice using standard techniques. For single-copy transgenic lines, 12 ng of genomic DNA was used as a template for PCRs. For multicopy integrants, the quantity of DNA used was reduced to account for copy number to insure that the PCR amplifications were in the linear range. All PCRs, gel electrophoresis, blotting, and hybridization with ³²P-labeled probes were performed as previously described (31). Hybridization signals were quantified using a PhosphorImager, and reported values for VDJ recombination were normalized to the C signal for each PCR template.

Analysis of V(D)J recombination in sorted thymocyte populations

For cell sorting, thymocyte populations were obtained as previously described (13), with minor modifications. All Abs were purchased from BD Pharmingen (San Diego, CA). Briefly, to sort DN subpopulations, DN-enriched thymocytes were incubated with anti-CD4-CyChrome, anti-CD8-CyChrome, anti-CD3-CyChrome, anti-CD24-biotin, anti-CD25-FITC, anti-CD44-PE, and unlabeled anti-CD16, followed by streptavidin-PharRed. DN subpopulations were sorted on the basis of CD25 and CD44 staining of CD4^–CD8^–CD3^–CD24⁺ gated cells. To sort DP cells, total thymocytes were incubated with anti-CD4-FITC, anti-CD8-PE, and unlabeled anti-CD16. To sort T cells, DN-enriched thymocytes were incubated with anti- TCR-PE, anti- TCR-FITC, and unlabeled anti-CD16. To sort T cells, total thymocytes were incubated with anti- TCR-PE, anti- TCR-FITC, and unlabeled anti-CD16. Labeled cells gated by forward and side scatter were sorted using a MoFlow sorter (DakoCytomation, Fort Collins, CO). Reanalysis of sorted populations confirmed cell purity. Preparation of cell templates for PCR analysis, conditions for PCR, and primers and probes used to analyze V(D)J recombination of both the murine TCR gene and the human TCR minilocus were previously described (13, 31).

DNase I in vivo footprinting

DNase I treatments were performed as previously described (13). Linker A (32) was annealed to 2 µg of purified thymic DNA from RAG-1^–/– or RAG-2^–/– (R) mice (33) and RAG-2-deficient mice carrying a functionally rearranged TCR transgene (Rx) (34). DNA was precipitated and subjected to PCR as previously described (32). The oligonucleotides used for E top strand analysis were GGGTGTTACCACCAAGACCTGCAA and CCACCAAGACCTGCAAGCCCCAC. Those used for E bottom strand analysis were GTTTCCCACTTCCCTCCAGGTGTTT and CCCACTTCCCTCCAGGTGTTTGGGTC.

EMSAs

Preparation of nuclear extracts from Jurkat cells was performed as previously described (35). Extracts from DN-III and DP cells were prepared from total thymocytes obtained from R and Rx mice (34, 36), respectively. In brief, after a PBS wash, thymocytes were lysed at 0.5 x 10⁶ cells/ml in 50 mM HEPES (pH 7), 250 mM NaCl, 1 mM EDTA, 0.5 mM DTT, 0.5% Triton X-100, 1 mM PMSF, 1 µg/ml pepstatin, 1 µg/ml leupeptin, and 1 µg/ml aprotinin and were incubated for 30 min on ice. Lysates were then centrifuged at 15,000 x g for 15 min at 4°C to separate soluble material from debris, and glycerol was added to a concentration of 20%. Protein concentrations were determined by Bradford assay using a protein assay (Bio-Rad, Munich, Germany). Binding reactions with pure Sp1 contained 0.1 U of human recombinant Sp1 (Promega, Madison, WI).

Binding sites were obtained by PCR using a plasmid containing human 1.4-kb E (KpnI-BamHI fragment) inserted in a version of pBluescript KS⁺ that had previously been modified to eliminate plasmid backbone BstXI sites, generated by J. L. Roberts (Duke University, Durham, NC) as a template, and different combinations of the oligonucleotides T1(5')PCR (TTGGGGGCTGGGGCG), T2(3')PCR (AAACTCTTCTTTCCAGAGGA),T3(5')PCR (AAAATACTGAGTTAGAGATAGC), and T4(3')PCR (CGGTGCAAGTCACCGA). Binding sites were radiolabeled using polynucleotide T4 kinase and [-³²P]ATP. Radiolabeled DNA fragments were purified using Nuc Trap probe purification columns (Stratagene, Cedar Creek, TX). EMSAs were performed as described previously (37) with some modifications. Jurkat nuclear extracts (2 µg) or thymocyte cell extracts (20 µg) were incubated with 2 µg of poly(dI-dC) carrier (Amersham Biosciences, Piscataway, NJ) and 5 µg of BSA in a 30-µl reaction mix containing 10 mM Tris-HCl (pH 7.9), 50 mM NaCl, 33 mM KCl, 5 mM MgCl₂, 1 mM DTT, and 5% glycerol for 30 min at room temperature. Reactions also included, as appropriate, 2 µg of purified Abs or 1 µl of rabbit sera. Anti-Sp1 serum was provided by J. Horowitz (North Carolina State University, Raleigh, NC); anti-pCREB, anti-Ets-1, anti-Fli-1, and anti-GATA-3 Abs were obtained from Santa Cruz Biotechnology (Santa Cruz, CA); anti-TCF-1/LEF-1 Abs were obtained from Santa Cruz Biotechnology and from Kamiya Biomedical (Seattle, WA); purified control Abs were obtained from Sigma-Aldrich (St. Louis, MO); and normal rabbit serum was obtained from DakoCytomation (Carpinteria, CA). Labeled binding site probes (15 fmol, 3 x 10⁴ cpm) were then added for an additional 30 min of incubation at room temperature. Samples were electrophoresed through a 4% polyacrylamide gel containing 22.5 mM Tris-borate and 0.5 mM EDTA at 4°C.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Initiation of V(D)J recombination directed by E, E, and T1-T2 during thymocyte development in adult mice

Previous experiments using a reporter construct consisting of an unrearranged human TCR minilocus in transgenic mice have demonstrated the enhancer dependence of developmentally appropriate V(D)J recombination at the TCR locus (13, 16). The TCR minilocus used in these experiments contains V1, V2, D3, J1, and J3 gene segments; C; and an enhancer within the J3-C intron (31) (Fig. 2A). V gene segments within the construct carry a mutation to avoid expression of a transgene-derived TCR -chain that could interfere with normal T cell development (31). Analysis of the transgenic minilocus driven by human E revealed that the enhancer-dependent VD to J rearrangement step occurs on fetal day 14.5 and at similar levels in both and T cells in adult mice, suggesting that E-dependent V(D)J recombination is activated in early precursors of both and T cells (16). By contrast, in the presence of human E, transgene VD to J recombination was delayed to fetal day 16.5 and was detected exclusively in T cells, suggesting that enhancer-dependent V(D)J recombination is activated exclusively in more mature cells committing to the T cell lineage (16).

View larger version (15K): [in this window] [in a new window]   FIGURE 2. Human TCR minilocus and PCR strategy used to analyze minilocus rearrangements. A, Diagram of E-, E-, T1-T2-, and T1-T4-containing minilocus constructs. , Exons; , protein binding regions. B, PCR products generated from V1 rearrangements are depicted along with the V1 and J1 primers used (arrows). Similar products are generated with V2 and J1 primers.

View larger version (54K): [in this window] [in a new window]   FIGURE 3. PCR analysis of E, E, and T1-T2 minilocus and endogenous TCR rearrangement in sorted thymocyte populations of adult mice. A, Thymocytes from transgenic lines A, J, L, M, T2, and T5 were sorted to obtain the indicated populations. Endogenous V to J rearrangement was amplified by PCR of genomic DNA using VF3 and J57 (nomenclature of Koop et al. (58 )) primers and detected on a Southern blot using a radiolabeled J57 oligonucleotide probe as described previously (13 ). Minilocus V1D3 and V1D3J1 rearrangements were amplified by PCR from the same DNA preparations using V1 and J1 primers and were detected on a Southern blot using a radiolabeled V1 cDNA probe (16 31 ). As a control, minilocus C was amplified using human C primers and were detected using a radiolabeled C cDNA probe (16 31 ). The positions of 1.2-kb V1D3 (VD) and 0.3-kb V1D3J1 (VDJ), C, and VJ PCR products are indicated. B, Reported values for minilocus V1D3J1 rearrangements () are normalized to the C signal for each population and expressed as a percentage of the rearrangement level in T cells. Reported values for endogenous VJ rearrangement () are normalized to the C signal for each population and expressed as a percentage of the rearrangement level in DP thymocytes. The data reflect the mean ± SEM for three or four determinations.

Previous experiments indicated that the T1-T2 fragment of the human 1.4-kb E directed a premature activation of enhancer-dependent VD to J rearrangement, on the basis of elevated rearrangement in T cells and in fetal day 15.5 thymocytes (29). These results were interpreted to indicate that T1-T2 became active in a thymocyte population that is developmentally intermediate between those in which E and E are normally activated. Consistent with this, we found enhancer-dependent V1D3 to J1 rearrangement to be clearly detected in DN-III thymocytes and T cells of T1-T2 transgenic lines T2 and T5 (Fig. 3). Levels of V1-D3-J1 rearrangement in DN-III thymocytes were 26% for line T2 and 22% for line T5. Consistent with a potential for DN-III thymocytes to differentiate to T cells, comparable levels of minilocus rearrangement were detected in T cells (19 and 42% for lines T2 and T5, respectively). In addition, the levels of complete V1-D3-J1 rearrangements were higher in DN-IV thymocytes from T1-T2 lines than from E lines (36 and 67% for lines T2 and T5, respectively). These results confirm the previous supposition that E binding sites outside T1-T2 are critical for the fine control of enhancer function because they restrict activation of the core enhancer until the DN-IV to DP stages of thymocyte development (29).

Chromatin structural changes at E during the transition from DN-III to DP thymocytes

Previous genomic footprinting analysis using dimethylsulfate at the endogenous murine E revealed that T1-T4 elements and flanking areas within E are extensively occupied in DN-III thymocytes, before enhancer activation, with no major differences in enhancer occupancy between DN-III and DP thymocytes (13, 20). Furthermore, analysis of E chromatin structure in DN-III and DP thymocytes, as measured by its sensitivity to DNase I digestion on Southern blots, did not reveal any major differences between the two populations (13), although high resolution analysis did reveal some subtle changes both within the core enhancer, at the edges of the of the TCF/LEF motif, and outside of the minimal E, at the 5' end of T1 and in T3 (20). To further investigate possible changes in chromatin structure that may occur at the DN-III to DP transition and correlate with E activation, we mapped DNase I sensitivity at nucleotide resolution using ligation mediated-PCR (Fig. 4). This technique permits detection of minor changes in chromatin structure resulting from DNA bending as a consequence of protein-DNA interactions (39). As a source of DN-III cells, we used total thymocytes from R mice (33), of which 90% are DN-III and 10% are DN-I and -II (6). As a source of DP cells, we used total thymocytes from Rx mice, essentially all of which are DP (34). We found stage-specific differences in enhancer structure at E sequences both within and outside T1-T2 (Fig. 4). E chromatin was generally more sensitive to DNase I digestion in DN-III thymocytes than in DP thymocytes (bottom strand analysis), suggesting that the protein complex formed on E may be more compact in DP cells than in DN-III cells. Furthermore, we found striking differences in DNase I sensitivity at particular nucleotides. Consistent with the previous analysis (20), we detected diminished DNase I sensitivity at the 5' edge of the TCF/LEF binding site (top strand) in DP compared with DN-III thymocytes. In addition, we identified additional sites of reduced DNase sensitivity at nucleotides in the 5' T1 GC-I box, in the T3 GATA-3 binding site and E box, and in the region between the T4 E box and the downstream GC box. Hence, E undergoes specific chromatin structure changes at the DN-III to DP transition at 5' T1, at T2, at T3, and downstream of T4 that correlate with functional activation of the enhancer. These data are consistent with the idea that precise developmental control relies on enhancer elements situated both within and outside the minimal enhancer.

View larger version (30K): [in this window] [in a new window]   FIGURE 4. Chromatin structure analysis of DN-III and DP thymocytes. Permeabilized thymocytes from R and Rx mice were treated with DNase I, and purified genomic DNA was processed for in vivo footprinting. Differences in DNase I digestion are noted by arrows. Sites of protein binding are indicated.

A T1-T4 enhancer fragment is sufficient for proper developmental regulation of E

To ask whether the enhancer fragment analyzed above, spanning from T1 to downstream of T4, contains all the transcription factor binding sites required for proper developmental activation of V(D)J recombination by E, we generated new lines of transgenic mice in which minilocus recombination is under control of a human 275-bp BstXI-ApaI E fragment, denoted T1-T4 (Figs. 1B and 2A). The 5' end of this fragment is shared with the 116-bp T1-T2 fragment present in lines T2 and T5, whereas the 3' end includes the additional sites in T3 and downstream of T4 that undergo structural changes on transition from DN-III to DP (Figs. 1B and 4). We characterized four independent transgenic lines, designated C2, C3, C4, and C9. Transgene copy numbers were 10, 13, 1 and 5 for lines C2, C3, C4, and C9, respectively. Analysis of minilocus V(D)J recombination in total thymocytes revealed low levels of V1-D3 and high levels of V1-D3-J1 rearrangements in all four transgenic lines, indicating that T1-T4 induces activation of enhancer-dependent V1D3 to J1 rearrangement with an efficiency comparable to E (line A), E (lines J, L, and M) and T1-T2 (lines T2 and T5; Fig. 5). Similar results were obtained in the analysis of rearrangements involving V2 (Fig. 5).

View larger version (87K): [in this window] [in a new window]   FIGURE 5. PCR analysis of T1-T4 minilocus rearrangements in unfractionated thymocytes and sorted thymocyte populations from adult mice. Genomic DNA templates from thymocytes of E (line A), E (lines J, L, and M), T1-T2 (lines T2 and T5), and T1-T4 (lines C2, C3, C4, and C9; all 4–6 wk old) were amplified by PCR using either a V1 (top panel) or V2 (middle panel) primer together with a J1 primer or with C primers (bottom panel) (16 ). Southern blots were probed with radiolabeled V1, V2, or C cDNA fragments (16 ). The positions of 1.2-kb V1D3 and V2D3, and 0.3-kb V1D3J1, V2D3J1, and C PCR products are indicated.

View larger version (53K): [in this window] [in a new window]   FIGURE 6. PCR analysis of T1-T4 minilocus and endogenous TCR rearrangement in sorted thymocyte populations of adult mice. Thymocytes from transgenic lines C2, C3, C4, and C9 were sorted to obtain the indicated populations. Endogenous V to J and minilocus V1D3 and V1D3J1 rearrangements were analyzed as indicated in Fig. 3. The position of 1.2-kb V1D3 (VD) and 0.3-kb V1D3J1 (VDJ), C, and VJ PCR products are indicated. C, Reported values for minilocus V1D3J1 rearrangement () and endogenous VJ rearrangement () represent the mean ± SEM of three determinations and were calculated as outlined in Fig. 3.

Cooperative assembly of the E enhanceosome

Precise developmental control by the T1-T4 fragment suggests that E sequences in the T3-T4 region function to prevent the premature activation of V(D)J recombination that would otherwise be directed by T1-T2 (Figs. 3 and 6). In an attempt to analyze the molecular mechanism for functional collaboration between T1-T2 and T3-T4 binding proteins, we performed EMSAs using T1-T2, T3-T4, and T1-T4 (BstXI-DraI, DraI-ApaI, and BstXI-ApaI enhancer fragments, respectively) in the presence of extracts from Jurkat cells or mouse thymocytes (Figs. 1B and 7).

View larger version (26K): [in this window] [in a new window]   FIGURE 7. Formation of complexes on T1-T2, T3-T4, and T1-T4 in vitro. A, Radiolabeled T1-T2 and T1-T4 (BstXI-DraI and BstXI-ApaI enhancer fragments, respectively) were incubated with Jurkat nuclear extract in the presence of control or specific Abs, as indicated. DNA-protein complexes were resolved by electrophoresis. The multiprotein complexes corresponding to the T1-T2 and the T1-T4 enhanceosomes are marked E12 and E1234, respectively. B, Radiolabeled T1-T2, T3-T4 (DraI-ApaI enhancer fragment), and T1-T4 were incubated with Jurkat nuclear extract or recombinant human Sp1 in the presence of control or specific rabbit serum, as indicated. DNA-protein complexes were resolved by electrophoresis. The Sp1-containing DNA-protein complexes as well as the multiprotein complexes corresponding to the T1-T2, T3-T4, and T1-T4 enhanceosomes are marked E12, E34, and E1234, respectively. C, Radiolabeled T1-T4 was incubated with DN-III or DP thymocyte cell extracts in the presence of control or specific Abs, as indicated. The multiprotein complex corresponding to the T1-T4 enhanceosomes is marked E1234.

Incubation of extracts from Jurkat cells or mouse thymocytes with a T1-T4 probe also resulted in the formation of a series of complexes. Similar to T1-T2, we detected a very slow migrating complex with Jurkat, DN-III, and DP extracts that corresponded to formation of a T1-T4 enhanceosome (labeled as E₁₂₃₄; Fig. 7). The identity of this complex was confirmed by inhibition of its formation in the presence of anti-TCF-1/LEF-1, anti-Ets1, anti-Fli1, and anti-GATA-3 Abs (Fig. 7A and data not shown). Inhibition was specific, because anti-GATA-3 Ab did not affect formation of the enhanceosome formed on T1-T2 (data not shown). The low mobility complex formed on T1-T4 is therefore a consequence of simultaneous binding of TCF-1/LEF-1, Ets-1, and GATA-3 or TCF-1/LEF-1, Fli-1, and GATA-3 to the same DNA molecule. These data support the concept that cooperative assembly of a multiprotein complex on T1-T4 is responsible for developmental activation of E.

T1-T2 contains two GC boxes (the GC-I box located 5' of T1, and the GC-II box located upstream of the cAMP response element (CRE) site within T1)) that can both serve as Sp1 binding sites in vitro (40) (Fig. 1B). Binding of purified Sp1 to T1-T2 was clearly detected by the formation of two complexes, called Sp1 and Sp1* (Fig. 7B), that were supershifted to the top of the well in presence of anti-Sp1 serum (data not shown). Hence, complex Sp1 is probably the result of binding of Sp1 to the GC-I box, whereas complex Sp1* may result from binding of Sp1 to both the GC-I box and the GC-II box within the same DNA molecule. Incubation of T1-T2 with nuclear extracts from Jurkat cells resulted in the formation of several complexes. Two of them displayed the same mobility as the Sp1 complexes. That these complexes are probably identical with the Sp1 complexes detected with purified Sp1 protein was demonstrated by supershift experiments in the presence of anti-Sp1 serum (Fig. 7B). No clear differences were detected in the level of the Sp1 complex formed on T1-T2 in the presence of DN-III or DP cell extracts, indicating that Sp1 from Jurkat cells or thymocytes can bind similarly to the T1-T2 enhancer fragment in vitro (data not shown). Interestingly, although Sp1 from Jurkat or thymocyte cell extracts can bind independently to T1-T2, Sp1 does not seem to be required for formation of E₁₂, because E₁₂ formation is not inhibited by anti-Sp1 (Fig. 7B).

In addition to GC-I and GC-II, T1-T4 contains three GC boxes (III, IV, and V) within T3-T4 (Fig. 1B) that might also serve as binding sites for Sp1. In fact, incubation of purified Sp1 with a T3-T4 probe revealed the formation of two Sp1-containing complexes (Fig. 7B). The more abundant one contains a single molecule of Sp1 (marked Sp1), whereas the other probably contains two Sp1 molecules bound to the same DNA molecule (marked Sp1*). As for E₁₂, the T3-T4 enhanceosome (E₃₄) does not seem to require Sp1, because its formation is not inhibited by anti-Sp1. Thus, Sp1 binds independently to T1-T2 and T3-T4, but is not required for the formation of either E₁₂ or E₃₄. However, in contrast with E₁₂ and E₃₄, the T1-T4 enhanceosome (E₁₂₃₄) contains Sp1, because its formation was dramatically inhibited by anti-Sp1 (Fig. 7B). We conclude that the E₁₂₃₄ results from cooperative assembly of Sp1 with other DNA-binding proteins on T1-T4. The fact that Sp1 is not required for formation of E₁₂ and E₃₄ suggests that Sp1 plays a unique role in the cooperative assembly of E_1234.

The composition of the enhanceosome formed on T1-T4 should differ between DN-III and DP cells to account for E activation during T cell development. However, we found no evidence for differential binding of TCF-1/LEF-1, Ets factors, GATA-3, and Sp1 between DN-III and DP cells (data not shown). One possibility is that developmental activation of E is regulated by post-translational modifications of prebound factors. Previous work had suggested that the phosphorylated form of CREB-1 bound to the isolated T1 CRE site in DN-III, but not DP, extracts (20). Therefore, we performed EMSAs to analyze pCREB-1 binding to T1-T4 during thymocyte development (Fig. 7C). We found that anti-pCREB-1 inhibited formation of E₁₂₃₄ only in DN-III, but not in DP, thymocytes. These data support a model in which dephosphorylation of pCREB-1 might be involved in activation of E during the DN-III to DP transition in vivo.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
Our data define a 275-bp fragment of E (T1-T4) as the minimal enhancer fragment required for correct developmental activation in vivo. Precise developmental activation must therefore be orchestrated by the specific array of transcription factors and coactivators recruited to the region. As we previously found, the T1-T2 fragment seems to be subject to premature activation in vivo, and our results indicate that the T3-T4 region functions to enforce developmentally appropriate activation to T1-T2. Based on the extensive occupancy of T1-T4 in DN-III thymocytes before its activation as well as our current EMSA data, we conclude that T1-T2- and T3-T4-bound factors interact to form a stable multiprotein complex and to precisely regulate the enhancer in vivo. Our data suggest that Sp1 may play a distinctive role in coordinating interactions between T1-T2- and T3-T4-bound factors. Furthermore, our data suggest that dephosphorylation of CREB-1-bound to E might be involved in enhancer activation in the transition from DN-III to DP cells.

An enhanceosome is a compact nucleoprotein structure created by stereospecific interactions between transactivators bound to their cognate sites within an enhancer. This high level of structural organization ensures high level functional cooperativity of the various enhanceosome components (41). In general, architectural proteins are believed to orchestrate the formation of such complexes by facilitating interactions between distantly bound factors to form a specific surface for recruitment of coactivator proteins. T1-T2 has been considered a paradigm for enhanceosome structure (28, 42). TCF-1/LEF-1-induced DNA bending is thought to play an organizing role that promotes specific interactions between ATF/CREB factors and Ets factors bound to distal ends of the enhancer (28), and that helps to recruit non-DNA-binding proteins that provide additional bridges between the various DNA-bound factors (43, 44). Consistent with this model, in vivo studies of T1-T2 occupancy revealed that factor binding occurs in a highly cooperative fashion (40). In agreement with these results, we have been able to detect the formation of a T1-T2 enhanceosome in vitro, as shown by the cooperative assembly of multiple DNA-binding proteins to the same DNA molecule. However, our data also suggest the formation of a higher order enhanceosome structure that extends to regions outside the minimal enhancer. This would be consistent with the chromatin structural changes at the 5' T1 GC-I box, at T3, and downstream of T4 detected during the transition from DN-III to DP thymocytes. Hence, functional interaction between factors bound to T3-T4 and factors bound to T1-T2 provides an additional layer of complexity to the organization of an E enhanceosome that has functional relevance in vivo.

Our data revealed that equivalent levels of TCF-1/LEF-1, Ets factors, GATA-3, and Sp1 are present at the T1-T4 enhanceosome in both DN-III and DP thymocytes (data not shown), suggesting that none of these factors directly triggers activation of E at the DN-III to DP transition. However, these factors have the potential to act as either repressors or activators depending on different developmental or cellular contexts through specific interactions with coactivators or corepressors, or contain autoinhibitory domains (43, 44, 45, 46, 47, 48, 49, 50). Thus, none of these factors can truly be eliminated as mediators of a developmental switch in E function. Other factors, such as early growth response (Egr) factors 1 and 3 have been suggested as potential regulators of E function, because they are induced in the transition from DN-III to DN-IV thymocytes, and they can activate TCR transcription in retrovirally transduced cells (51). Although we have evidence for Egr-1 and Egr-3 binding to the enhancer, anti-Egr Abs did not disrupt enhanceosome assembly (data not shown). Functional experiments are currently in progress to better address a role for Egr factors in E activation.

In addition, E activity may depend on post-translational modifications of prebound factors. CREB/ATF factors are basic leucine zipper transcriptional regulators that have been involved in E function in vitro and in vivo through the T1 CRE site (28, 42). CREB-1 binds to its cognate site as a homodimer or as a heterodimer in association with other members of the CREB/ATF family, including ATF-1 and CRE modulator-1 (CREM-1). This factor is directly coupled to the activation of signal transduction pathways through its phosphorylation at Ser¹³³. CREB-1 is mostly present in an unphosphorylated state in resting thymocytes, and its phosphorylation is induced by different pharmacological stimuli that activate different signaling pathways resembling TCR engagement (52). Although CREB-1 is the major factor that binds to an isolated CRE site in both DN-III and DP cells, pCREB-1 binding has been detected in DN-III cells, but not in DP cells (20). Because phosphorylation of CREB-1 does not affect its affinity for DNA, differences in pCREB-1 binding in DN-III and DP cells should parallel the levels of this protein present in these two populations. Consistent with this, Western blot analysis revealed that pCREB-1 is more abundant in DN-III than in DP thymocytes (data not shown). In agreement with this, our data with T1-T4 indicate that pCREB-1 is an important component for the T1-T4 enhanceosome formed in DN-III cells, but not in DP cells. Although unphosphorylated CREB-1 is the major form of this factor present in both DN-III and DP thymocytes (20, 52), our data with T1-T4 show that pCREB-1 is a major component of the enhanceosome in DN-III cells. These results indicate that pressure must exist for binding of the phosphorylated form of CREB-1 to this enhancer fragment to form a stable multiprotein complex in DN-III thymocytes.

CREB-1 phosphorylation at Ser¹³³ allows specific interaction with the coactivator CREB-binding protein (CBP) and its paralogue p300 (53). These coactivators contain different domains for interaction with transcription factors, and act as integrators for the assembly of the IFN- and TNF- enhanceosomes (54, 55, 56). In both instances, these coactivators are recruited through their interaction with a surface composed by the specific arrangement of CBP/p300-interacting, DNA-bound factors. In fact, it has been demonstrated that cooperative assembly of these enhanceosomes through CBP/p300 recruitment results in functional synergy among several nuclear factors bound to these regions. Interestingly, in addition to pCREB-1, other T1-T4-binding proteins, such as Runx, Ets-1, Sp1, and GATA-3, which are essential for E enhanceosome formation, also interact with CBP/p300 (53). Similar to the IFN- and TNF- enhanceosomes, assembly of a T1-T4 enhanceosome in DN-III cells may require the recruitment of CBP/p300 through a specific surface formed by pCREB-1 and the other CBP/p300-interacting proteins that specifically bind to the enhancer. In agreement with this possibility, stable occupancy of the enhancer in vitro depends on a specific helical phasing relationship between the CRE site and Runx and Ets binding sites (28). In addition, these studies also indicated that recombinant forms of CREB/ATF factors could not generate a stable multiprotein complex on T1-T2, suggesting that these factors might need to be modified or interact with specific coactivators to support enhanceosome assembly (28). Hence, phosphorylation of CREB-1 (and possibly ATF-1 or CREM-1, which are also recognized by the Abs used in our experiments) might be a requirement for the recruitment of CBP/p300 in combination with other enhancer-binding proteins and for the assembly of a stable enhanceosome on T1-T4 in DN-III cells.

Our data suggest that enhancer activation may depend on substitution of pCREB-1 by CREB-1 at E in the transition from DN-III to DP thymocytes. pCREB-1 might be excluded from T1-T4 in DP cells because it may have negative effects on enhancer activity. It has been proposed that pCREB-1 may repress transcription depending on the nucleoprotein context (53). Our results might suggest a different conformation of the T1-T4 enhanceosome that specifically excludes the binding of pCREB-1 in DP cells or that eliminates the pressure for binding of pCREB-1 to form a stable complex.

Our experiments show that although Sp1 can bind independently to both T1-T2 and T3-T4 sequences, it binds preferentially as part of the E enhanceosome in the context of the specific multiprotein complex formed on T1-T4. Sp1-induced DNA bending has been proposed to have an essential role in the architecture and assembly of the TNF- enhanceosome (55), much in the way that TCF-1/LEF-1 functions at the E enhanceosome and HMG-I(Y) proteins function at the IFN- enhanceosome (28, 57). Within the TNF- enhanceosome, Sp1 interacts with proteins bound to abutting sequences and must be in phase with other activators to interact with the basal transcription complex (56). Correctly aligned proteins are thought to form a specific surface to efficiently recruit the coactivator proteins CBP/p300.

Our studies using a human TCR minilocus as a recombination reporter construct in transgenic mice indicate that T1-T2 can stimulate accessibility of recombination signal sequences to the V(D)J recombinase at distances of at least 2 kb, albeit with reduced developmental specificity (Ref. 29 and this study). However, recent studies using gene-targeted mutation at the endogenous TCR locus found that T1-T2 cannot replace E to stimulate the accessibility of J recombination signal sequences over 70 kb (30). Therefore, interactions among T1-T2- and T3-T4-bound factors are probably critical not only for developmental stage specificity, but also for qualitative or quantitative differences in enhancer activity that are required for long-range functions in vivo. Additional gene-targeted mutations of E at the endogenous locus will be required to address these issues in greater detail.

	Acknowledgments

 
We thank Cheryl Bock for generation of transgenic mice at the Duke University Shared Transgenic Mouse Facility, Hubertus Kohler and Tracy Hayden for their help with sorting experiments at the Basel Institute for Immunology, Allison Dwileski for help with statistics and graphical representation of data, Juan Carabaña for providing us with thymocyte extracts, and Carlos Suñé for experimental help and comments on the manuscript. C.H.M. wants to thank Miguel A. Alonso and Carlos Suñé for allowing her to finish this work in their laboratories at the Centro de Biología Molecular Severo Ochoa and the Centro Nacional de Biotecnología, respectively, in Madrid, Spain.

	Footnotes

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ This work was supported by a grant from the Spanish Ministry of Science and Technology (BCM2002–01446), a grant from the National Institutes of Health (GM41052), and the Basel Institute for Immunology, which was founded and supported by Hoffman-La Roche. C.H.M. is supported by the Ramón y Cajal Program from the Spanish Ministry of Education and Science.

² N.B. and N.Z. contributed equally to this work.

³ Current address: Basilea Pharmaceuticals. Grenzacherstrasse 487, 4005 Basel, Switzerland.

⁴ Address correspondence and reprint requests to Dr. Cristina Hernández-Munain at the current address: Centro Nacional de Biotecnología, Consejo Superior de Investigaciones Científicas, Universidad Autónoma de Madrid, C/ Darwin 3, Cantoblanco, 28049 Madrid, Spain. E-mail address: chdez{at}cnb.uam.es

⁵ Abbreviations used in this paper: DN, double negative, CD4^–CD8^– thymocyte; ATF, activation transcription factor; bHLH, basic helix-loop-helix; CBP, CREB-binding protein; CRE, cAMP response element; CREM-1, CRE modulator-1; DP, double positive, CD4⁺CD8⁺ thymocyte; E, TCR enhancer; E, TCR enhancer; Egr, early growth response; LEF-1, lymphocyte enhancer-binding factor-1; TCF-1, T cell factor-1.

Received for publication September 24, 2003. Accepted for publication August 12, 2004.

	References

Top Abstract Introduction