The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Salam, M. A.
Right arrow Articles by Senpuku, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Salam, M. A.
Right arrow Articles by Senpuku, H.
The Journal of Immunology, 2004, 173: 4908-4918.
Copyright © 2004 by The American Association of Immunologists

E2f1 Mutation Induces Early Onset of Diabetes and Sjögren’s Syndrome in Nonobese Diabetic Mice1

Mohammad Abdus Salam*, Khairul Matin{dagger}, Naoko Matsumoto*, Yuzo Tsuha*, Nobuhiro Hanada{ddagger} and Hidenobu Senpuku2,*

* Department of Bacteriology, National Institute of Infectious Diseases, Tokyo, Japan; {dagger} Center of Excellence Program for Frontier Research on Molecular Destruction and Reconstruction of Tooth and Bone, Department of Cariology and Operative Dentistry, Tokyo Medical and Dental University, Tokyo, Japan; and {ddagger} Department of Oral Health, National Institute of Public Health, Tokyo, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
E2f1 is an important regulator of T cell proliferation, differentiation, and apoptosis that controls the transcription of a group of genes that are normally regulated at the G1 to S phase transition in the cell cycle. Insulin-dependent diabetes mellitus (IDDM) and Sjögren’s syndrome (SS) are highly regulated autoimmune diseases that develop spontaneously in NOD mice. The aim of the present in vivo study was to explore the functional importance of the E2f1 molecule in IDDM and SS, in the context of whole animal physiology and pathophysiology, using E2f1-deficient NOD mice. For the experiment, we produced NOD mice homozygous for a nonfunctional E2f1 allele onto a NOD background. E2f1-deficient NOD mice developed an early and increased onset of diabetes as compared with their littermates. These mice also exhibited a defect in T lymphocyte development, leading to excessive numbers of mature T cells (CD4+ and CD8+), due to a maturation stage-specific defect in the apoptosis of thymocytes and peripheral T cells. We also found that they also exhibited a more rapid and increased entry into the S phase following antigenic stimulation of spleen cells and thymocytes in vitro. Furthermore, E2f1-deficient mice showed a profound decrease of immunoregulatory CD4+CD25+ T cells, while the spleen cells of NOD mice lacking E2f1 showed a significant increase of the proinflammatory cytokine IFN-{gamma} following antigenic stimulation in vitro. Consistent with these observations, E2f1 homozygous mutant NOD mice were highly predisposed to the development of IDDM and SS.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The nonobese diabetic mouse strain remains the best available model for the study of insulin-dependent type 1 diabetes mellitus (IDDM)3 (1, 2, 3). These mice develop a complex autoimmunity that is controlled by multiple genes, including those syntenic with genetic loci that control susceptibility in humans (2, 3, 4). IDDM and Sjögren’s syndrome (SS) are chronic multisystem and autoimmune disorders (5, 6, 7, 8) that spontaneously develop in NOD mice at 4–6 mo of age (9). The development of IDDM is characterized by the infiltration of T lymphocytes, dendritic cells, and monocytes into the islets of the pancreas, as well as the terminal destruction of {beta} cells (2, 5, 9, 10, 11, 12, 13). SS, on the other hand, is a systemic autoimmune disease characterized by hyposalivation, along with oral and occular dryness, and is accompanied by clinical observation of a progressive loss of salivary and lacrimal function that is related to the presence of perivascular and periductal T lymphocyte infiltration (14, 15, 16) as well as systemic production of autoantibodies to ribonucleoprotein (17). In recent reports, it has been clearly shown that both the CD4 and CD8 subsets of T cells play a crucial role in the development of IDDM in NOD mice (18, 19), which also develop lymphocytic inflammation in their salivary glands (sialoadenitis) and lacrimal glands (dacryoadenitis) (20, 21). These findings led to the notion that recruitment of a threshold frequency of autoreactive T cells into the pancreatic islets and salivary glands may be required for progression to the destruction of {beta} cell salivary gland tissue.

In autoimmune diabetes, the pathogenic T cells are a Th1 type that produce primarily the proinflammatory cytokine IFN-{gamma}, and Th2 cells appear to mediate protection against diabetes development via secretion of IL-4 and IL-10 (22, 23, 24, 25). Several studies have demonstrated that the autoimmune response in NOD mice is the result of a loss of immunoregulation, with a dominance of pathogenic Th1 cells over Th2 cells (23, 24, 25, 26). Various islet autoantigens, including glutamic acid decarboxylase 65, heat shock protein 60, and insulin, have been implicated in the initiation of diabetes, while Th1 responses to these autoantigens have been detected in NOD mice (27, 28, 29). In contrast, it has been reported that some NOD-derived CD4 T cell clones can induce IDDM when in either a Th1 or Th2 mode (30, 31) and, in a subsequent study, the other articles showed IFN-{gamma} signaling is dispensable for IDDM development in NOD mice (32, 33, 34). Therefore, the concept that skewing toward a Th1 vs a Th2 cytokine production profile, respectively, promotes or inhibits the diabetogenic potential of NOD T cells is now a crumbling dogma.

Members of the E2F transcription factor family (E2f1--E2f5) are important regulators of cell proliferation, differentiation, and apoptosis. The most characteristic member of the E2F family is E2f1 (34, 35, 36), which controls the initiation of DNA synthesis and subsequent transition of cells from the G0-G1 to S phase of the cell cycle (37, 38). The E2f1 molecule is activated through association with another transcription factor, DP1. Binding of the phosphorylated forms of the retinoblastoma (Rb) tumor suppressor protein (39) may inactivate the E2f1-DP1 complex. The decision by individual cells to proliferate, remain quiescent, or die is crucial to all organisms. Dysregulation of the normal functions involved with this decision can result in failure of important reparative, inflammatory, or other adaptive responses and can lead to aberrant proliferation characteristics of late-onset autoimmune diseases due to the deposition of T lymphocytes in different glands and salivary gland dysplasia by destruction of acinar cells (40, 41, 42, 43). Several recent studies demonstrated that a mutation of the E2f1 gene in mice causes enhanced T lymphocyte proliferation, leading to testicular atrophy, splenomegaly, salivary gland dysplasia, and other systemic and organ-specific autoimmunity (40, 41, 42, 43, 44, 45). However, it is uncertain whether the function of E2f1 has an influence in the development of IDDM and SS. To address this issue, we generated E2f1-deficient NOD mice. Furthermore, to test the critical function of the E2f1 molecule in the development of IDDM and SS in NOD mice in vivo, we inactivated the E2f1 locus by homologous recombination.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation of E2f1-deficient NOD mice

NOD/LtJ and E2f1–/– mice were originally purchased from The Jackson Laboratory (Bar Harbor, ME). They were housed in polypropylene mouse cages with pine chips and maintained in accordance with guidelines established by the National Institute of Infectious Diseases. The E2f1–/– allele was functionally disrupted by insertion of a neomycin-resistant gene (neoR) that had been backcrossed from the original chimeric stock and mixed with the 129/SV and C57BL/6 genome (42) onto the NOD inbred background. Heterozygous carriers of the E2f1–/– allele were used as breeders and each backcross generation was identified by typing DNA taken from the tail by PCR with the primers (5'-AGGATCTCGTCGTGACCCATGGCGA-3') and (5'-GAGCGGCGATACCGTAAAGCACGAGG-3'), which generated a 271-bp product from within the neoR insert. Each cycle of 35 amplification cycles were performed on a PTC-200 (MJ Research, Watertown, MA) and consisted of denaturation at 95°C for 5 min, primer annealing at 96°C for 1 min, and extension at 68°C for 5 min. Using a simple sequence length polymorphism (SSLP) analysis by PCR, segregants from the fourth backcross (N5) generation were genotyped for the microsatellite markers shown in Table I which were linked to the indicated Idd loci. In the N5 backcross generation, E2f1+/– heterozygotes, shown by these PCR analyses to be fixed as homozygous for the NOD allele at the indicated linkage markers of Idd susceptibility loci, were intercrossed to generate E2f1–/–, E2f1+/–, and E2f1+/+ NOD mice. A separate genomic PCR assay to detect the wild-type allele (392 bp) or mutant E2f1 allele (271 bp) was designed using an L31 intron primer (5'-GCTGGAATGGTGTCAGCACAGCG-3') and the E2f1 wild-type exon L26 primer (5'-TCCAAGAATCATATCCAGTGGCT-3') (42) or the neoR gene primer. E2F-1 was also genotyped using GGATATGATTCTTGGACTTCTTGG (E2F-1–5') and CTAAATCTGACCACCAAACGC (E2F-1–3') primers (46). PCR (25 µl) were amplified using a PTC-200 (MJ Research) for 39 cycles (94°C, 1 min; 58°C, 1 min; 72°C, I min) and 1 cycle (72°C, 7 min), and then were analyzed on a 3% agarose gel by electrophoresis.


View this table:
[in this window]
[in a new window]
 
Table I. Linkage markers analyzed to fix NOD-derived Idd loci to homozygosity in NOD. E2f1–/– congenic micea

 
Assessment of diabetes

E2f1–/–, E2f1+/–, and E2f1+/+ NOD mice were monitored weekly for clinical onset of diabetes which was determined by the presence of glucose in the urine and blood. Urine was tested with Ames reagent strips (Uristix; Bayer Medical, Newbury, U.K.) and confirmed positive by blood glucose measurements. All positive animals eventually displayed weight loss that progressed to death unless killed earlier.

Collection of saliva

At 25–30 wk old, NOD/LtJ, E2f1–/–, N5 (NOD.E2f1–/–), and (NOD x B10.D2)F1 mice were injected with a mixture of isoproterenol (0.20 µg/100 g body weight) and pilocarpine (0.05 µg/100 g body weight; Sigma-Aldrich, St. Louis, MO) in PBS as a secretagogue under anesthesia. Subsequently, saliva was collected from the mouth into 1.5-ml microfuge tubes using a micropipette for 15 min. Total volume and weight were measured and calculated per body weight, and the samples were then stored at –80°C for further analyses.

Histological examination

Nondiabetic mutant and wild-type E2f1 allele NOD mice were killed at 12–16 wk of age after blood serum had been collected. The pancreas and submandibular salivary glands were snap-frozen in OCT compound, cut into 6-µm serial sections (Microm, Zeiss, Germany), and stained with H&E for histological observation of mononuclear cell infiltration. Histological observations and photomicrography were performed using an Olympus BX50WI microscope (Olympus, Tokyo, Japan).

T cell stimulation assay and cytokine detection

Spleen cells, depleted of RBC, were cultivated at 1 x 106/ml in a 24-well plate in culture medium (RPMI 1640 supplemented with glutaMAX, 10% FBS, antibiotics, 10 mM HEPES, and 5 x 10–5 M 2-ME) in the presence of soluble anti-CD3 Ab (145-2C11) at 1 µg/ml for 3 days. After washing, the cells were rested in culture medium without stimulation for 2 days at 37°C. Dead cells were removed using a Ficoll-Hypaque gradient and replated at 0.5 x 106 cells/ml in culture medium in a 24-well plate previously coated with anti-CD3 Ab at 1 µg/ml in PBS (1). After 48 h of restimulation, the culture supernatant was removed and analyzed for the cytokines IFN-{gamma} and IL-4 by ELISA using commercial kits from Endogen (Cambridge, MA).

Cell cycle analysis

Thymus cells and spleen cells from 6-wk-old wild-type and mutant E2f1 allele NOD mice were separately primed in vitro and cultivated at 1 x 106/ml in 24-well plates in culture medium (RPMI 1640 supplemented with glutaMAX, 10% FBS, antibiotics, 10 mM HEPES, and 5 x 10–5 M 2-ME) in the presence of soluble anti-CD3 Ab at 1 µg/ml for 4 h. During the final 45 min of culture, the cells were labeled with 10 µM BrdU. The cell cycle positions and active DNA synthetic activities of the cells were determined by analyzing the correlated expression of total DNA and incorporated BrdU levels. BrdU-incorporated cells were stained with FITC anti-BrdU Ab and the total DNA content was stained with 7-aminoactinomycin D using a BrdU Flow kit (BD Pharmingen, San Diego, CA), after which they were analyzed with FACScan CellQuest software (BD Biosciences, San Jose, CA).

Abs and chemicals

The following mAbs were purchased from BD Pharmingen: FITC-conjugated anti-mouse anti-CD4 (H129.19), anti-CD8a (53-6.7), anti-CD25 (7D4), anti-CD45 (30-F11); PE-conjugated anti-mouse anti-CD8a (53-6.7), anti-CD45 (30-F11), anti IFN-{gamma}, allophycocyanin-conjugated anti-IL-4 PerCP-conjugated CD4 (Rm4-5), and nonconjugated anti-CD3e (145-2C11). BrdU flow kits were also purchased from BD Pharmingen. Alkaline phosphatase-conjugated goat anti-mouse IgG and IgM were purchased from Zymed Laboratories (San Francisco, CA). Culture medium RPMI 1640 (Sigma-Aldrich), HBSS (Invitrogen Life Technologies, Grand Island, NY), and FBS (ICN, Aurora, OH) were also purchased.

Flow cytometry analyses of T cells

Single-cell suspensions from thymus, spleen, and cervical lymph node specimens from 6-wk-old wild-type and mutant E2f1 allele NOD mice were obtained by teasing the tissues and forcing the resultant suspension through sterile nylon mesh. Cell numbers were determined using a hemacytometer and trypan blue exclusion to determine cell viability (>95% viable). For the measurement of CD4+CD8+, CD4+CD8, CD4CD8+, CD4+CD25+, and CD8+CD25+ T cell, 106 cells were incubated with FITC-conjugated anti-CD4, PerCP-conjugated anti-CD4, and PE-conjugated anti-CD8 Abs, respectively, followed by PE- and FITC-conjugated anti-CD8 and anti-CD25 Abs, respectively. Fc block (BD Pharmingen) was used to prevent nonspecific binding. Three-color immunofluorescence analyses were performed for the detection of intracellular productions of IFN-{gamma} and IL-4 by CD4+ and CD8+ T cells after 4 h of culture in the presence of leukocyte activation kits (BD Pharmingen). Cells were analyzed using a FACScan flow cytometer and the CellQuest program. Samples were gated on the forward light scatter and side light scatter and were used to identify viable lymphocytes and their ratios.

Adoptive type 1 diabetes transfer experiments

Spleen cells of 13 NOD.E2f1+/+ and 13 NOD.E2f1–/– female mice from 5- to 10-wk-old were isolated in RPMI 1640 medium supplemented with 10% FBS. RBC were depleted by a lysis with ACK buffer (0.155 M ammonium chloride, 0.1 M disodium EDTA, and 0.01 M potassium bicarbonate, pH 7.2). After washing, counting of the total cell numbers, and viability evaluation, splenocytes (5 x 107) were i.p. injected into 26 eight- to 10-wk-old NOD/SCID female mice, respectively. Beginning 1–2 wk after adoptive cell transfer, the recipient animals (NOD/SCID) were monitored twice a week for clinical onset of diabetes that was determined by the presence of glucose in the urine and blood. Urine was tested with Ames reagent strips and confirmed positive by blood glucose measurements. The recipient animals were killed at the time they became diabetic and the pancreas and salivary glands were subjected for histological analyses.

Statistical analysis

A Kaplan-Meier cumulative survival test was used to compare the incidences of diabetes. Comparative analyses were performed by ANOVA. A p < 0.05 was considered to be statistically significant for two-tailed comparisons. All statistical analyses were performed using StatView for the Macintosh operating system.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Establishment of the NOD.E2f1–/– mouse strain

Heterozygous carriers of the E2f1–/– allele from the backcross generation and all progeny of the N5 intercross generation were typed by PCR for the microsatellite markers shown in Table I, which were closely linked to the indicated Idd loci. The SSLP analyses identified mice homozygous for allelic variants characteristic of NOD mice at all of the Idd1–Idd15 linkage markers (Table I). Typing of these markers confirmed the homozygous presence of the NOD-derived genome at all identified Idd loci in the N5 progenitors used for the intercross (Table I). Genotyping by genomic PCR demonstrated that E2f1 mutant-type (NOD.E2f1–/–), heterozygous (NOD.E2f1+/–), and wild-type (NOD.E2f1+/+) animals were produced at the expected ratio of 1:2:1 (Table II). Homozygous E2f1–/– mice of the fifth (N5) backcross intercross generation were used to establish the NOD.E2f1–/– mouse strain, which was maintained by brother-sister mating. To discuss the potential for the autoimmune effects to be linked in NOD mice to allelic E2F-1 polymorphism, the original mouse strains (C57BL/6 and 129sv) to the knockout mouse were compared with NOD mice by SSLP analysis. As a result, there were no differences in the E2F-1 polymorphisms between NOD and the original strains.


View this table:
[in this window]
[in a new window]
 
Table II. Frequency of homozygosity in N5 intercross generation micea

 
Early and increased incidence of diabetes in E2f1-deficient NOD mice

E2f1–/– mice were bred onto a NOD background and diabetes was assessed by weekly measurement of urinary glucose or blood glucose concentration. The incidence of diabetes was ~88% in female N5 mutant (NOD.E2f1–/–) (Fig. 1a) and 58% in male N5 mutant (NOD.E2f1–/–) mice (Fig. 1b), while 71% of the N5 wild-type (NOD.E2f1+/+) females and 25% of the N5 wild-type (NOD.E2f1+/+) males became diabetic by 32 wk of age (Fig. 1, p < 0.05 and p < 0.001, respectively). Disease onset was earlier and more severe in mutant NOD.E2f1–/– mice as compared with their wild-type littermates (Fig. 1). The incidence of diabetes in both heterozygote male and female N5 (NOD.E2f1–/+) mice was not significantly different as compared with the N5 wild-type (NOD.E2f1+/+) control mice (Fig. 1).



View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 1. Increased incidence and early onset of diabetes in E2f1-deficient NOD mice. Urine and blood glucose levels were checked weekly in N5 generation E2f1 homozygous mutant NOD.E2f1–/–, heterozygous NOD.E2f1–[supi]/+, and wild-type NOD.E2f1+/+ female (a) and male (b) mice. N5 mice in each genotype class were fixed to homozygosity for linkage markers delineating all known NOD Idd loci. Both the cumulative incidence and time of onset of type 1 diabetes at 8 mo of age in females (a) and males (b) were significantly different between mutant (NOD.E2f1–/–) and wild-type littermates (*, p < 0. 05 and **, = p < 0.001, respectively, ANOVA Kaplan-Meier analysis).

 
Low salivary flow rate in E2f1-deficient NOD mice

Salivary analyses of different mouse strains showed that the total amount of secreted saliva was significantly lower in both NOD and E2f1–/– as compared with the standard (NOD x B10.D2) F1 mice after stimulation by the secretagogue (Fig. 2). Our salivary analyses showed that the total amount of secreted saliva after stimulation by the secretagogue was significantly lower in N5 mutant (NOD.E2f-1–/–) mice (380.0 ± 24.5 µg/100 g body weight) as compared with the standard NOD (620.0 ± 45.6 µg/100 g body weight, p < 0.01) and F1 (750.0 ± 21.5 µg/100 g body weight, p < 0.001) mice (Fig. 2).



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 2. Salivary flow rate in E2f1-deficient NOD mice and wild-type mice. Saliva was collected from NOD (n = 15), (NOD x B10.D2)F1 (n = 12), E2f1–/– (n = 12), and N5 NOD.E2f-1–/– (n = 15) mice at 4 mo of age. The total amount of secreted saliva per 100 g body weight was significantly lower in E2f1–/– and N5 NOD.E2f1–/– mice as compared with the standard NOD and (NOD x B10.D2)F1 mice (*, p < 0.01 and **, p < 0.001, respectively).

 
Histological abnormalities of exocrine glands in E2f1-deficient NOD mice

Histological examinations of submandibular salivary gland and pancreas specimens from 12- to 16-wk-old E2f1-deficient N5 mutant prediabetic NOD mice revealed that large numbers of mononuclear inflammatory cells had infiltrated the salivary glands and pancreas islets with some evidence of acinar cell degeneration (Fig. 3, a and c). Abnormally large nuclei or nuclei doubled in number were observed in pancreas islets of N5 (NOD.E2f1–/–) mice (Fig. 3a). This morphology represents a more severe destructive cellular infiltration of the tissue and suggests that the E2f1 molecule may help to maintain a normal nuclear structure and possible DNA content within these organ tissues (40, 42). The histological examinations also revealed that severe insulitis in the mutant NOD.E2f1–/– group (grade 0, 20.9 ± 7.9%; grade 1, 14.8 ± 5.9%; grade 2, 16.1 ± 7.6%; grade 3, 20.9 ± 4.5%; and grade 4, 27.0 ± 5.7%) as compared with the wild NOD.E2f1+/+ group (grade 0, 26.3 ± 4.5%; grade 1, 28.3 ± 6.4%; grade 2, 16.9 ± 0.6%; grade 3, 10.1 ± 2.5%; and grade 4, 16.5 ± 2.21%; Fig. 4). In particular, there were larger differences in grade 3 and grade 4 insulitis between these two groups. Furthermore, we analyzed whether the splenocytes of young E2f1-deficient NOD and standard NOD mice can induce lymphocytic infiltration in salivary glands and pancreas and development of diabetes by spleen T cells of NOD.E2f1–/– mice transferred into NOD.SCID mice with differing efficiencies. As expected, the majority (75%) of recipients injected with splenocytes from both E2f1-deficient NOD and NOD mice became diabetic by 10 wk after transfer (data not shown). There was no significant difference in the onset of diabetes between the recipients.



View larger version (151K):
[in this window]
[in a new window]
 
FIGURE 3. E2f1-deficient NOD mice exocrine gland histology. Histological staining (H&E) showing that massive mononuclear cell infiltration in pancreas islets in E2f1-deficient NOD mice (Fig. 4a) and wild-type NOD.E2f1+/+ mice (Fig. 4b) at 12–16 wk of age. Arrows, nuclei. Extensive lymphatic infiltration in the submandibular glands of both N5 mutant NOD.E2f1–/– mice (Fig. 4c) and wild-type NOD.E2f1+/+ mice (Fig. 4d) at 12–16 wk of age. There were greater levels of aggressive lymphatic infiltration and acinar cell degeneration in the exocrine glands of NOD.E2f1–/– mice than in their wild-type littermates (NOD.E2f1+/+). Original magnification, x200. –/– = NOD.E2f1–/– and +/+ = NOD.E2f1+/+.

 


View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 4. Analyses of insulitis in NOD.E2f1–/– and NOD.E2f1+/+ group mice at 12–16 wk of age. The degree of mononuclear cell infiltration was graded as follows: grade 0, no infiltrating cells in the islets; grade 1, infiltrating cells adjacent to the islets but not in the islets; grade 2, infiltrating cells occupying <25–50% of the islets’ area; grade 3, infiltrating cells occupying 25–50% of the islets’ area; grade 4, infiltrating cells occupying >50% of the islets’ area. The assessment of insulitis was performed using H&E-stained pancreas sections. Results are expressed as the mean ± SD of the insulitis counts for six independent mice selected randomly. The asterisk denotes significantly different insulitis counts between two groups (p < 0.001).

 
Thymus, thymocyte, and peripheral T cell abnormalities in NOD.E2f1–/– mice

The E2f1 molecule was found to play an important role in normal thymic development. The thymi of 5-wk-old N5 mutant-type NOD.E2f1–/– mice were noticeably enlarged compared with those of N5 wild-type littermates (NOD.E2f1+/+), and thymus weight per 100 g body weight in E2f1-deficient NOD mice was also increased (26.2 ± 2.3) compared with their littermates (18.7 ± 0.9; Fig. 5a, p < 0.001). This increased thymus size reflected a consistent increase in thymic cellularity, demonstrated by an ~55% increase in the number of thymocytes per thymus (Fig. 5b, p < 0.001). Several mechanisms might explain the increased number of thymocytes. To investigate the mechanisms of thymus and thymocyte abnormalities, the developmental profiles of thymocytes from N5 (NOD.E2f1–/–) mice and N5 wild-type (NOD.E2f1+/+) mice were compared. By monitoring the expression of CD4 and CD8 cell surface markers, the extent of thymocyte maturation was assessed. As thymocytes mature, they progress sequentially through double-negative (CD4CD8), double-positive (CD4+CD8+), and single-positive (CD4+CD8 or CD4/D8+) stages. Upon staining with anti-CD4 and anti-CD8 Abs, thymi of 5-wk-old N5 (NOD.E2f1–/–) mice were consistently found to contain a higher fraction of mature thymocytes (CD4+ or CD8+) than their N5 wild-type (NOD.E2f1+/+) littermates (Fig. 6, d–f, p < 0.01). Furthermore, the total number of thymocytes per thymus as well as the absolute number of cells in all thymocyte populations were increased in N5 (NOD.E2f1–/–) mice (Figs. 5b and 6j). There were also significantly low numbers of double-positive (CD4+CD8+) thymocytes in N5 (NOD.E2f1–/–) mice (72.9 ± 2.9%) as compared with the wild-type NOD.E2f1+/+ mice (79.0 ± 1.6%; Fig. 6, d and e, p < 0.01). Finding from flow cytometric analyses of spleen and lymph node T cells revealed that the percentages of mature T cells (CD4+ and CD8+) were significantly increased in N5 (NOD.E2f1–/–) mice than in wild-type N5 (NOD.E2f1+/+) mice (Fig. 6, a–c, g, h, and i, p < 0.01), and the absolute number of spleen T cells (CD4+ and CD8+) was also significantly increased in mutant NOD.E2f1–/– mice as compared with wild-type NOD.E2f1+/+ mice (Fig. 6k). These results indicated that E2f1-deficient NOD mice also have an increased number of mature peripheral T cells. Increased cell numbers in the peripheral tissues may be due to increased proliferation, decreased cell death as well as or in place of alteration of cell migration from the thymus in E2f1-deficient NOD mice.



View larger version (10K):
[in this window]
[in a new window]
 
FIGURE 5. Thymus and thymocyte abnormalities in E2f1-deficient NOD mice. a, Thymus weights from 5-wk-old mutant and wild-type mice are expressed as the fraction of total body weight. The increase in thymus size of the thymi in mutant (NOD.E2f1–/–) mice as compared with wild-type was statistically significant. Data are expressed as mean ± SD of 20 mice per genotype (*, p < 0.001). b, The numbers of thymocytes harvested from the thymi of 5-wk-old mutant and wild-type mice are shown. The number of thymocytes in mutant mice was increased ~55% as compared with their wild-type littermates. The effect of genotype on the number of thymocytes per thymus was statistically significant. Data are expressed as the mean ± SD of 15 mice per genotype (*, p < 0.001).

 


View larger version (53K):
[in this window]
[in a new window]
 
FIGURE 6. T cell abnormalities in E2f1-deficient NOD mice. Lymphocytes were harvested from the spleen (a and b), thymus (d and e), and lymph nodes (g and h) of 5-wk-old female littermates of the indicated genotypes, then stained with fluorescent-conjugated Abs to CD4 or CD8 and analyzed by flow cytometry. The percentage of cells positive for the expression of CD4 or CD8 is shown, which represents the mean ± SD of six experiments for each panel using sex-matched littermates. The differences in percentages of CD4+ or CD8+ singly positive T cells in the spleen (a–c), thymus (d–f), and lymph nodes (g–i) were significant when comparing NOD.E2f1–/– mice to their wild-type littermates. The percentage of CD4+CD8+ double-positive immature thymocytes was significantly lower in mutant mice (d) than in their wild-type littermate (e). j, Calculations of the absolute number of thymocytes in each subpopulation were performed based on the percentages measured in f and the total number of cells per thymus in Fig. 5b. NOD.E2f1–/– mice had a larger selective increase in the absolute number of CD4/CD8 single-positive thymocytes as compared with their wild-type littermates. Data are expressed as the mean ± SD of 15 mice per genotype. k, Calculations of the absolute number of spleen lymphocytes in each subpopulation based on the percentages measured in a and b and the total number of cells per spleen for each mouse. NOD.E2f1–/– mice had a larger selective increase in absolute number of CD8 single-positive lymphocytes compared with their wild-type littermates and a marginal increase in CD4-positive T cells. Data are expressed as the mean ± SD of 15 mice per genotype (*, p < 0.01 and **, p < 0.01).

 
Increased entry into S phase of cell cycle in E2f1-deficient NOD mice

Thymocyte and spleen cell proliferation in vitro in response to stimulation with mitogens was found to be distinguishable when cells isolated from 5-wk-old mutant (NOD.E2f1–/–) and wild-type (NOD.E2f1+/+) mice were compared (Fig. 7). Flow cytometric analyses of the cell cycle positions and active DNA synthetic activities of the cells revealed that the fractions of cells in the S phase in the thymus and spleen of N5 (NOD.E2f1–/–) mice were significantly increased (29.1 ± 3.6 and 11.5 ± 2.3, respectively) as compared with those in the wild-type N5 (NOD.E2f1+/+) mice (19.1 ± 4.9 and 4.1 ± 1.6, respectively; Fig. 7, b and d, p < 0.05 and p < 0.005, respectively), whereas cells in the G0-G1 phase in the thymus and spleen of N5 mutant (NOD.E2f1–/–) mice were significantly decreased (60.8 ± 6.4 and 77.9 ± 6.0, respectively) as compared with those in the wild-type N5 (NOD.E2f1+/+) mice (72.7 ± 6.8 and 91.2 ± 3.3, respectively; Fig. 7, b and d, p < 0.05 and p < 0.005, respectively). Furthermore, significant differences in cells in the G2 + M phase in the spleen were seen between the mutant-type NOD.E2f1–/– mice and wild-type NOD.E2f1+/+ mice (Fig. 7d, p < 0.05); however, there were no significant differences in the thymus between these two groups (Fig. 7b, p = 0.19).



View larger version (46K):
[in this window]
[in a new window]
 
FIGURE 7. Increase of S phase entry in E2f1-deficient NOD mice. Significant differences in cell cycle entry between mutant NOD.E2f1–/– and wild-type NOD.E2f1+/+ mice were observed in the spleen (a and b) and thymus (c and d). Thymocytes and splenocytes were stimulated with anti-mouse CD3 mAb as described in Materials and Methods. Cell cycle analysis was performed using BrdU and 7-aminoactinomycin D flow kits as described Materials and Methods. R2 indicates S phase, R3 indicates G2 + M phase, and R4 indicates G0-G1 phase. Data are expressed as the mean ± SD of four independent experiments, with 16 animals in each group. Asterisks indicate statistically significant between each genotype (*, p < 0. 05 and **, p < 0. 005).

 
CD4+CD25+ T cell subset reduced in number in E2f1-deficient NOD mice

Results of flow cytometric analyses of the CD4+CD25+ T cell subset revealed that a significant decrease of these cells in the spleen was observed in the 5-wk-old E2f1-deficient NOD mice compared with that in the 5-wk-old wild-type NOD.E2f1+/+ mice (Fig. 8, a and b, p < 0.01). Furthermore, the total number of the immunoregulatory CD4+CD25+ T cells in spleen were also decreased significantly in NOD.E2f1–/–(28.3 x 105 cells/mouse) mice as compared with the wild-type NOD.E2f1+/+ (62.4 x 105 cells/mouse) mice (p = 0.007, data not shown in figure). There was no significant difference in CD4+ CD25+ T cells in the lymph nodes and thymus between these two groups of mice, although a slightly lower number of this subset was found in the mutant NOD.E2f1–/– mice as compared with the wild-type NOD.E2f1+/+ mice (Fig. 8, c–f). These results reflect that E2f1-deficient NOD mice are more susceptible to IDDM and SS than wild-type NOD.E2f1+/+ mice.



View larger version (41K):
[in this window]
[in a new window]
 
FIGURE 8. Expression of CD4+CD25+ T cells in mutant NOD.E2f1–/– and wild-type NOD.E2f1+/+ mice. Single-cell suspension were isolated from the spleen, thymus, and lymph nodes of 5-wk-old female mice of both genotypes and stained with anti-CD4 and anti-CD25 mAbs, before being analyzed, using a flow cytometer. Comparable percentages and differences were observed in spleen cells (a and b) and small differences were observed in the thymus (c and d) and lymph nodes (e and f). Data are expressed as the mean ± SD of four independent experiments, with 18 animals in each group (*, p < 0.01).

 
Th1 and Th2 cytokines increased in E2f1-deficient NOD mice

The roles of cytokines in autoimmune diabetes and SS have been extensively studied in NOD mice. Some cytokines, such as IFN-{gamma}, are pathogenic, whereas others, like IL-4, are able to block the development of autoimmune diseases such as IDDM and SS. Spleen cells from E2f1-deficient NOD mice were stimulated with anti-CD3 mAb, and the supernatants were harvested to determine the levels of IL-4 and IFN-{gamma} production. The production of IFN-{gamma} by spleen T cells in 5-wk-old E2f1-deficient NOD mice was significantly increased (840.0 ± 216.7) as compared with the wild-type NOD.E2f1+/+ mice (443 ± 22.8; Fig. 9, p < 0.005). Furthermore, Th2 cytokine IL-4 production by spleen T cells in the mutant NOD.E2f1–/– mice was slightly increased (117.0 ± 18.2) as compared with the wild-type NOD.E2f1+/+ mice 98.0 ± 34.0); however, the difference was not significant (Fig. 9, p = 0.38).



View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 9. Th1 and Th2 cell responses in mutant NOD.E2f1–/– and wild-type NOD.E2f1+/+ mice. Splenocytes from littermates of mutant NOD.E2f1–/– and wild-type NOD.E2f1+/+ mice were separately stimulated in vitro with anti-CD3 mAb, and the cytokines released into the medium were evaluated using ELISA kits to determine the concentrations of IFN-{gamma} and IL-4. Data are expressed as the mean ± SD of three independent experiments, with 12 animals in each group. Asterisks indicate significant differences between each genotype (*, p < 0.005).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To investigate the functional role of the E2f1 molecule in IDDM and SS in NOD mice, we generated an E2f1-deficient NOD mouse (NOD.E2f1–/–) strain. Several studies have demonstrated that E2f1-deficient animals develop late-onset autoimmune features and are characterized by widespread inflammatory infiltrates, exocrine gland dysplasia, glomerular immunocomplex deposition, and hyperplastic thymic and peripheral T lymphocyte proliferation (40, 41, 43, 45, 46, 47). In the present study, our analyses of SSLP by PCR using microsatellite markers and neoR gene primers demonstrated that E2f1 homozygous mutant, heterozygous, and wild-type mice were produced at the expected ratio of 1:2:1 (Table II) (2, 41, 42). The E2f-1 polymorphism was not found in the autoimmune strain (NOD) and nonautoimmune strains (C57BL/6 and 129sv). The SSLP analysis using the D2Mit286 marker as the Idd13 on chromosome 2 that is close to the E2F-1 gene did not show the polymorphism in NOD, NOD.E2f1–/–, E2f1–/–, 129sv, and C57BL/6 mice in our experiments. Our results also showed that the E2f1 mutation in NOD mice caused early and increased incidences of IDDM and SS (Fig. 1).

At 5 wk old, N5 (NOD.E2f1–/–) mice displayed a significant enlargement of the thymus, spleen, and lymph nodes as compared with their littermates. Enlargement of these organs reflects an expansion in the population of mature CD4/CD8 single-positive thymocytes and peripheral T cells, which may have been due to a maturation stage-specific defect in the normal pathway of T cell apoptosis (40, 41, 42). Recently, apoptosis was shown to be an important event during normal thymocyte maturation (40, 41). The elimination of thymocytes bearing self-reactive T cell receptors occurs during negative selection and is believed to be mediated by TCR-stimulated apoptosis of CD4/CD8 double-positive thymocytes just before their conversion into mature thymocytes (40, 41, 48, 49). Those observations, taken together with our finding that NOD.E2f1–/– mice have a defect in TCR-stimulated apoptosis of CD4/CD8 double-positive thymocytes, raise the possibility that the E2f1 molecule is functionally active in the process of negative selection.

Recent studies have found that E2f1 functions primarily as a suppressor of cell proliferation (40, 41, 50). Consistent with these findings are observations that E2f1 DNA binding sites in the promoters of several cell cycle genes function primarily to repress transcription of these genes during G0 and G1 (51, 52, 53), presumably by binding to the E2f1-Rb complex. Furthermore, several studies have suggested that repression of transcription the E2f1-Rb complex suppresses entry into the S phase (40, 41, 54). Thus, E2f1-deficient cells may be unable to tether Rb to E2f1 DNA binding sites during the G0 or G1 phase, which may lead to an aberrant expression of particular cell cycle regulatory genes and inappropriate cell proliferation (40). A role of E2f1 in the suppression of thymocyte cell cycle progression might explain the excessive proliferation and significantly different cell cycle distribution seen in the thymus and spleen T lymphocytes of 5-wk-old N5 (NOD.E2f1–/–) mice as compared with the wild-type NOD.E2f1+/+ mice (Fig. 8). Moreover, a direct role of E2f1 as a suppressor of cell cycle progression may explain the additional phenotypes that we and other investigators observed in E2f1-deficient mice, such as testicular atrophy, hyposalivation or exocrine gland dysplasia, increased mortality, hair loss, and sporadic skin tumor formation (40, 41, 42, 43). These results indicate that a deletion of the E2f1 molecule leads to enhanced T cell proliferation and suggest that excessive infiltration of T lymphocytes in pancreas islets and salivary glands caused severe IDDM and SS in E2f1-deficient NOD mice as compared with the wild-type NOD.E2f1+/+ mice (Fig. 2). A role of apoptosis of epithelial cells in the effector phase of sialoadenitis in the NOD mouse was suggested after the study of some investigators (52, 53, 54, 55, 56, 57), while other investigators did not find evidence for a role of apoptosis in the effector phase of sialoadenitis (58). In addition, in our experiments we did not find evidence for a role of apoptosis in the initiation phase of IDDM and SS in either group of mice. E2f1 deficiency may regulate proliferative activities of T cells and associate in the initiation phase rather than promotion of apoptosis. Therefore, the induction of autoreactive T cells was proposed as an important mechanism in the initiation phase of the disease in NOD mice.

CD4+CD25+ immunoregulatory T cells represent a unique lineage of thymic-derived cells that potently suppress both in vitro and in vivo effector T cell functions. There is mounting evidence that CD4+CD25+ T cells represent an important mechanism for the maintenance of self-tolerance (59, 60, 61, 62, 63), and they have been shown to prevent or limit experimentally induced organ-specific autoimmune diseases (1, 61, 64, 65). Several recent studies also demonstrated that removal of these cells from animals that normally do not develop autoimmune disease could result in autoimmunity (29, 66, 67). In most mouse strains, this subset represents 7–10% of the CD4+ T cell subset, while Salomon et al. (1) reported that these cells are reduced in number and represent only 5–6% of the CD4+ T cells in NOD mice. In the present study, we found that both E2f1-deficient NOD and wild-type NOD mice have reduced numbers of CD4+CD25+ T cell subsets, and these T cell subsets were significantly reduced in spleen cells of N5 E2f1 mutant mice as compared with the wild-type NOD.E2f1+/+ mice (Fig. 8). These results reflect an earlier onset of IDDM and SS, along with an excessive number of mature CD4/CD8 single-positive thymocytes and peripheral T cells in 5-wk-old NOD.E2f1–/– mice as compared with their wild-type NOD.E2f1+/+ mice (Figs. 1, 5, and 6) (1, 42, 68, 69). A mutation of the E2f1 molecule from NOD mice may be a factor in the susceptibility of NOD mice to early autoimmunity by causing a severe reduction of immunoregulatory CD4+CD25+ T cell subsets. Furthermore, we examined the production of Th1 and Th2 cytokines (IFN-{gamma} and IL-4, respectively) in peripheral spleen T cells activated with anti-CD3 mAb in E2f1 mutant NOD.E2f1–/– and wild-type NOD.E2f1+/+ female mice. Our results showed that peripheral T lymphocytes from 5-wk-old E2f1- deficient NOD mice produced significantly more IFN-{gamma} than T lymphocytes from 5-wk-old wild-type NOD.E2f1+/+ mice (Fig. 9). However, both mutant and wild-type mice produced a significantly higher amount of IFN-{gamma} and lower amount of IL-4 at 5 wk of age, although there was a significant difference in IFN-{gamma} production between the two groups. These results suggest that T cells from E2f1-deficient NOD mice have an enhanced ability to produce proinflammatory Th1-type cytokine IFN-{gamma}, but it remains unknown whether this contributes to their accelerated rate of type 1 diabetes development.

IDDM and SS result from T cell-mediated autoimmune destruction of {beta} cells in pancreas islets and acinar cells in salivary glands (22, 70). IDDM and SS that spontaneously develop in NOD mice share immunopathological characteristics with human diseases (22, 71). However, the transfer experiments of spleen cells from E2f1-deficient NOD mice did not reveal the differing efficiencies in the IDDM and SS as compared with the NOD mice. This indicates that the pancreatic and salivary glands changes may contribute to induction and enhancement of autoreactive T cells. Moreover, the E2F-1 deficiency may lead to decreasing production of saliva and insulin, resulting in the early onset of diabetes. Therefore, a definitive conclusion regarding the mechanism of early-onset diabetes in E2f1-deficient NOD mice requires further investigation producing E2f1-deficient NOD.SCID mice in which autoreactive T cells do not develop.

In conclusion, we demonstrated that the loss of the E2f1 from NOD mice caused an early onset of IDDM and SS autoimmune diseases from widespread inflammatory infiltrates in the islets of Langerhans in the pancreas and salivary glands, as well as an accumulation of mature T (CD4+ or CD8+) cells in the thymus, spleen, and lymph nodes. We also found that the loss of the E2f1 molecule from normal standard NOD mice caused an inappropriate cell cycle distribution in thymocytes and peripheral spleen T lymphocytes. Th cell effector function such as cytokine (IFN-{gamma} or IL-4) secretion is dependent on T cell proliferation (72, 73, 74). The increased production of IFN-{gamma} observed in the present study is consistent with those reports and suggests that the increased number of inflammatory T cells in E2f1 mutant mice may contribute to the development of autoimmune diseases by increasing T cell effector functions. We suggest that molecules such as E2f1, which can intervene in cell cycle control mechanisms, have a functional effect to restrict the development of early and increased onset of IDDM and SS in NOD mice. Furthermore, E2f1-deficient N5 (NOD.E2f1–/–) mice may be a useful model to study the functional role of the E2f1 molecule and other E2F molecules in IDDM and SS, as well as other dry mouth-type diseases.


    Acknowledgments
 
We thank Dr. Ryoma Nakao and Dr. Bibi Rahima for their technical assistance and encouragement.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by a Grant-in-Aid from the Ministry of Health, Labor and Welfare of Japan to the Japan Foundation for Emergency Medicine and development scientific research grants (1539057) from the Ministry of Education, Science, Sports and Culture of Japan This study was also funded in part by "Ground Research for Space Utilization" promoted by the National Space Development Agency of Japan and Japan Space Forum. Back

2 Address correspondence and reprint requests to Dr. Hidenobu Senpuku, Department of Bacteriology, National Institute of Infectious Diseases, Toyama 1-23-1, Shinjuku-ku, Tokyo162-8640, Japan. E-mail address: hsenpuku{at}nih.go.jp Back

3 Abbreviations used in this paper: IDDM, insulin-dependent diabetes mellitus; SS, Sjögren’s syndrome; Rb, retinoblastoma; SSLP, simple sequence length polymorphism. Back

Received for publication July 13, 2003. Accepted for publication August 13, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Salomon, B., D. J. Lenschow, L. Rhee, N Ashourian, B. Singh, A. Sharpe, J. A. Bluestone. 2000. B7/CD28 costimulation is essential for the homeostasis of the CD4+CD25+ immunoregulatory T cells that control autoimmune diabetes. Immunity 12:431.[Medline]
  2. Serreze, D. V., H. D. Chapman, D. S. Varnum, M. S. Hanson, P. C. Reifsnyder, S. C. Richard, A. S. Fleming, E. L. Leiter, L. D. Shultz. 1996. B lymphocytes are essential for the initiation of T cell-mediated autoimmune diabetes: analysis of a new speed congenic stock of NOD.Ignull mice. J. Exp. Med. 184:2049.[Abstract/Free Full Text]
  3. Hattori, M., E. Yamato, N. Itoh, H. Senpuku, T. Fujisawa, M. Yoshino, M. Fukuda, E. Matsumoto, T. Toyonaga, I. Najagawa, et al 1999. Homologous recombination of the MHC class 1K region defines new MHC-linked diabetogenic susceptibility gene(s) in nonobese diabetic mice. J. Immunol. 163:1721.[Abstract/Free Full Text]
  4. Bloch, K. J., W. W. Buchanan, M. J. Wohl, J. J. Bunim. 1992. Sjögren’s syndrome: a clinical, pathological study of sixty-two cases. Medicine 41:386.
  5. Daniels, T. E., P. Fox. 1992. Salivary and oral components of Sjögren’s syndrome. Rheum. Dis. Clin. North Am. 18:571.[Medline]
  6. Wicker, L. S., M. C. Appel, F. Dotta, A. Pressey, B. J. Miller, N. H. DeLarato, P. A. Fischer, R. C. Boltz, Jr, L. B. Peterson. 1992. Autoimmune syndrome in major histocompatibility complex (MHC) congenic strains of nonobese diabetic (NOD) mice: the NOD MHC is dominant for insulitis and cyclophosphamide-induced diabetes. J. Exp. Med. 176:67.[Abstract/Free Full Text]
  7. Wicker, L. S., B. J. Miller, L. Z. Coker, S. E. McNally, S. Scott, Y. Mullen, M. C. Appel. 1987. Genetic control of diabetes and insulitis in the nonobese diabetic (NOD) mouse. J. Exp. Med. 165:1639.[Abstract/Free Full Text]
  8. Fox, R. I., G. Pearson, J. H. Vaughan. 1986. Detection of Epstein-Barr virus-associated antigens and DNA in salivary gland biopsies from patients with Sjögren’s syndrome. J. Immunol. 137:3162.[Abstract]
  9. Makino, S., K. Kunimoto, Y. Muraoka, Y. Mizushima, K. Katigiri, Y. Tochino. 1980. Breeding of a non-obese diabetic strain of mice. Jikken Dobutsu. 29:1.[Medline]
  10. Serreze, D. V., S. A. Fleming, H. D. Chapman, S. D. Richard, E. H. Leiter, R. M. Tisch. 1998. B lymphocytes are critical antigen presenting cells for the initiation of T cell-mediated autoimmune diabetes in nonobese diabetic mice. J. Immunol. 161:3912.[Abstract/Free Full Text]
  11. Jansen, A., F. Homo-Delarche, H. Hooijokaas, P. J. Leenen, M. Dardenne, H. A. Drexhage. 1994. Immunohistochemical characterization of monocytes-macrophages and dendritic cells involved in the initiation of the insulitis and {beta}-cell destruction in NOD mice. Diabetes 43:667.[Abstract]
  12. Lühder, F., P. Hoglund, J. P. Allison, C. Benoist, D. Matis. 1998. Cytotoxic lymphocyte-associated antigen 4 (CTLA-4) regulates the unfolding of autoimmune diabetes. J. Exp. Med. 187:427.[Abstract/Free Full Text]
  13. O’Reilly, L. A., P. R. Hutchings, P. R. Crocker, E. Simpson, T. Lund, D. Kioussis, F. Takei, J. Baird, A. Cooke. 1991. Characterization of pancreatic islet cell infiltration in NOD mice: effect of cell transfer and transgene expression. Eur. J. Immunol. 21:1171.[Medline]
  14. Adamson, T. C., R. I. Fox, D. M. Frisman, F. V. Howell. 1983. Immunological analysis of lymphoid infiltrates in primary Sjogren’s syndrome using monoclonal antibodies. J. Immunol. 130:203.[Abstract]
  15. Zumla, A., M. Mathur, J. Stewart, L. Wilkinson, D. Isenberg. 1991. T cell receptor expression in Sjogren’s syndrome. Ann. Rhem. Dis. 50:691.[Abstract/Free Full Text]
  16. Boulard, O., G. Fluteau, L. Eloy, D. Damotte, P. Bedossa, H. J. Garchon. 2002. Genetic analysis of autoimmune sialadenitis in nonobese diabetic mice: a major susceptibility region on chromosome 1. J. Immunol. 168:4192.[Abstract/Free Full Text]
  17. Haneji, N., T. Nakamura, K. Takio, K. Yanagi, H. Higashiyama, I. Saito, S. Noji, H. Sugino, Y. Hayashi. 1997. Identification of {alpha}-fodrin as a candidate autoantigen in primary Sjogren’s syndrome. Science 276:604.[Abstract/Free Full Text]
  18. Miller, B. J., M. C. Appel, J. J. O’Neil, L.S. Wicker. 1988. Both the Lyt-2+ and L3T4+ cell subsets are required for the transfer of diabetes in nonobese diabetic (NOD) mice. J. Immunol. 140:52.[Abstract]
  19. Bendelac, A., C. Carnaud, C. Boitard, J. F. Bach. 1987. Syngenic transfer of autoimmune diabetes from diabetic NOD mice to healthy neonates: requirement of both L3T4+ and Lyt-2+ T cells. J. Exp. Med. 166:823.[Abstract/Free Full Text]
  20. Asamoto, H., Y. Akazawa, S. Tashiro. 1984. Infiltration of lymphocytes in various organs of the NOD (non-obese diabetic) mouse. J. Jpn. Diab. Soc. 27:775.
  21. Hunger, R. E., C. Carnaud, I. Vogt, C. Mueller. 1998. Male gonadal environment paradoxically promotes dacryoadenitis in non-obese diabetic mice. J. Clin. Invest. 101:1300.[Medline]
  22. Feili-Hariri, M., D. H. Falkner, P. A. Morel. 2002. Regulatory Th2 response induced following adoptive transfer of dendritic cells in prediabetic NOD mice. Eur. J. Immunol. 32:2021.[Medline]
  23. Rabinovitch, A.. 1994. Immunoregulatory and cytokine imbalances in the pathogenesis of IDDM: therapeutic intervention by immunostimulation?. Diabetes 43:613.[Abstract]
  24. Rapoport, M. J., A. Jaramillo, D. Zipris, A. H. Lazarus, D. V. Sereze, E. H. Leiter, P. Cyopock, J. S. Danska, T. L. Delovitch. 1993. IL4 reverses T cells proliferative unresponsiveness and prevents the onset of diabetes in NOD mice. J. Exp. Med. 178:87.[Abstract/Free Full Text]
  25. Serreze, D.V., H. D. Chapman, C. M. Post, E. A. Johnson, W. L. Suarez-Pinzon, A. Rabinovitch. 2001. Th1 to Th2 cytokine shifts in nonobese diabetic mice: sometimes an outcome, rather than the cause of diabetes resistance elicited by immunostimulation. J. Immunol. 166:1352.[Abstract/Free Full Text]
  26. Koarada, S., Y. Wu, W. M. Ridgway. 2001. Increased entry into the IFN-{gamma} effector pathway by CD4+ T cells selected by I-Ag7 on a non-obese diabetic versus C57BL/6 genetic background. J. Immunol. 167:1693.[Abstract/Free Full Text]
  27. Tisch, R., X. D. Yang, S. M. Singer, R. S. Liblau, L. Fluger, H. O. McDevit. 1993. Immune response to glutamic acid decarboxylase correlates with insulitis in non-obese diabetic mice. Nature 366:72.[Medline]
  28. Wegmann, D. R., R. G. Gill, M. Norbury-Glaser, N. Schloot, D. Daniel. 1994. Analysis of the spontaneous T cell response to insulin in NOD mice. J. Autoimmun. 7:833.[Medline]
  29. Suri-Payer, E., A. Z. Amar, A. M. Thornton, E. M. Shevach. 1998. CD4+CD25+ T cells inhibit both the induction and effector function of autoreactive T cells and represent a unique lineage of immunoregulatory cells. J. Immunol. 160:1212.[Abstract/Free Full Text]
  30. Pakala, S. V., M. O. Kurrer, J. D. Katz. 1997. T helper 2 (Th2) T cells induce acute pancreatitis and diabetes in immune-compromised nonobese diabetic (NOD) mice. J. Exp. Med. 186:299.[Abstract/Free Full Text]
  31. Poulin, M., K. Haskins. 2000. Induction of diabetes in nonobese diabetic mice by Th2 T cell clone from a TCR transgenic mouse. J. Immunol. 164:3072.[Abstract/Free Full Text]
  32. Kanagawa, O., G. Xu, A. Tevaarwerk, B. A. Vaupel. 2000. Protection of nonobese diabetic mice from diabetes by gene(s) closely linked to IFN-{gamma} receptor loci. J. Immunol. 164:3919.[Abstract/Free Full Text]
  33. Serreze, D. V., C. M. Post, H. D. Chapman, E. A. Johnson, B. Lu, P. B. Rothman. 2000. Interferon-{gamma} receptor signaling is dispensable in the development of autoimmune type 1 diabetes in NOD mice. Diabetes 49:2007.[Abstract/Free Full Text]
  34. Helin, K., J. A. Lees, M. Vidal, N. Dyson, E. Harlow, A. Fattaey. 1992. A cDNA encoding a pRB-binding protein with properties of transcription factor E2F. Cell 70:337.[Medline]
  35. Kaelin, W. G., Jr, W. Krek, W. R. Sellers, J. A. Decaprio, F. Ajchenbaum, C. S. Fuchs, T. Chittenden, Y. Li, P. J. Farnham, M. A. Blanar, et al 1992. Expression cloning of a cDNA encoding a retinoblastoma-binding protein with E2F-like properties. Cell 70:351.[Medline]
  36. Shan, B., W. H. Lee. 1994. Deregulated expression of E2F-1 induces S-phase entry and leads to apoptosis. Mol. Cell. Biol. 14:8166.[Abstract/Free Full Text]
  37. La Thangue, N. B.. 1994. DTRF1/E2f: an extending family of heterodimeric factors implicated in cell cycle control. Trends Biochem. Sci. 19:108.[Medline]
  38. Nevins, J. R.. 1992. E2F: a link between the Rb tumor suppressor protein and viral oncoproteins. Science 258:424.[Abstract/Free Full Text]
  39. Chellappan, S. P., S. Hiebert, M. Mudryj, J. M. Horowitz, J. R. Nevins. 1991. The E2F transcription factor is a cellular target for the RB protein. Cell 65:1053.[Medline]
  40. Murga, M., O. Fernandez-Capetillo, S. J. Field, B. Moreno, L. R. Borlado, Y. Fujiwara, D. Balomenos, A. Vicario, A. C. Carrera, S. H. Orkin, et al 2001. Mutation of E2F2 in mice causes enhanced T lymphocyte proliferation, leading to the development of autoimmunity. Immunity 15:959.[Medline]
  41. Field, S. J., F. Y. Tsai, F. Kuo, A. M. Zubiaga, Jr, W. G. Kaelin, D. M. Livingston, S. H. Orkin, M. E. Greenberg. 1996. E2F-1 functions in mice to promote apoptosis and suppress proliferation. Cell 85:549.[Medline]
  42. Yamasaki, L., T. Jacks, R. Bronson, E Goillot, E. Harlow, N. J. Dyson. 1996. Tumor induction and tissue atrophy in mice lacking E2F-1. Cell 85:537.[Medline]
  43. Lillibridge, C. D., B. C. O’Connell. 1997. In human salivary gland cells, over expression of E2F1 overcomes an interferon-{gamma}- and tumor necrosis factor-{alpha}-induced growth arrest but does not result in complete mitosis. J. Cell Physiol. 172:343.[Medline]
  44. Zhu, J. W., D. DeRyckere, F. X. Li, Y. Y. Wan, J. DeGregori. 1999. A role for E2F1 in the induction of ARF, p53, and apoptosis during thymic negative selection. Cell Growth Differ. 10:829.[Abstract/Free Full Text]
  45. Rounbehler, R. J., P. M. Rogers, C. J. Conti, D. G. Johnson. 2002. Inactivation of E2f1 enhances tumorigenesis in a Myc transgenic model. Cancer Res. 11:3276.
  46. O’Hare, M. J., S. T. Hou, E. J. Morris, S. P. Cregan, Q. Xu, R. S. Slack, D. S. Park. 2000. Induction and modulation of cerebellar granule neuron death by E2F-1. J. Biol. Chem. 275:25328.
  47. Yamasaki, L., R. Bronson, B. O. Williams, N. J. Dyson, E. Harlow, T. Jacks. 1998. Loss of E2F-1 reduces tumorigenesis and extends the life span of Rb1 (+/–) mice. Nat. Genet. 18:360.[Medline]
  48. Fowlkes, B. J., R. H. Schwartz, D. M. Paradol. 1988. Deletion of self-reactive thymocytes occurs at a CD4+/8+ precursor stage. Nature 334:620.[Medline]
  49. Kisielow, P., H. Von Boehmer. 1991. Kinetics of negative and positive selection in the thymus. Adv. Exp. Med. Biol. 292:31.[Medline]
  50. Krek, W., M. E. Ewen, S. Shirodkar, Z. Arany, W.G. Kaelin, Jr, D. Livingston. 1994. Negative regulation of the growth-promoting transcription factor E2F-1 by a stably bound cyclin A-dependent protein kinase. Cell 78:161.[Medline]
  51. Weintraub, S. J., C. A. Prater, D. C. Dean. 1992. Retinoblastoma protein switches the E2F site from positive to negative element. Nature 358:259.[Medline]
  52. Weintraub, S. J., K. N. Chow, R. X. Luo, S. H. Zhang, S. He, D. C. Dean. 1995. Mechanism of active transcriptional expression by the retinoblastoma protein. Nature 375:812.[Medline]
  53. Neuman, E., E. K. Flemington, W. R. Sellers, W. G. Kaelin, Jr. 1994. Transcription of the E2F-1 gene is rendered cell cycle dependent by E2F DNA-binding sites within its promoter. Mol. Cell. Biol. 14:6607.[Abstract/Free Full Text]
  54. Sellers, W. R., J. W. Rodgers, W. G. Kaelin, Jr. 1997. A potent transrepression domain in the retinoblastoma protein induces a cell cycle arrest when bound to E2F sites. Proc. Natl. Acad. Sci. USA 92:11544.
  55. Elkon, K. B.. 1998. Fas (APO-1/CD95)- assisted suicide in NOD exocrine glands. Clin. Exp. Rheumatol. 16:659.[Medline]
  56. Humphrey-Beher, M. G., Y. Hu, Y. Nakagawa, P. L. Wang, K. R. Purushotham. 1994. Utilization of the non-obese diabetic (NOD) mouse as an animal model for the study of secondary Sjögren’s syndrome. Adv. Exp. Med. Biol. 350:631.[Medline]
  57. Kong, L., C. P. Robinson, A. B. Peck, N. Vela-Roch, K. M. Sakata, H. Dang, N. Talal, M. G. Humphrey-Beher. 1998. Inappropriate apoptosis of salivary and lacrimal gland epithelium of immunodeficient NOD-scid mice. Clin. Exp. Rheumatol. 16:675.[Medline]
  58. Van Blokland, S. C., C. G. Van Helden-Meeuwsen, A. F. Wierenga-Wolf, D. Tielemans, H. A. Drexhage, J. P. Van De Merwe, F. Homo-Delarche, M. A. Versnel. 2003. Apoptosis and apoptosis-related molecules in the submandibular gland of the non-obese diabetic mouse model for Sjögren’s syndrome: limited role of apoptosis in the development of sialoadenitis. Lab. Invest. 83:3.[Medline]
  59. Sakaguchi, S.. 2000. Regulator T cells: key controllers of immunologic self-tolerance. Cell 101:455.[Medline]
  60. Shevach, E.. 2001. Certified professionals: CD4+CD25+ suppressor T cells. J. Exp. Med. 193:F41.[Medline]
  61. Wu, A. J., H. Hua, S. H. Munson, H. O. McDevitt. 2002. Tumor necrosis factor-{alpha} regulation of CD4+CD25+ T cell levels in NOD mice. Proc. Natl. Acad. Sci. USA 99:12287.[Abstract/Free Full Text]
  62. Murakami, M., A. Sakamoto, J. Bender, J. Kappler, P. Marrack. 2002. CD25+CD4+ T cells contribute to the control of memory CD8+ T cells. Proc. Natl. Acad. Sci. USA 99:8832.[Abstract/Free Full Text]
  63. Kukreja, A., G. Cost, J. Marker, C. Zhang, Z. Sun, K. Lin-Su, S. Ten, M. Sanz, M. Exley, B. Wilson, et al 2002. Multiple immuno-regulatory defects in type-1 diabetes. J. Clin. Invest. 109:131.[Medline]
  64. Asseman, C., S. Mauze, M. W. Leach, R. L. Ciffman, F. Powrie. 1999. An essential role for interleukin 10 in the function of regulatory T cells and inhibit intestinal inflammation. J. Exp. Med. 190:995.[Abstract/Free Full Text]
  65. Seddon, B., D. Mason. 1999. Regulatory T cells in the control of autoimmunity: the essential role of transforming growth factor {beta} and interleukin 4 in the prevention of autoimmune thyroiditis in rats by peripheral CD4+CD45RC+ cells and CD4+CD8+ thymocytes. J. Exp. Med. 189:279.[Abstract/Free Full Text]
  66. Sakaguchi, S., N. Sakaguchi, M. Asano, M. Itoh, M. Toda. 1995. Immunological self tolerance maintained by activated T cells expressing IL-2 receptor {alpha}-chains (CD25): breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J. Immunol. 155:1151.[Abstract]
  67. Smith, D. S., G. Leone, J. DeGregori, M. N. Ahmed, M. B. Qumsiyeh, J. R. Nevin. 2000. Induction of DNA replication in adult rat neurons by deregulation of the retinoblastoma/E2F G1 cell cycle pathway. Cell Growth Differ. 11:625.[Abstract/Free Full Text]
  68. Stephens, L. A., C. Mottet, D. Mason, F. Powrie. 2001. Humans CD4+CD25+ thymocytes and peripheral T cell have immune suppressive activity in vitro. Eur. J. Immunol. 31:1247.[Medline]
  69. Green, E. A., Y. Choi, R. A. Flavell. 2002. Pancreatic lymph node-derived CD4+CD25+ Treg cells: highly potent regulators of diabetes that require TRANCE-RANK signals. Immunity 16:183.[Medline]
  70. Castano, L., G. S. Eisenbarth. 1990. Type-1 diabetes: a chronic autoimmune disease of human, mouse and rat. Annu. Rev. Immunol. 8:647.[Medline]
  71. Leiter, E. H., M. Prochazaka, D. L. Coleman. 1987. The non-obese diabetic (NOD) mouse. Am. J. Pathol. 128:380.[Medline]
  72. Wang, B., I. Andre, A. Gonzalez, J. D. Katz, M. Aguet, C. Benoist, D. Mathis. 1997. Interferon-{gamma} impacts at multiple points during the progression of autoimmune diabetes. Proc. Natl. Acad. Sci. USA 94:13844.[Abstract/Free Full Text]
  73. Bird, J. J., D. R. Brown, A. C. Mullen, N. H. Moskowitz, M. A. Mahowald, J. R. Sider, T. F. Gajewski, C. R. Wang, S. L. Reiner. 1998. Helper T cell differentiation is controlled by the cell cycle. Immunity 9:229.[Medline]
  74. Gett, A. V., P. D. Hodgkin. 1998. Cell division regulates the T cell cytokine repertoire, revealing a mechanism underlying immune class regulation. Proc. Natl. Acad. Sci. USA 95:9488.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Salam, M. A.
Right arrow Articles by Senpuku, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Salam, M. A.
Right arrow Articles by Senpuku, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS