|
|
||||||||


* Department of Immunology, Graduate School of Medicine, Chiba University, and
Department of Life and Environmental Sciences and High Technology Research Center, Chiba Institute of Technology, Chiba, Japan; and
Laboratory for Immune Regulation, RIKEN Research Center for Allergy and Immunology, Yokohama, Japan
| Abstract |
|---|
|
|
|---|
or IL-5 and IL-13, respectively. Little is known, however, about the molecular mechanisms that control NK1 and NK2 cell differentiation. To address these questions, we established an in vitro mouse NK1/NK2 cell differentiation culture system. For NK1/NK2 cell differentiation, initial stimulation with PMA and ionomycin was required. The in vitro differentiated NK2 cells produced IL-5 and IL-13, but the levels were 20 times lower than those of Th2 or T cytotoxic (Tc)2 cells. No detectable IL-4 was produced. Freshly prepared NK cells express IL-2R
, IL-2R
C, and IL-4R
. After stimulation with PMA and ionomycin, NK cells expressed IL-2R
. NK1 cells displayed higher cytotoxic activity against Yac-1 target cells. The levels of GATA3 protein in developing NK2 cells were approximately one-sixth of those in Th2 cells. Both NK1 and NK2 cells expressed large amounts of repressor of GATA, the levels of which were equivalent to CD8 Tc1 and Tc2 cells and significantly higher than those in Th2 cells. The levels of histone hyperacetylation of the IL-4 and IL-13 gene loci in NK2 cells were very low and equivalent to those in naive CD4 T cells. The production of IL-5 and IL-13 in NK2 cells was found to be STAT6 dependent. Thus, similar to Th2 cells, NK2 cell development is dependent on STAT6, and the low level expression of GATA3 and the high level expression of repressor of GATA may influence the unique type 2 cytokine production profiles of NK2 cells. | Introduction |
|---|
|
|
|---|
upon IL-2 stimulation and play crucial roles during infection and in anti-tumor immunity (1, 2). However, human NK cells are known to produce type 2 cytokines as well, particularly when cultured with certain cytokines (3, 4, 5, 6, 7). NK1/NK2 terminology has been proposed in analogy to Th1/Th2 subsets of CD4 T cells (4). The roles of NK2 cells in host defense immune responses remain undetermined; however, the unique cytokine production profile of NK2 cells suggests that these cells may play certain roles in specific immune responses, including the regulation of allergic or autoimmune diseases (8, 9, 10). The molecular requirements for the differentiation of functional type 1 and type 2 cytokine-producing Th1/Th2 cells have been extensively investigated. The IL-12-mediated activation of STAT4 is required for Th1 cell differentiation, and IL-4-mediated STAT6 activation is crucial for Th2 cell differentiation (11, 12, 13, 14). In addition to cytokine-mediated signals, activation of TCR-mediated signaling is also indispensable for both Th1 and Th2 cell differentiation (15, 16, 17). Master transcription factors for Th1 and Th2 cell differentiation have been revealed, i.e., GATA3 for Th2 and T-bet for Th1 (18, 19, 20, 21).
Changes in the chromatin structure of the Th2 cytokine (IL-4/IL-5/IL-13) gene loci occur during Th2 cell differentiation (22). Hyperacetylation of histones H3 and H4 by histone acetyl transferases has been suggested to be associated with active chromatin (23). Recently, we and others have reported that hyperacetylation of histone H3 and H4 tails of nucleosomes associated with the Th2 cytokine gene loci occurs in developing Th2 cells, but not in naive or developing Th1 cells (24, 25, 26).
In the present study we established an in vitro murine NK1/NK2 cell differentiation system and demonstrate molecular events that may govern the unique cytokine production of NK1/NK2 cells. NK1 cells produced substantial amounts of IFN-
with hyperacetylation of the IFN-
promoter locus. Interestingly, NK2 cells produced low levels of IL-5 and IL-13 and undetectable levels of IL-4. This unique profile appears to be due to the low level expression of GATA3 and the high level expression of repressor of GATA (ROG)3 in developing NK2 cells. Type 2 cytokine production in NK2 cells was found to be STAT6 dependent.
| Materials and Methods |
|---|
|
|
|---|
C57BL/6 mice were purchased from Charles River Laboratories (Tokyo, Japan). STAT6-deficient mice (27) were provided by Dr. S. Akira (Osaka University, Japan). RAG1-deficient mice were purchased from Jackson Laboratory (Bar Harbor, ME). All mice were maintained under specific pathogen-free conditions and used for experiments when
7 wk old. Animal care was in accordance with the guidelines of Chiba University.
Reagents
The reagents used in this study were as follows: Cy5-conjugated streptavidin was prepared in our laboratory. Anti-NK1.1-FITC (PK136-FITC), anti-CD4-FITC (RM4-5-FITC), anti-CD11b-FITC (M1/70-FITC), anti-CD44-FITC (1M7-FITC), anti-CD69-FITC (H1.2F3-FITC), anti-CD95-FITC (Jo2-FITC), anti-Ly49A-FITC (A-1-FITC), anti-Ly49D-FITC (4E5-FITC), anti-TCR
-PE (H57-597-PE), anti-CD4-PE (RM4-5-PE), anti-CD8
-PE (53-6.7-PE), anti-CD25-PE (7D4-PE), anti-CD122-PE (TM-
1-PE), anti-CD124-PE (mIL4R-M1-PE), anti-CD132-PE (4G3-PE), anti-CD11b-biotin (M1/70-biotin), anti-CD94-biotin (18d3-biotin), anti-CD119-biotin (GR20-biotin), anti-CD178-biotin (MFL4-biotin), anti-CD212-biotin (114-biotin), anti-NK1.1-allophycocyanin (PK136-allophycocyanin), anti-CD25-PE (7D4-PE), anti-CD122-PE (TM-
1-PE), anti-CD124-PE (mIL4R-M1-PE), and anti-CD132-PE (4G3-PE) were purchased from BD Pharmingen (La Jolla, CA). Streptavidin-FITC was purchased from Biomeda (Foster City, CA). Anti-FcR
III/II mAb (2.4G2), anti-IFN-
mAb (RA2.6A2), and anti-IL-4 mAb (11B11) were used as culture supernatants.
Immunofluorescent staining and flow cytometric analysis
In general, one million cells were preincubated with 2.4G2 to prevent nonspecific binding of mAb via FcR interactions, then incubated on ice for 30 min with the appropriate staining reagents according to a standard method previously described (28). Flow cytometric analysis was performed on a FACSCalibur (BD Biosciences, Mountain View, CA), and the results were analyzed with CellQuest software (BD Biosciences).
51Cr release cytotoxic assay
The cytotoxic activities of differentiated NK cells were assessed by a 4-h 51Cr release cytotoxic assay using the Yac-1 lymphoma cell line as previously described (29). The cells were harvested and seeded at the indicated E:T cell ratios. Specific lysis was calculated according to the following formula: % specific lysis = 100 x ([experimental cpm spontaneous cpm]/[maximum cpm spontaneous cpm]).
ELISA for the measurement of cytokine concentration
Differentiated NK cells (0.2 x 106) were stimulated with IL-2 (500 U/ml) or PMA (50 ng/ml) and ionomycin (500 nM) for 72 h in 200-µl cultures. The production of IL-4, IL-5, and IFN-
was measured by ELISA as previously described (30). The productions of IL-10 and IL-13 were measured using a mouse IL-10 BD OptEIA ELISA Kit (BD Biosciences) and mouse IL-13 ELISA kit (R&D Systems, Minneapolis, MN) respectively, according to the manufacturers protocols.
In vitro NK and T cell differentiation culture
NK cells (NK1.1+/TCR
cells) were isolated from spleens using magnetic beads and an AutoMACS sorter (Miltenyi Biotec, Auburn, CA), then sorted on a FACSVantage cell sorter (BD Biosciences), yielding a purity of >98%. Purified NK cells (2.0 x 106) were stimulated for 2 days with PMA (50 ng/ml) and ionomycin (500 nM) in the presence of IL-2 (250 U/ml) for neutral (NK0-skewed) conditions, IL-2 (250 U/ml) and IL-12 (500 U/ml) for NK1-skewed conditions, and IL-2 (250 U/ml), IL-4 (500 U/ml), and anti-IFN-
mAb (R4.6A2, 25% culture supernatant) for NK2-skewed conditions. The cells were then transferred to new dishes and cultured for another 57 days in the presence of only the cytokines present in the initial culture. IL-18 was purchased from eBioscience. IFN
and IFN
were purchased from PeproTech (Rocky Hill, NJ).
Culture conditions for Th1/Th2 and T cytotoxic (Tc)1/Tc2 differentiation were described previously (24, 30). In brief, CD4 T and CD8 T cells were purified using magnetic beads and an AutoMACS sorter (Miltenyi Biotec), yielding a purity of >98%. Enriched CD4 T and CD8 T cells (2.0 x 106) were stimulated for 2 days with 1 µg/ml immobilized anti-TCR mAb (H57-597) in the presence of IL-2 (25 U/ml), IL-12 (100 U/ml), and anti-IL-4 mAb (11B11, 25% culture supernatant) for type 1-skewed conditions and in the presence of IL-2 (25 U/ml) and IL-4 (100 U/ml) for type 2-skewed conditions. The cells were then transferred to new dishes and cultured for another 3 days in the presence of only the cytokines present in the initial culture.
Chromatin immunoprecipitation (ChIP) assay
ChIP was performed using a histone H3 ChIP assay kit (no. 17-245: Upstate Biotechnology, Lake Placid, NY). The primers used for PCR amplification were described previously (24). Images were quantified using an L&S analyzer (ATTO, Tokyo, Japan).
PCR
Total RNA was isolated using TRIzol reagent (Invitrogen Life Technologies, Gaithersburg, MD). RT was performed using Superscript II (Invitrogen Life Technologies-BRL). Three-fold serial dilutions of template cDNA were achieved as previously described (31). The primers used in the RT-PCR study were as follows:
-actin forward, GAGAG GGAAATCGTGCGTGA-3';
-actin reverse, 5'-ACATCTGCTGGAAGGTGGAC; GATA3 forward, GAAGGCATCCAGACCCGAAAC-3'; GATA3 reverse, 5'-ACCCATGGCGGTGACCATGC; ROG forward, CTCTCTGGAGTCAGAATC AGCTGG-3'; ROG reverse, 5'-AGCGCTGAGGACAGAGGCTACAGG; IL-12R
2 forward, ACATCCAATAAGCAGCCTACAGCC-3'; IL-12R
2 reverse, 5'-GGCCATGCCATCAGGAGATTATCC; granzyme B forward, GCCCACAACTGCTGGAAGAACAG-3'; granzyme B reverse, 5'-AACCAGC CACATAGCACACAT; perforin 1 forward, TGCTACACTGCCACTCGGTCA-3'; perforin 1 reverse, 5'-TTGGCTACCTTGGAGTGGGAG; GATA1 forward, CATTGGCCCCTTGTGAGGCCAGAGA-3'; GATA1 reverse, 5'-ACCTGATGG AGCTTGAAATAGAGGC; GATA2 forward, GCCTGTGGCCTCTACTACAA GCTG-3'; and GATA2 reverse, 5'-CCATGGCAGTCACCATGCTGGACG.
For real-time PCR, a TaqMan universal PCR master mix was used for all reactions (Applied Biosystems) and the ABI PRISM 7000 Sequence Detection System was used. The primers and TaqMan probes for the detection of T-bet and hypoxanthine phosphoribosyltransferase were purchased from Applied Biosystems. T-bet expression was normalized using the hypoxanthine phosphoribosyltransferase signal. Data are shown as relative intensity.
Retrovirus vectors and infection
The pMx-internal ribosome entry site (IRES)-GFP and the Plat-E packaging cell line were provided by Dr. T. Kitamura (University of Tokyo, Tokyo, Japan); pMx-IRES-GFP and pMx-GATA3-IRES-GFP and the methods for the generation of virus supernatants were described previously (30). The LFD-14 cell line (32) was provided by Dr. N. Minato (Kyoto University, Kyoto, Japan) and was maintained in the presence of IL-2 (100 U/ml). LFD14 cells were infected with pMx-GATA3-IRES-GFP, cultured for 2 days, and harvested, and the GFP-positive cells were isolated by sorting on a FACSVantage cell sorter (BD Biosciences). GFP-positive cells were cultured for another 2 days, then restimulated with IL-2 (500 U/ml) or PMA (50 ng/ml) plus ionomycin (500 nM) for 72 h in 200-µl cultures.
Immunoblot analysis
Nuclear extracts for the detection of GATA3 and ROG, and cytoplasmic extracts for tubulin-
were prepared using NE-PER Nuclear and Cytoplasmic Extraction Reagent (catalogue no. 78833; Pierce, Rockford, IL). Immunoblotting was performed with anti-GATA3 mouse mAb (HG3-31; Santa Cruz Biotechnology, Santa Cruz, CA), anti-tubulin-
mouse mAb (DM1A; Neo Markers, Fremont, CA) and anti-ROG rabbit antisera as described previously (30). Protein levels were visualized by ECL (Amersham Biosciences, Arlington Heights, IL) using HRP-conjugated anti-mouse Ig Ab (Amersham Biosciences).
| Results |
|---|
|
|
|---|
The aim of this study was to clarify the molecular events underlying NK1/NK2 cell differentiation. We first established an in vitro murine NK1/NK2 cell differentiation system without feeder cells. Purified splenic NK cells were stimulated with PMA plus ionomycin for 2 days under NK0-, NK1-, and NK2-skewed culture conditions, then the cells were transferred to new wells to culture for another 6 days with the cytokines present in the initial culture. The amounts of cytokines produced by in vitro differentiated NK0, NK1, and NK2 cells after IL-2 or PMA plus ionomycin restimulation were assessed by ELISA (Fig. 1A). We designated NK0 cells as NK cells cultured under non-type 1- or non-type 2-skewed conditions as described in Materials and Methods. As expected, the production of IL-5 and IL-13 was detected only in NK2 cells. No IL-4 production was detected. The amounts of IL-5 and IL-13 produced by NK2 cells were
20-fold less than those produced by Th2 cells (Fig. 1). Only NK1 cells produced IL-10 and IFN-
. The levels of IFN-
produced by NK1 cells were significantly lower than those produced by Th1 cells (Fig. 1). We performed cytoplasmic cytokine staining, but could not detect significant IL-5- or IL-13-producing populations in the NK2 cell population (data not shown). This is probably due to the low sensitivity of the system, but the result suggests that the limited amounts of IL-5 and IL-13 detected by ELISA are not produced by a small population secreting very high amounts of IL-13 and IL-5. Taken together, these results suggest that in vitro differentiated mouse NK1 and NK2 cells possess unique cytokine production profiles.
|
, and IFN-
on the production of IFN-
in NK cells
NK1 cells prepared as described in Fig. 1 were stimulated with PMA plus ionomycin, IL-18, IFN-
, IFN-
, or IL-12, and the amounts of IFN-
produced in the culture supernatant were measured by ELISA. As shown in Fig. 2A, IL-18 induced substantial amounts of IFN-
in NK1 cells. IL-12 induced levels of IFN-
production similar to those induced by PMA and ionomycin. The effects of IFN-
or IFN-
were less than those of IL-12. In addition, the effects of IL-18 in NK cell differentiation culture were assessed. NK cells were cultured in the presence of IL-2 (NK0 conditions), IL-2 plus IL-12 (NK1 conditions), or IL-2 plus IL-18 (50 ng/ml), then the cells were restimulated with IL-2 or PMA plus ionomycin. The addition of IL-12 enhanced the production of IFN-
, but no significant effect of IL-18 was observed (Fig. 2B).
|
To characterize the purified NK cells, we first assessed their cell surface expressions of IL-2R
, IL-2R
, common
-chain (
C), and IL-4R
(Fig. 3A). Considerable levels of IL-2R
,
C, and IL-4R
were expressed on freshly prepared NK cells, whereas IL-2R
was undetectable. In NK cells activated by stimulation with PMA plus ionomycin and IL-2 for 1 day, IL-2R
, IL-2R
,
C, and IL-4R
were all expressed (Fig. 3A). Next, the staining profiles of cytokine receptors in NK0, NK1, and NK2 cells were determined. As shown in Fig. 3B, all cytokine receptor components were expressed on NK0 and NK2 cells, whereas a significantly lower expression of IL-2R
and undetectable expression of
C were found in NK1 cells. Fig. 3C shows the staining profiles of various surface marker Ags. An activation marker, CD69, was expressed on every subset of NK cells. No significant Ly49A and Ly49D staining was observed in either subset of NK cells. CD94 was slightly expressed only on NK1 cells. The level of Mac-1 (CD11b) expression, which reportedly correlates with NK cell maturation, was high on freshly prepared NK cells (Fig. 3D). The expression was down-regulated during NK cell differentiation. No significant staining of Mac-1 was detected on NK1 cells.
|
The cytotoxic activity of differentiated NK cells was measured by a standard 4-h Cr release assay with Yac-1 target cells. As shown in Fig. 4, all NK cell subsets displayed significant levels of cytotoxic activity to Yac-1 cells. Among them, NK0 cells expressed the highest levels of cytotoxic activity, and NK2 cells showed the lowest cytotoxic activity. NK1 cells produced higher amounts of IFN-
, but the levels of cytotoxic activity were similar to those of fresh NK cells. In freshly prepared NK cells, only low level IFN-
production (
10 ng/ml; <1/10th of NK1) was detected upon stimulation with PMA plus ionomycin (data not shown). These results suggest no clear link between the production of IFN-
and cytotoxic activity.
|
2 in differentiated NK subsetsNext, to examine the genes that may regulate NK1/NK2 cell differentiation and cytokine production, we studied the mRNA expression of various transcription factors and a cytokine receptor in NK cells compared with that in Th1/Th2 (Fig. 5A) and Tc1/Tc2 cells (Fig. 5B). Bone marrow-derived mast cells were used as a control for GATA1 and GATA2. GATA3, a crucial factor for Th2 cell differentiation, was expressed at a significantly higher level in NK2 cells than in freshly prepared NK, NK0, or NK1 cells. The levels were equivalent to those in naive CD4, Th1, or Tc2 cells and were significantly lower than those in Th2 cells. Neither GATA1 nor GATA2 was expressed in these NK cells. ROG plays crucial roles in cytokine expression and chromatin remodeling in developing Tc2 cells (30). Interestingly, ROG was found to be highly expressed in NK0, NK1, and NK2 cells, with expression levels equivalent to those in Tc1 and Tc2 cells. Thus, the low level production of type 2 cytokines (IL-5 and IL-13) in NK2 cells appears to be due in part to the low level of GATA3 induction. In addition, the lack of detectable IL-4 production in NK2 cells may be due to both the low level induction of GATA3 and the high level expression of ROG. This is reminiscent of the unique type 2 cytokine production profiles of CD8 T cells (30).
|
2, perforin 1, and granzyme B in differentiated NK cells. Substantial levels of the mRNAs for granzyme B, perforin 1, and IL-12R
2 were detected in NK0, NK1, and NK2 cells, but not in freshly prepared NK cells. The expression levels of IL-12R
2 in NK1 cells were about half those in NK0 or NK2 cells (Fig. 5A). The protein expression levels of GATA3 and ROG were assessed by immunoblotting analysis in fresh NK, in vitro differentiated NK2, and Th2 cells using specific Abs (Fig. 5C). NK2 cells expressed significant amounts of GATA3, although the levels were much less than those in Th2 cells. Considerable levels of ROG protein were detected in NK2 cells, but not in fresh NK or Th2 cells.
Next, we performed real-time PCR analysis on T-bet expression in freshly prepared NK cells, NK0, NK1, and NK2 cells; naive CD4 T cells; Th1 and Th2 cells; naive CD8 T cells; and Tc1 and Tc2 cells (Fig. 5D). The level of T-bet transcription was highest in fresh NK cells. NK0, NK1, and NK2 cells expressed significant, but similar, levels of T-bet. The levels were higher than those of naive CD4 and CD8 cells or Th2 and Tc2 cells, but lower than those of Th1 or Tc1 cells. These results suggest that there is no correlation between the production of IFN-
or type 2 cytokines and the expression levels of T-bet transcription in NK0, NK1, and NK2 cells.
Acetylation status of the IFN-
and type 2 cytokine gene loci in differentiated NK cell subsets
Next, we investigated the acetylation status of histones associated with the IFN-
and type 2 cytokine gene loci. A ChIP assay using anti-histone H3 mAb was performed with titrated doses of DNA samples. Fig. 6A shows the real-time quantitative PCR bands derived from freshly prepared NK, NK1, and NK2 cells; freshly prepared naive CD4 and Th2 cells; and those of input DNA. The results of this analysis are presented as the relative intensity of each group normalized to the band intensity of the corresponding input DNA bands (Fig. 6B). The acetylation levels of the type 2 cytokine gene loci (IL-4 promoter, IL-13 promoter, IL-4 VA enhancer, conserved noncoding sequence 1, and conserved GATA response element) in NK2 cells were clearly lower than those in Th2 cells, and almost the same as those in naive CD4 T cells. As for the IL-5 locus, acetylation of histones was not fully induced (
2-fold) in Th2 cells on day 5, and the acetylation levels in NK cell subsets were equivalent to those in Th2 cells. The acetylation levels of the IFN-
promoter locus were higher in NK1 cells compared with those in NK2 cells or Th2 cells. The levels were approximately one-third those in Th1 cells (data not shown). Thus, the cytokine production profiles of NK1 and NK2 cells appear to reflect the acetylation status of histones associated with the IFN-
and type 2 cytokine gene loci.
|
To investigate the requirement of STAT6 for NK2 cell differentiation, we prepared NK cells from STAT6-deficient mice. The number of NK cells in the spleen and the expressions of NK cell surface markers, such as those shown in Fig. 3, were all equivalent to those of wild-type C57BL/6 NK cells (data not shown). As shown in Fig. 7A, the STAT6-deficient NK cells cultured under type 2-skewed conditions did not produce detectable levels of IL-5 or IL-13. The production of IFN-
was not decreased, but was slightly increased, in STAT6-deficient NK1 cells. These results suggest that NK2 cell differentiation is STAT6 dependent.
|
Finally, we studied whether the ectopic expression of GATA3 induces the production of type 2 cytokines in NK cells. Because the naive or activated splenic NK cells were resistant to retrovirus infection, we used the fetal liver-derived NK-like cell line LFD14. LFD14 cells were infected with a retrovirus encoding GATA3 bicistronically with enhanced GFP (EGFP). Two days after infection, enhanced GFP-positive cells were isolated, cultured for another 2 days, harvested, and restimulated with IL-2 or PMA plus ionomycin for 72 h. The production of type 2 cytokines (IL-4, IL-5, and IL-13) was measured by ELISA. As shown in Fig. 7B, IL-13 was detected in GATA3-transfected LFD14 cells after IL-2 stimulation, whereas no IL-4 and IL-5 were detected. Fig. 7C shows the increased expression of GATA3 in the GATA3-infected LFD14 cells, suggesting that the ectopic expression of GATA3 induces IL-13 production in NK-like LFD14 cells. As in the case of differentiated NK0, NK1, and NK2 cells, LFD14 cells expressed significant amounts of ROG protein.
| Discussion |
|---|
|
|
|---|
We established a mouse NK1/NK2 cell differentiation culture system in which NK cells were stimulated with PMA and ionomycin in the presence of IL-2. IL-12 and IL-4 were used for type 1- and type 2-skewed differentiation. No feeder cells were used in the culture. Stimulation with PMA and ionomycin at the initial phase of culture was indispensable for the induction of NK1/NK2 cells. Previous studies have shown that human NK cells differentiate into NK1 or NK2 cells after cultivation with gamma-irradiated feeder cells or NK-sensitive tumor cells in the presence of IL-2 or IL-15 (4, 5, 6). In these human systems, it is possible that the feeder cells or NK-sensitive tumor cells may substitute the activation of both Ca2+/calcineurin and the Ras-MAPK signaling pathway. In fact, it is known that the cross-linking of CD16 on NK cells induces the activation of calcineurin and subsequent NFAT activation (33) and activation of the ERK/MAPK cascade (34). In any event, the requirement for the activation of both Ca2+/calcineurin and the Ras-MAPK signaling pathway for NK1 and NK2 cell differentiation is reminiscent of the differentiation of Th cells. Ag-induced, TCR-mediated signaling in naive T cells is indispensable for the differentiation of Th1/Th2 cells. We have reported that efficient activation of calcineurin (17) and the Ras-MAPK signaling pathway (16) are crucial for Th2 cell differentiation. This interesting analogy may suggest that even in NK2 cells, the strength of the signaling events may influence the direction of differentiation toward NK1 and NK2 cells. Indeed, our preliminary results suggest that decreased doses of PMA plus ionomycin abrogate NK2 cell differentiation, but not NK1 cell differentiation (unpublished observations).
We and others (4) have observed that in vitro differentiated NK2 cells produce significant amounts of IL-13 and IL-5 even after resting in culture for 47 days. In addition, although the system is slightly different, NK1.1+CD3 NK cells differentiated from lineage-negative bone marrow cells by culture with feeder cells, IL-2, and IL-15 produced IL-5 and IL-13 (5). Thus, we think the IL-5- and IL-13-producing NK cells are not just a transient state induced by the constant present of IL-4 in the culture, but are a truly differentiated cell population with a self-sustainable phenotype.
The low level production of IL-5 and IL-13 and undetectable production of IL-4 in developing NK2 cells may be partly due to the low levels of GATA3 expression in NK cells. The expression levels of GATA3 in NK2 cells were less than those in Th2 cells. Other GATA family members, GATA1 and GATA2, were not expressed in these NK cell subsets (Fig. 5). Th2 cell differentiation is known to be highly dependent on the expression levels of GATA3 (18). In addition, GATA3 is important as a transcription factor for the type 2 cytokine genes, particularly for activation of the IL-13 and IL-5 genes (18, 35, 36). Thus, it is possible that the low level production of IL-5 and IL-13 is due to a defect at the transcriptional phase, but not at the differentiation phase. However, we detected impaired histone hyperacetylation of the type 2 cytokine gene loci (Fig. 6), suggesting that the limited GATA3 expression affects chromatin remodeling at the differentiation phase.
Another interesting finding in developing NK cells is the high level expression of ROG (Fig. 5). ROG was originally reported to be a repressor of GATA3-induced transactivation of the IL-4 and IL-5 promoters in the M12 B and EL-4 T cell lines by preventing GATA3 from binding to DNA (37). GATA3 is required for chromatin remodeling of the IL-4 and IL-13 gene loci (24) and the IL-5 gene locus (38). The levels of transcription of the IL-5 and IL-13 genes are highly dependent on GATA3. Thus, as for the limited production of three Th2 cytokines (IL-5, IL-13, and IL-4) in NK2 cells, their high level expression of ROG may contribute significantly by inhibiting GATA3 function very efficiently. Another possible mechanism responsible for undetectable production of IL-4 in NK2 cells is ROG-mediated inhibition of chromatin remodeling in the IL-4 gene locus. Recently, we reported that the expression of ROG is much higher in CD8 T cells than in CD4 T cells and provided evidence suggesting that the high level expression of ROG causes limited production of IL-4 in Tc2 cells (30). ROG may bind to the conserved ROG response element in IL-13 exon 4 and recruit histone deacetylase 1 and 2 at this element, resulting in the inhibition of histone hyperacetylation in the region downstream of the IL-13 gene, including the IL-4 locus (30). In NK2 cells, ROG was expressed at a high level, similar to that in Tc2 cells (Fig. 5). Thus, ROG-mediated inhibition of chromatin remodeling in the IL-4 gene locus may also contribute to undetectable production of IL-4 in NK2 cells.
We detected IL-10 production in NK1 cells, but not in NK0 or NK2 cells (Fig. 1), consistent with the results of previous reports (4, 39). The mechanism underlying the NK1-cell specific expression of IL-10 is not clear at this time; however, we know that both IL-2 and IL-12 are required for the acquisition of IL-10 production in NK cells (Fig. 1) (39). Thus, some transcriptional factors induced by IL-2R- and IL-12R-mediated signaling in NK cells should be responsible for the chromatin remodeling of the IL-10 gene locus and/or IL-10 gene transcription. Differentiated NK1 cells may have immunoregulatory functions in some aspects of immune responses by the production of IL-10.
Another important finding is that the production of IL-5 and IL-13 in NK2 cells is totally dependent on STAT6 expression (Fig. 7). As shown in Fig. 3, freshly prepared NK cells express significant amounts of IL-4R
and
C. In human NK cells, either IL-4 or IL-13 induced STAT6 phosphorylation and subsequent formation of C
-STAT6 DNA-protein complexes (40). Thus, similar to developing Th2 cells, STAT6/GATA3-induced molecular events appear to operate in developing NK2 cells and are crucial for their differentiation and IL-5 and IL-13 production.
In our in vitro differentiated NK1 cells, the IFN-
promoter locus was found to be hyperacetylated compared with that in fresh NK cells and NK2 cells. The levels were higher than those in naive CD4 T cells or Th2 cells (Fig. 6). These results are consistent with the abundant production of IFN-
in NK1 cells.
In established NK2 cells, IL-2 restimulation induced significant amounts of IL-5 and IL-13 (Fig. 1). This is not the case in established Th2 cells, for which TCR stimulation is required for the induction of type 2 cytokine production. These results suggest that the signaling pathways downstream of IL-2R are distinct in NK2 cells. This could also be true for the signaling pathways responsible for IFN-
production in NK1 cells (Fig. 1). In particular, IL-18 induced large amounts of IFN-
in NK1 cells (Fig. 2).
The cytotoxic activity against K562 cells has been reported to be similar for IFN-
-producing NK cells and nonproducing NK cells in human systems (6). We observed significant differences in cytotoxic activity among freshly prepared NK, NK0, NK1, and NK2 cells (Fig. 4). However, there appears to be no clear link between the production of IFN-
and the cytotoxic activity of NK cell populations. CD94 was expressed only on NK1 cells, and marginal expression of Ly49A and Ly49D was found on all subsets of NK cells (Fig. 3C). Thus, it is not certain at present that the difference in cytotoxicity among NK0, NK1, and NK2 cell subsets can be explained by the difference in expression of these NK receptor molecules. The mRNA expression of perforin 1 and granzyme B was equivalent among these NK cell subsets (Fig. 5).
The levels of IL-12R
2 expression in human NK1 cells are reported to be higher than those in NK2 cells (4). However, we detected a slightly decreased expression of IL-12R
2 in differentiated mouse NK1 cells (Fig. 5). After differentiation, the levels of IL-2R
and C
expression were slightly lower in NK1 cells compared with NK0 and NK2 cells, whereas the others were equivalent (Fig. 3). Thus, it is not clear whether the direction of NK cell differentiation is influenced by the expression levels of certain cytokine receptor components.
Recently, Loza and Perussia (41, 42) proposed a pathway for linear 2-0-1 lymphocyte development in NK cells based on experimental results in the human NK cell system. According to their hypothesis, type 2 cells develop into type 0 cells, and then develop further into type 1 cells. Type 1 and type 2 cells do not develop from common precursor naive or type 0 cells. This is an interesting hypothesis, but our results in a mouse system do not support the hypothesis. First, we detected no type 2 cytokine-producing cells in the freshly prepared mouse NK cells (Fig. 1). Secondly, NK2 cells producing IL-5 and IL-13 were generated only when the freshly prepared NK cells were stimulated with PMA plus ionomycin in the presence of IL-2 and IL-4 for 2 days after cultivation with IL-2 and IL-4. Without IL-4 (NK0 conditions), no IL-5- and IL-13-producing cells were generated, although the number of cells at the end of the culture was about twice that in NK2 cultures (T. Nakayama and T. Katsumoto, unpublished observations).
In summary, we established an in vitro mouse NK1/NK2 cell differentiation system and revealed possible molecular events that may control the chromatin remodeling and transcriptional activation of the type 2 cytokine gene loci in NK2 cells. Low level expression of GATA3 and high level expression of ROG may confer unique cytokine production profiles on NK2 cells. It is now of interest to study the physiological roles of NK2 cells possessing unique type 2 cytokine production profiles in murine models of infection and various immune disorders in vivo.
| Acknowledgments |
|---|
| Footnotes |
|---|
1 This work was supported by grants from the Ministry of Education, Culture, Sports, Science, and Technology of Japan (Grants-in-Aid for Scientific Research, Priority Areas Research 13218016 and 12051203; Scientific Research B 14370107, Advanced and Innovational Research Program in Life Science; and Special Coordination Funds); the Ministry of Health, Labor, and Welfare of Japan (a grant-in-aid for research on Advanced Medical Technology); the Program for Promotion of Fundamental Studies in Health Science of the Organization for Pharmaceutical Safety and Research of Japan; The Hamaguchi Foundation; and The Uehara Memorial Foundation. ![]()
2 Address correspondence and reprint requests to Dr. Toshinori Nakayama, Department of Immunology, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670, Japan. E-mail address: tnakayama{at}faculty.chiba-u.jp ![]()
3 Abbreviations used in this paper: ROG, repressor of GATA; C
, common
-chain; ChIP, chromatin immunoprecipitation; EGFP, enhanced GFP; IRES, internal ribosome entry site; Tc, T cytotoxic. ![]()
Received for publication December 18, 2003. Accepted for publication August 5, 2004.
| References |
|---|
|
|
|---|
) and type 2 (interleukin-13, interleukin-5) cytokines at distinct stages of natural killer cell differentiation from progenitor cells. Blood 99:1273.
-secreting and IFN-
-nonsecreting NK cells. Eur. J. Immunol. 32:879.[Medline]
. J. Immunol. 162:51.
loci accompany Th1/Th2 differentiation. J. Immunol. 169:647.
14 NKT cells by glycosylceramides. Science 278:1626.This article has been cited by other articles:
![]() |
M. R. Hepworth and R. K. Grencis Disruption of Th2 Immunity Results in a Gender-Specific Expansion of IL-13 Producing Accessory NK Cells during Helminth Infection J. Immunol., September 15, 2009; 183(6): 3906 - 3914. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Aranami, S. Miyake, and T. Yamamura Differential Expression of CD11c by Peripheral Blood NK Cells Reflects Temporal Activity of Multiple Sclerosis J. Immunol., October 15, 2006; 177(8): 5659 - 5667. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Gao, P. Schwartzberg, J. A. Wilder, B. R. Blazar, and D. Yuan B Cell Induction of IL-13 Expression in NK Cells: Role of CD244 and SLAM-Associated Protein. J. Immunol., March 1, 2006; 176(5): 2758 - 2764. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |