The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shirota, H.
Right arrow Articles by Klinman, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shirota, H.
Right arrow Articles by Klinman, D. M.
Right arrowPubmed/NCBI databases
*Substance via MeSH
The Journal of Immunology, 2004, 173: 5002-5007.
Copyright © 2004 by The American Association of Immunologists

Suppressive Oligodeoxynucleotides Inhibit Th1 Differentiation by Blocking IFN-{gamma}- and IL-12-Mediated Signaling1

Hidekazu Shirota, Mayda Gursel and Dennis M. Klinman2

Section of Retroviral Immunology, Center for Biologics Evaluation and Research, U.S. Food and Drug Administration, Bethesda, MD 20892


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Repetitive TTAGGG motifs present at high frequency in mammalian telomeres can suppress Th1-mediated immune responses. Synthetic oligonucleotides (ODN) containing TTAGGG motifs mimic this activity and have proven effective in the prevention/treatment of certain Th1-dependent autoimmune diseases. This work explores the mechanism by which suppressive ODN block the induction of Th1 immunity. Findings indicate that these ODN inhibit IFN-{gamma}-induced STAT1 phosphorylation and IL-12-induced STAT3 and STAT4 phosphorylation. As a result, T-bet expression is reduced as is the maturation of naive CD4+ cells into Th1 effectors. These changes indirectly support the generation of Th2-dominated immune responses. Suppressive ODN may thus represent a novel approach to influence the Th1:Th2 balance in vivo.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Deoxyribonucleic acid has multiple and complex effects on the immune system. Bacterial DNA contains "CpG motifs" that trigger an immune response through TLR9 (1, 2, 3), while the telomeric ends of mammalian DNA contain large numbers of TTAGGG repeats that inhibit these immune responses (4). Synthetic oligonucleotides (ODN)3 containing TTAGGG motifs mimic the activity of telomeric DNA, reducing Th1 and proinflammatory cytokine production (4, 5). In murine models, suppressive TTAGGG ODN have been effective in the prevention/treatment of a variety of organ-specific and systemic autoimmune diseases (5, 6, 7, 8).

Previous studies showed that ODN containing poly(G) and to a lesser extent poly(GC) motifs could suppress Th1 responses (5, 8). Yet little is known about the cellular targets of suppressive ODN, the molecular mechanism by which they inhibit Th1 responses, or their effect on Th2 immunity. Thus, studies were undertaken to explore the ability of suppressive ODN to modulate T cell maturation and activation. Experiments focused on CD4+ T cells, since they play a key role in both Ag-specific protective responses and pathologic autoimmune responses (9).

Stimulating the TCR of naive CD4+ cells triggers them to differentiation into either Th1 or Th2 effectors (10). Th1 cells contribute to the development of delayed-type hypersensitivity reactions and cell-mediated immunity, whereas Th2 cells facilitate the induction of humoral immune responses (11). These two cell types form an interactive and mutually inhibitory network in which type 1 cytokines promote the maturation of Th1 and inhibit the maturation of Th2 cells and vice versa (12, 13).

Current findings indicate that suppressive ODN selectively reduce Th1 cytokine production, while enhancing Th2 immunity. These effects derive from the ability of suppressive ODN to inhibit the IFN-{gamma} and IL-12 signaling pathways, thereby blocking the differentiation of naive CD4+ T cells into Th1 effectors. Although suppressive ODN do not directly promote Th2 differentiation, the resulting decrease in IFN-{gamma} production facilitates the development of strong Th2 responses.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals

Female BALB/c (6–8 wk old) were obtained from the National Cancer Institute (Frederick, MD). DO11.10 OVA-TCR-transgenic (Tg) mice (14) (on BALB/c background) were obtained from The Jackson Laboratory (Bar Harbor, ME). TLR9-deficient mice (1) (on BALB/c background) were kindly provided by Dr. S. Akira (Osaka University, Osaka, Japan). All studies were approved by the Center for Biologics Evaluation and Research Animal Care and Use Committee.

T cells

CD4+ T cells were isolated from BALB/c splenocytes by negative selection using a combination of anti-MHC class II, anti-CD8, anti-DX5, anti-CD11c, and anti-CD11b microbeads (Miltenyi Biotec, Auburn, CA). The resulting cell population contained >90% CD4+ cells and <0.5% CD8+, I-A+, or DX5+ cells, as measured by flow cytometry.

Con A-activated T cells were prepared as described previously (15). Briefly, BALB/c spleen cells (2 x 106/ml) were stimulated with 2 µg/ml Con A (Pharmacia Biotech, Uppsala, Sweden). After 3 days of culture, the cells were harvested and cultured in medium containing 0.5% FBS for an additional 16 h to synchronize their cell cycle at G1. T cell blasts were isolated by centrifugation over Histopaque (Sigma-Aldrich, St. Louis, MO) at 1500 x g for 15 min. This population of cells normally contained >98% T cell blasts as measured by flow cytometry. The IL-12-responsive murine T cell clone (16) (2D6 cell, kindly provided by Dr. H Fujiwara, Osaka University, Osaka, Japan) was maintained by stimulation with IL-12 (250 pg/ml; R&D Systems, Minneapolis, MN) and used 12–24 h after IL-12 depletion.

Oligodeoxynucleotides

Endotoxin-free phosphorothioate ODN were synthesized at the Center for Biologics Evaluation and Research core facility. The following ODN were used: suppressive ODNA151 (TTAGGGTTAGGGTTAGGGTTAGGG) and control ODN1612 (GCTAGAGCTTAGGCT).

Cytokine ELISAs

Cytokine levels in culture supernatants were measured by ELISA, as described previously (17). Paired anti-IL-4 and anti-IFN-{gamma} mAbs were purchased from BD Pharmingen (San Diego, CA). Ninety-six-well Immulon H2B plates (Thermo LabSystems, Franklin, MA) were coated with first-stage cytokine-specific Abs and then blocked with PBS/1% BSA. Culture supernatants were added, and bound cytokine was detected by the addition of biotin-labeled secondary Ab, followed by phosphatase-conjugated avidin and a phosphatase-specific colorimetric substrate (PNPP; Pierce, Rockford, IL). Standard curves were generated using recombinant cytokines purchased from R&D Systems. The detection limit for these assays was <15 pg/ml for IFN-{gamma} and <3.8 pg/ml for IL-4. All assays were performed in triplicate.

In vitro stimulation of spleen cells to monitor Th differentiation

Spleen cells (2.5 x 106/ml) from unimmunized DO11.10 mice were stimulated in vitro for 3 days with 100 µg/ml OVA (Sigma-Aldrich) with or without 5 µM ODN, 10 µg/ml anti-IFN-{gamma} mAb (R&D Systems) and, in some cases, with 300 pg/ml recombinant mouse IL-12. The cells were washed and incubated for 2 more days in medium alone. Briefly, 3 x 104 viable lymphocytes recovered by density gradient centrifugation over Ficoll-Paque (Pharmacia Biotech) were restimulated with 2 x 105 APCs in the presence of 100 µg/ml OVA in 96-well plates. APCs were prepared by treating spleen cells from unimmunized BALB/c mice with 50 µg/ml mitomycin C (Wako Pure Chemical, Osaka, Japan) for 30 min at 37°C. After 2 days, the culture supernatants were assayed for IFN-{gamma} and IL-4 levels (18, 19). All studies were performed in triplicate

To examine Ag-independent T cell differentiation in the absence of APCs, naive CD4+ T cells (2.5 x 106/ml) were stimulated in vitro with 0.1 µg/ml immobilized anti-CD3{epsilon} mAb (BD Pharmingen), 1 µg/ml soluble anti-CD28 mAb (BD Pharmingen) with or without 5 µM ODN, 10 µg/ml anti-IFN-{gamma} mAb, and/or 300 pg/ml IL-12. After 3 days, cells were washed and cultured in fresh medium for 2 more days. Briefly, 3 x 104 viable lymphocytes were restimulated with immobilized anti-CD3{epsilon} mAb (0.1 µg/ml) in 96-well plates. After 24 h, the culture supernatants were assayed for IFN-{gamma} and IL-4 (20).

In vivo induction of effector Th cells detected by in vitro restimulation

To examine the activity of in vivo-activated T cells, BALB/c mice were primed i.p. with 100 µg of OVA emulsified in IFA. They were injected with 400 µg of ODN on the same day or 2 days after vaccination. On day 14, spleen cells (3 x 105/well) were isolated and restimulated in vitro with 100 µg/ml OVA for 48 h or anti-CD3{epsilon} mAb for 16 h in triplicate in 96-well plates.

RT-PCR analysis

Total RNA was extracted from target cells using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA) as recommended by the manufacturer. Five micrograms of total RNA was reverse-transcribed in first-strand buffer (50 mM Tris-HCl (pH 7.5), 75 mM KCl, and 2.5 mM MgCl2) containing 25 µg/ml oligo(dT)12–18, 200 U Moloney leukemia virus reverse transcriptase, 2 mM dNTP, and 10 mM DTT. The reaction was conducted at 42°C for 1 h. A standard PCR was performed on 1 µl of the cDNA synthesis for 24 cycles using the following primer pairs: mouse T-bet, CGCTGGGGCCCCTTCTCCTTTTG and CCCAGTCCGCCCGCAGTCACC and mouse {beta}-actin, GACATGGAGAAGATCTGGCAACCACA and ATCTCCTGCTCGAAGTCTAGAGCAA. Aliquots of the PCR were separated on a 1.5% agarose gel and visualized with UV light after ethidium bromide staining.

Western blots

Con A-activated T cells were incubated with various stimuli, washed with PBS, and lysed in cold lysis buffer containing protease and phosphatase inhibitors. This solution was boiled for 5 min, size separated on a 4–12% gradient SDS-PAGE, and transferred onto a polyvinylidene difluoride membrane. Immunoblots were probed with Abs specific to phospho-STAT1 (Tyr701), phospho-STAT3 (Tyr705), phospho-STAT5 (Tyr694), phospho-STAT6 (Tyr641)(New England Biolabs, Beverly, MA), and phospho-STAT4 (Tyr693) (Zymed Laboratories, South San Francisco, CA), followed by HRP-coupled donkey secondary Abs. Signals were visualized by autoradiography using the LumiGLO detection kit (New England Biolabs). Blots were then stripped and reprobed with specific Abs to STAT1, STAT3, STAT5, STAT6 (New England Biolabs), and STAT4 (Santa Cruz Biotechnology, Santa Cruz, CA).

Statistical analysis

Student’s t test was used to analyze all results. To facilitate comparisons when an experiment was repeated multiple times, results were standardized by calculating the fold change vs the control group in each individual experiment. Correlation analysis is computed by linear correlation analysis between cytokine production vs concentration of suppressive ODN.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Suppressive ODN modulate Ag-specific T cell differentiation in vitro

To examine the effect of suppressive ODN on the activation of Ag-specific T cells in vitro, splenocytes from OVA TCR Tg mice were cultured with optimized concentrations of OVA with or without ODN (18, 19). When restimulated with Ag-pulsed APCs, cells cultured in the presence of suppressive ODN produced 5-fold more IL-4 (p < 0.05) but significantly less IFN-{gamma} than cells cultured in OVA alone (p < 0.01, Fig. 1, A and B). These differences in cytokine production were selectively mediated by suppressive ODN since control ODN had no effect on cytokine levels (Fig. 1, A and B). The magnitude of the changes in cytokine production mediated by suppressive ODN was similar to those elicited by coculture with anti-IFN-{gamma}, an immune modulator known to strongly inhibit Th1 differentiation (Fig. 1, A and B, and Refs. 20 and 21).



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 1. Effect of suppressive ODN on the differentiation of Ag-stimulated T cells. Spleen cells from OVA-specific TCR Tg mice were cultured with 100 µg/ml OVA with or without 5 µM ODN, anti-IFN-{gamma} mAb, and/or IL-12 as described in Materials and Methods. These cells were then restimulated with OVA-pulsed APCs and assayed for IFN-{gamma} (A and C) or IL-4 (B and D) production. In four independent experiments, average IFN-{gamma} production by OVA-stimulated cells was 461 ± 542 pg/ml, while IL-4 production was 97 ± 53 pg/ml. To facilitate comparisons between experiments, the fold change in cytokine production in each treatment group was calculated relative to the OVA-alone group in that experiment. Results represent the mean ± SD of all four experiments. *, p < 0.05; **, p < 0.001 (compared with the OVA-alone group). The correlation coefficient of cytokine production vs ODN concentration was determined by linear analysis. Note that in the absence of OVA stimulation, no cytokine production was detected. Sup, Suppressive; Cont, control.

 
To further explore the effect of suppressive ODN on cytokine production, these studies were repeated in the presence of IL-12. IL-12 promotes Th1 immune responses, characterized by a significant increase in IFN-{gamma} and decrease in IL-4 production (Fig. 1, A and B, and Ref.22). Yet even in the presence of IL-12, suppressive ODN significantly increased IL-4 while decreasing IFN-{gamma} production (Fig. 1, C and D). These effects were dose related (IFN-{gamma}, R = –0.75; IL-4, R = 0.94), consistent with suppressive ODN promoting Th2 while inhibiting Th1 differentiation in vitro.

To examine whether suppressive ODN were directly inhibiting the differentiation of naive T cells, purified CD4+ lymphocytes were cultured with ODN plus a combination of anti-CD3{epsilon} plus anti-CD28 mAbs. Under these conditions (in which APCs were absent), suppressive ODN again increased IL-4 while decreasing IFN-{gamma} production (Fig. 2, A and B). Adding IL-12 during culture enhanced Th1 differentiation, yet this effect was again reduced by inclusion of suppressive (but not control) ODN (Fig. 2, C and D).



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 2. Suppressive ODN act directly on naive T cells. Purified CD4+ T cells from BALB/c (A–D) and TLR9 KO (E–H) mice were stimulated with anti-CD3{epsilon} and anti-CD28 mAb with or without ODN or anti-IFN-{gamma} mAb in the absence (A, B, E, and F) or presence (C, D, G, and H) of IL-12. These cells were restimulated with anti-CD3{epsilon} and assayed for IFN-{gamma} (A, C, E, and G) or IL-4 (B, D, F, and H) production. In three to four independent experiments, average IFN-{gamma} and IL-4 production following Ab stimulation alone was similar in WT and KO mice, ranging from 1070 ± 177 pg/ml (A) and 2140 ± 1230 pg/ml (C), while IL-4 production was 113 ± 26 pg/ml (B) and 52 ± 46 pg/ml (D). To facilitate comparisons between experiments, the fold change in cytokine production in each treatment group was calculated relative to the Abs alone group. *, p < 0.05; **, p < 0.001 (compared with the (–) group). Note that in the absence of anti-CD3 stimulation, no cytokine production was detected. Sup, Suppressive; Cont, control.

 
Although originally identified by their ability to suppress CpG-induced immune activation, the class of suppressive ODN typified by ODN A151 has been shown to down-modulate Th1 responses induced by other immune stimuli (5). To confirm that the effects observed on CD4 T cells were not CpG related, these experiments were repeated using cells from TLR9 KO mice. As seen in Fig. 2, ODN A151 had the same effect on the activation of CD4+ T cells from wild-type (WT) and TLR9 knockout (KO) mice. Since neither Ags nor APCs contributed to T cell maturation in this model system, these findings suggest that suppressive ODN directly promote the differentiation of naive T cells into Th2 rather than Th1 effectors in a TLR9-independent manner.

Suppressive ODN modulate Ag-specific T cell differentiation in vivo

To determine whether suppressive ODN can influence T cell differentiation in vivo, the effect of administering A151 with Ag was examined. Normal BALB/c mice were immunized with OVA in IFA and injected at the same site (i.p.) with 300 µg of ODN on days 0 and 2. This dose and frequency of ODN administration was previously shown to be effective in vivo (5, 6, 7). The cytokine profile of the resultant immune response was monitored by restimulating spleen cells with Ag in vitro. As seen in Fig. 3, A and B, splenocytes from mice immunized with OVA plus suppressive ODN produced significantly more IL-4 and less IFN-{gamma} than cells from animals immunized with OVA alone (or OVA plus control ODN, p < 0.05). These findings were confirmed by monitoring the number of spleen cells secreting IL-4 and IFN-{gamma} by ELISPOT assay (data not shown).



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 3. Modulation of Ag-specific T cell differentiation by suppressive ODN in vivo. BALB/c mice were immunized with OVA in IFA and injected i.p. with free ODN 5 min and 2 days later. On day 14, splenocytes were stimulated with OVA (A and B) for 48 h and anti-CD3{epsilon} mAb (C and D) for 16 h and monitored for IFN-{gamma} and IL-4 production. Data represent the mean ± SD of four independently analyzed mice per group, and were confirmed in three additional experiments. *, p < 0.05 (compared with the PBS treatment group). Note that in the absence of OVA or anti-CD3{epsilon} Ab stimulation, no cytokine production was detected. Sup, Suppressive; Cont, control.

 
To examine the effect of suppressive ODN on the broader T cell pool, spleen cells from OVA-immunized mice were stimulated in vitro with anti-CD3{epsilon} mAb. This brief Ag-independent activation triggered the production of both IL-4 and IFN-{gamma} (Fig. 3, C and D). Of interest, there was no difference in the amount of cytokine produced by cells from mice treated with control vs suppressive ODN. Thus, administering suppressive ODN during the induction of Ag-specific immunity selectively promoted a Th2-biased Ag-specific response, but did not alter the global Th1:Th2 balance in vivo.

Suppressive ODN inhibit the early differentiation of naive CD4+ T cells into Th1 effectors

Naive CD4+ T cells produce IFN-{gamma} and/or IL-4 in response to TCR stimulation (21). The resultant cytokine milieu influences whether these T cells subsequently differentiate into Th1 or Th2 effectors (23). To examine the effect of suppressive ODN on this very early cytokine production, purified CD4+ lymphocytes were stimulated in vitro with anti-CD3{epsilon} plus anti-CD28 mAbs. The cells produced low but detectable levels of IFN-{gamma}, an effect reduced by coculture with suppressive ODN (p < 0.05, Fig. 4A). Adding IL-12 to these cultures amplified IFN-{gamma} production, but this effect was significantly reduced by inclusion of suppressive ODN. Of interest, suppressive ODN did not increase IL-4 production by naive CD4+ T cells at this early time point (Fig. 4B). These findings suggest that suppressive ODN selectively inhibit the production of IFN-{gamma} but do not alter IL-4 production by naive T cells. Similar results were obtained when naive CD4+ cells were stimulated by other polyclonal activators and when naive CD4+ cells from TLR9-deficient mice were studied (data not shown).



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 4. Inhibition of IFN-{gamma} production by various stimulations in T cells. Purified CD4+ T cells were cultured with ODN for 30 min and then stimulated with anti-CD3{epsilon} mAb, anti-CD28 mAb, or ODN with or without IL-12 for 2 days. The concentration of IFN-{gamma} and IL-4 in culture supernatants was determined by ELISA. Results represent the average ± SD of four animals per group, and the experiment was repeated three times with similar results. In the absence of anti-CD3{epsilon} mAb, neither cytokine was produced. *, p < 0.05 (compared with the (–) group). Sup, Suppressive; Cont, control.

 
Effect of suppressive ODN on cytokine-induced STAT phosphorylation

The effect of suppressive ODN on IFN-{gamma}-driven T cell differentiation was explored. A critical step in the signaling cascade that culminates in IFN-{gamma} production is IFN-{gamma}-induced STAT1 phosphorylation (24). As seen in Fig. 5A, suppressive ODN block this step. In addition, suppressive ODN inhibit the up-regulation of T-bet, IFN-{gamma}-inducible protein 10, and IFN regulatory factor 1 mRNA expression (Fig. 5B and data not shown). In contrast, suppressive ODN had no effect on IL-2-dependent STAT 5 phosphorylation or IL-4-dependent STAT6 phosphorylation (Fig. 5, C and D).



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 5. Suppressive (Sup) ODN inhibit IFN-{gamma} but not IL-2 and IL-4 signaling. Con A-activated T cells were incubated with ODN for 30 min and then treated with IFN-{gamma} (A), IL-2 (C), or IL-4 (D) for 20 min. Cells were lysed and analyzed by Western blot using anti-Tyr-phosphorylated STAT1 (pSTAT1) and anti-STAT1 Abs (A), anti-Tyr-phosphorylated STAT5 (pSTAT5), and anti-STAT5 Abs (C), and anti-Tyr-phosphorylated STAT6 (pSTAT6) and anti-STAT6 Abs (D). The experiments were repeated twice with similar results. B, Purified CD4+ T cells were stimulated for 3 days as described in Fig. 2. Total RNA from these cells was analyzed by RT-PCR. Levels of T-bet and {beta}-actin expression are shown (one example of four experiments yielding similar results). Cont, Control.

 
Previous studies established that the IL-12 signaling pathway plays a central role in Th1 differentiation. As seen in Fig. 6A, suppressive ODN inhibited tyrosine phosphorylation of STAT4 and STAT3 in T cells stimulated with IL-12. The magnitude of this inhibition was dose dependent and was mediated by suppressive but not control ODN. To confirm this finding, the IL-12-responsive 2D6 T cell clone was studied. As above, suppressive ODN inhibited IL-12-induced phosphorylation of STAT3 and STAT4 (Fig. 6B). These results suggest that suppressive ODN inhibit T cell differentiation by selectively blocking the phosphorylation of STAT1, STAT3, and STAT4.



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 6. Inhibition of IL-12-induced STAT3 and STAT4 phosphorylation by suppressive ODN. Con A-activated T cells (A) or the 2D6 T cell clone (B) were incubated with the indicated dose of ODN for 30 min and then treated with the indicated dose of IL-12 for 30 min. Cell lysates were analyzed by Western blot using anti-Tyr-phosphorylated STAT3 (pSTAT3) and anti-STAT3 Abs and anti-Tyr-phosphorylated STAT4 (pSTAT4) and anti-STAT4 Abs. The experiments were repeated three times with similar results.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study examines the effect of suppressive ODN containing telomeric TTAGGG motifs on naive CD4+ T cells. Results indicate that these suppressive ODN inhibit the differentiation of naive T cells into Th1 effectors, thereby skewing the resultant response to favor type 2 cytokine production (Figs. 1–3). This effect of suppressive ODN is detectable within 2 days of TCR engagement following either Ag-specific or polyclonal T cell activation (Fig. 4). Evidence that suppressive ODN inhibit IFN-{gamma}-induced STAT1 phosphorylation and IL-12-induced STAT3 and STAT4 phosphorylation (Figs. 5 and 6) provides insight into the mechanism underlying this effect.

Available evidence suggests that two distinct "classes" of suppressive ODN may exist. The first class, identified by Krieg and colleagues, is composed of GC-rich DNA and selectively inhibits CpG-induced immune activation (8, 25, 26, 27, 28). GC-rich ODN interfere with the binding of CpG DNA to TLR9, thus reducing CpG-dependent activation of NF-{kappa}B and AP-1 (28, 29). However, GC-rich ODN do not block other forms of immune activation, nor do they inhibit the IFN-{gamma} or IL-12 signaling cascades (data not shown).

The second class of suppressive ODN contains poly(G) motifs, such as those found in the TTAGGG multimers evaluated in the current work (4). This class of ODN has broader immunosuppressive activity, characterized by the ability to modulate both Ag-specific and polyclonal immune activation (5, 8, 30, 31, 32) in a TLR9-independent manner. Consistent with this observation, ODN A151 modulated the Th profile of cells from both WT and TLR9 KO mice (Fig. 2). Although T cells do not bind ODN as effectively as APCs (33, 34), preliminary studies in our laboratory established that FITC-labeled suppressive ODN do bind CD3+ T cells (data not shown). In this context, Halpern and Pisetsky (35) recently demonstrated that poly(G) ODN inhibit IFN-{gamma} production by polyclonally activated T cells.

IFN-{gamma} gene expression during CD4+ T cell activation is mediated by signals transduced through the TCR, IL-12R, and/or IFN-{gamma}R (20, 36, 37). Th1 maturation involves IFN-{gamma}-mediated phosphorylation of STAT1, which in turn up-regulates expression of the T-bet transcription factor (38, 39). Current findings indicate that suppressive G-rich ODN inhibit IFN-{gamma}-induced STAT1 phosphorylation (Fig. 5A) and the concomitant up-regulation of T-bet expression (Fig. 5B). IL-12 also plays a critical role in Th1 differentiation through a signaling cascade that proceeds through STAT3 and STAT4 (40). Our results demonstrate that suppressive ODN block IL-12-dependent STAT3 and STAT4 phosphorylation (Fig. 6). Thus, it appears that broadly suppressive ODN impair the generation of Th1 immunity by blocking both the IFN-{gamma} and IL-12 signaling pathways. Consistent with these findings, Jing et al. (41) recently demonstrated that phosphodiester G-rich ODN inhibit IFN-{gamma}-dependent STAT1 activation and IL-6-dependent STAT3 activation of a cancer cell line. Based on nuclear magnetic resonance studies, those authors suggest that G-rich ODN may interact with the Src homology domain of STAT3. We found the effect of suppressive ODN to be highly specific, since 1) control ODN had no effect on STAT1, STAT3, or STAT4 phosphorylation (Figs. 5 and 6) and 2) suppressive ODN did not inhibit the STAT5 or STAT6 phosphorylation (Fig. 5). Indeed, although suppressive ODN promoted the generation of IL-4-dominated responses, they did not up-regulate STAT6 phosphorylation. Thus, it appears that suppressive ODN, by blocking the production of Th1 cytokines, support the generation of Th2 cells occurring"by default."

There is considerable evidence that organ-specific autoimmune diseases are Th1 mediated (9, 42). Thus, the ability of suppressive ODN to selectively inhibit Th1-dependent immune responses is of potential therapeutic importance. In this context, several recent reports indicate that suppressive ODN can prevent/treat autoimmune diseases such as arthritis, systemic lupus erythematosus, and experimental autoimmune encephalomyelitis4 (5, 8). This is consistent with our hypothesis that TTAGGG motifs released from injured host cells act to down-regulate overexuberant or pathologic immune responses. Ongoing efforts to identify the precise mechanism(s) through which suppressive ODN limit undesirable immune responses should facilitate the development of agents with greater activity and therapeutic utility.


    Acknowledgments
 
We thank Dr. Ihsan Gursel for his intellectual support.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 The assertions herein are the private ones of the authors and are not to be construed as official or as reflecting the views of U.S. Army Medical Research Institute of Infectious Diseases or the Food and Drug Administration at large. Back

2 Address correspondence and reprint requests to Dr. Dennis M. Klinman, Building 29A Room 3 D10. Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, MD 20892. E-mail address: Klinman{at}cber.fda.gov Back

3 Abbreviations used in this paper: ODN, oligodeoxynucleotide; Tg, transgenic; KO, knockout; WT, wild type. Back

4 L. Dong, S. Ito, K. J. Ishii, and D. M. Klinman. Suppressive oligonucleotides delay the onset of glomerulonephritis and prolong the survival of lupus-prone NZB/W mice. Submitted for publication. Back

Received for publication May 11, 2004. Accepted for publication August 6, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hemmi, H., O. Takeuchi, T. Kawai, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, S. Akira. 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408:740.[Medline]
  2. Bauer, S., C. J. Kirschning, H. Hacker, V. Redecke, S. Hausmann, S. Akira, H. Wagner, G. B. Lipford. 2001. Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. Proc. Natl. Acad. Sci. USA 98:9237.[Abstract/Free Full Text]
  3. Takeshita, F., C. A. Leifer, I. Gursel, K. Ishii, S. Takeshita, M. Gursel, D. M. Klinman. 2001. Cutting edge: role of Toll-like receptor 9 in CpG DNA-induced activation of human cells. J. Immunol. 167:3555.[Abstract/Free Full Text]
  4. Gursel, I., M. Gursel, H. Yamada, K. J. Ishii, F. Takeshita, D. M. Klinman. 2003. Repetitive elements in mammalian telomeres suppress bacterial DNA-induced immune activation. J. Immunol. 171:1393.[Abstract/Free Full Text]
  5. Dong, l., S. Ito, K. J. Ishii, D. M. Klinman. 2004. Suppressive oligodeoxynucleotides protect against the development of collagen-induced arthritis in mice. Arthritis Rheum. 50:1686.[Medline]
  6. Zeuner, R. A., K. J. Ishii, M. J. Lizak, I. Gursel, H. Yamada, D. M. Klinman, D. Verthelyi. 2002. Reduction of CpG-induced arthritis by suppressive oligodeoxynucleotides. Arthritis Rheum. 46:2219.[Medline]
  7. Zeuner, R. A., D. Verthelyi, M. Gursel, K. J. Ishii, D. M. Klinman. 2003. Influence of stimulatory and suppressive DNA motifs on host susceptibility to inflammatory arthritis. Arthritis Rheum. 48:1701.[Medline]
  8. Ho, P. P., P. Fontoura, P. J. Ruiz, L. Steinman, H. Garren. 2003. An immunomodulatory GpG oligonucleotide for the treatment of autoimmunity via the innate and adaptive immune systems. J. Immunol. 171:4920.[Abstract/Free Full Text]
  9. Romagnani, S.. 1996. Th1 and Th2 in human diseases. Clin. Immunol. Immunopathol. 80:225.[Medline]
  10. Mosmann, T. R., H. Cherwinski, M. W. Bond, M. A. Giedlin, R. L. Coffman. 1986. Two types of murine helper T cell clones. I. Definition according to profiles of lymphokine activities and secreted proteins. J. Immunol. 136:2348.[Abstract]
  11. Liew, F. Y.. 2002. TH1 and TH2 cells: a historical perspective. Nat. Rev. Immunol. 2:55.[Medline]
  12. Mosmann, T. R., R. L. Coffman. 1987. Two types of mouse helper T-cell clone. Immunol. Today 8:223.
  13. Mosmann, T. R., J. H. Schumacher, N. F. Street, R. Budd, A. O’Garra, T. A. Fong, M. W. Bond, K. W. Moore, A. Sher, D. f. Fiorentino. 1991. Diversity of cytokine synthesis and function of mouse CD4+ T cells. Immunol. Rev. 123:209.[Medline]
  14. Hosken, N. A., K. Shibuya, A. W. Heath, K. M. Murphy, A. O’Garra. 1995. The effect of antigen dose on CD4+ T helper cell phenotype development in a T cell receptor-{alpha}{beta}-transgenic model. J. Exp. Med. 182:1579.[Abstract/Free Full Text]
  15. Bright, J. J., L. D. Kerr, S. Sriram. 1997. TGF-{beta} inhibits IL-2-induced tyrosine phosphorylation and activation of Jak-1 and Stat 5 in T lymphocytes. J. Immunol. 159:175.[Abstract]
  16. Maruo, S., H. J. Ahn, W. G. Yu, M. Tomura, M. Wysocka, N. Yamamoto, M. Kobayashi, T. Hamaoka, G. Trinchieri, H. Fuijiwara. 1997. Establishment of an IL-12-responsive T cell clone: its characterization and utilization in the quantitation of IL-12 activity. J. Leukocyte Biol. 61:346.[Abstract]
  17. Klinman, D. M., A. Yi, S. L. Beaucage, J. Conover, A. M. Krieg. 1996. CpG motifs expressed by bacterial DNA rapidly induce lymphocytes to secrete IL-6, IL-12 and IFN{gamma}. Proc. Natl. Acad. Sci. USA 93:2879.[Abstract/Free Full Text]
  18. Shirota, H., K. Sano, T. Kikuchi, G. Tamura, K. Shirato. 2000. Regulation of murine airway eosinophilia and Th2 cells by antigen-conjugated CpG oligodeoxynucleotides as a novel antigen-specific immunomodulator. J. Immunol. 164:5575.[Abstract/Free Full Text]
  19. Shirota, H., K. Sano, N. Hirasawa, T. Terui, K. Ohuchi, T. Hattori, K. Shirato, G. Tamura. 2001. Novel roles of CpG oligodeoxynucleotides as a leader for the sampling and presentation of CpG-tagged antigen by dendritic cells. J. Immunol. 167:66.[Abstract/Free Full Text]
  20. Bradley, L. M., D. K. Dalton, M. Croft. 1996. A direct role for IFN-{gamma} in regulation of Th1 cell development. J. Immunol. 157:1350.[Abstract]
  21. Miner, K. T., M. Croft. 1998. Generation, persistence, and modulation of Th0 effector cells: role of autocrine IL-4 and IFN-{gamma}. J. Immunol. 160:5280.[Abstract/Free Full Text]
  22. Manetti, R., P. Parronchi, M. G. Giudizi, M. P. Piccinni, E. Maggi, G. Trinchieri, S. Romagnani. 1993. Natural killer cell stimulatory factor (interleukin 12 [IL-12]) induces T helper type 1 (Th1)-specific immune responses and inhibits the development of IL-4-producing Th cells. J. Exp. Med. 177:1199.[Abstract/Free Full Text]
  23. Nakamura, T., R. K. Lee, S. Y. Nam, E. R. Podack, K. Bottomly, R. A. Flavell. 1997. Roles of IL-4 and IFN-{gamma} in stabilizing the T helper cell type 1 and 2 phenotype. J. Immunol. 158:2648.[Abstract]
  24. Shuai, K., C. M. Horvath, L. H. Huang, S. A. Qureshi, D. Cowburn, J. E. Darnell, Jr. 1994. Interferon activation of the transcription factor Stat91 involves dimerization through SH2-phosphotyrosyl peptide interactions. Cell 76:821.[Medline]
  25. Krieg, A. M., T. Wu, R. Weeratna, S. M. Efler, L. Love, L. Yang, A. Yi, D. Short, H. L. Davis. 1998. Sequence motifs in adenoviral DNA block immune activation by stimulatory CpG motifs. Proc. Natl. Acad. Sci. USA 95:12631.[Abstract/Free Full Text]
  26. Yamada, H., I. Gursel, F. Takeshita, J. Conover, K. J. Ishii, M. Gursel, S. Takeshita, D. M. Klinman. 2002. Effect of suppressive DNA on CpG-induced immune activation. J. Immunol. 169:5590.[Abstract/Free Full Text]
  27. Chen, Y., P. Lenert, R. Weeratna, M. McCluskie, T. Wu, H. L. Davis, A. M. Krieg. 2001. Identification of methylated CpG motifs as inhibitors of the immune stimulatory CpG motifs. Gene Ther. 8:1024.[Medline]
  28. Lenert, P., L. Stunz, A. K. Yi, A. M. Krieg, R. F. Ashman. 2001. CpG stimulation of primary mouse B cells is blocked by inhibitory oligodeoxyribonucleotides at a site proximal to NF-{kappa}B activation. Antisense Nucleic Acid Drug Dev. 11:247.[Medline]
  29. Latz, E., A. Schoenemeyer, A. Visintin, K. A. Fitzgerald, B. G. Monks, C. F. Knetter, E. Lien, N. J. Nilsen, T. Espevik, D. T. Golenbock. 2004. TLR9 signals after translocating from the ER to CpG DNA in the lysosome. Nat. Immunol. 5:190.[Medline]
  30. Pisetsky, D.S., F. R. C. . 2000. Inhibition of murine macrophage IL-12 production by natural and synthetic DNA. Clin. Immunol. 96:198.[Medline]
  31. Zhu, F. G., C. F. Reich, D. S. Pisetsky. 2002. Inhibition of murine macrophage nitric oxide production by synthetic oligonucleotides. J. Leukocyte Biol. 71:686.[Abstract/Free Full Text]
  32. Zhu, F. G., C. F. Reich, D. S. Pisetsky. 2002. Inhibition of murine dendritic cell activation by synthetic phosphorothioate oligodeoxynucleotides. J. Leukocyte Biol. 72:1154.[Abstract/Free Full Text]
  33. Gursel, M., D. Verthelyi, I. Gursel, K. J. Ishii, D. M. Klinman. 2002. Differential and competitive activation of human immune cells by distinct classes of CpG oligodeoxynucleotides. J. Leukocyte Biol. 71:813.[Abstract/Free Full Text]
  34. Sano, K., H. Shirota, T. Terui, T. Hattori, G. Tamura. 2003. Oligodeoxynucleotides without CpG motifs work as adjuvant for the induction of Th2 differentiation in a sequence-independent manner. J. Immunol. 170:2367.[Abstract/Free Full Text]
  35. Halpern, M. D., D. S. Pisetsky. 1995. In vitro inhibition of murine IFN {gamma} production by phosphorothioate deoxyguanosine oligomers. Immunopharmacology 29:47.[Medline]
  36. Moldwin, R. L., D. W. Lancki, K. C. Herold, F. W. Fitch. 1986. An antigen receptor-driven, interleukin 2-independent pathway for proliferation of murine cytolytic T lymphocyte clones. J. Exp. Med. 163:1566.[Abstract/Free Full Text]
  37. Kobayashi, M., L. Fitz, M. Ryan, R. M. Hewick, S. C. Clark, S. Chan, R. Loudon, F. Sherman, B. Perussia, G. Trinchieri. 1989. Identification and purification of natural killer cell stimulatory factor (NKSF), a cytokine with multiple biologic effects on human lymphocytes. J. Exp. Med. 170:827.[Abstract/Free Full Text]
  38. Mullen, A. C., F. A. High, A. S. Hutchins, H. W. Lee, A. V. Villarino, D. M. Livingston, A. L. Kung, N. Cereb, T. P. Yao, S. Y. Yang, S. L. Reiner. 2001. Role of T-bet in commitment of TH1 cells before IL-12-dependent selection. Science 292:1907.[Abstract/Free Full Text]
  39. Szabo, S. J., S. T. Kim, G. L. Costa, X. Zhang, C. G. Fathman, L. H. Glimcher. 2000. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell 100:655.[Medline]
  40. Jacobson, N. G., S. J. Szabo, R. M. Weber-Nordt, Z. Zhong, R. D. Schreiber, J. E. Darnell, Jr, K. M. Murphy. 1995. Interleukin 12 signaling in T helper type 1 (Th1) cells involves tyrosine phosphorylation of signal transducer and activator of transcription (Stat)3 and Stat4. J. Exp. Med. 181:1755.[Abstract/Free Full Text]
  41. Jing, N., Y. Li, X. Xu, W. Sha, P. Li, L. Feng, D. J. Tweardy. 2003. Targeting Stat3 with G-quartet oligodeoxynucleotides in human cancer cells. DNA Cell Biol. 22:685.[Medline]
  42. Liblau, R. S., S. M. Singer, H. O. McDevitt. 1995. Th1 and Th2 CD4+ T cells in the pathogenesis of organ-specific autoimmune diseases. Immunol. Today 16:34.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
T. Sato, T. Shimosato, W. G. Alvord, and D. M. Klinman
Suppressive Oligodeoxynucleotides Inhibit Silica-Induced Pulmonary Inflammation
J. Immunol., June 1, 2008; 180(11): 7648 - 7654.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Shirota, L. Petrenko, C. Hong, and D. M. Klinman
Potential of Transfected Muscle Cells to Contribute to DNA Vaccine Immunogenicity
J. Immunol., July 1, 2007; 179(1): 329 - 336.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Yasuda, P. Yu, C. J. Kirschning, B. Schlatter, F. Schmitz, A. Heit, S. Bauer, H. Hochrein, and H. Wagner
Endosomal Translocation of Vertebrate DNA Activates Dendritic Cells via TLR9-Dependent and -Independent Pathways
J. Immunol., May 15, 2005; 174(10): 6129 - 6136.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
O. Duramad, K. L. Fearon, B. Chang, J. H. Chan, J. Gregorio, R. L. Coffman, and F. J. Barrat
Inhibitors of TLR-9 Act on Multiple Cell Subsets in Mouse and Man In Vitro and Prevent Death In Vivo from Systemic Inflammation
J. Immunol., May 1, 2005; 174(9): 5193 - 5200.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Shirota, I. Gursel, M. Gursel, and D. M. Klinman
Suppressive Oligodeoxynucleotides Protect Mice from Lethal Endotoxic Shock
J. Immunol., April 15, 2005; 174(8): 4579 - 4583.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shirota, H.
Right arrow Articles by Klinman, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shirota, H.
Right arrow Articles by Klinman, D. M.
Right arrowPubmed/NCBI databases
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS