| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
* Department of Biodefense, Graduate School of Medical Sciences,
School of Nursing, and
Animal Center, Nagoya City University, Nagoya, Japan;
Choju Medical Institute, Fukushimura Hospital, Toyohashi, Japan; and
¶
National Institute for Longevity Sciences, Ohbu, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The mouse proCPR gene was isolated by screening a mouse 129/SV 
FIX II genomic library with mouse proCPR cDNA as a probe. A 23.2-kb NotI DNA fragment containing exons 3A-7 was subcloned into pBluescript II SK (–) vector (Stratagene, La Jolla, CA). A 4.3-kb EcoRV-SalI proCPR DNA fragment containing exon 6 from the above plasmid was subcloned into a pLoxNeoB-P1/R vector, which is composed of a phosphoglycerate kinase (PKG) promoter, a neomycin (neo) resistant gene, and a PGK poly(A) sequence. The resulting plasmid was used as a positive control for PCR detection of the wild-type allele. A 3.0-kb BamHI DNA region of the above 4.3-kb EcoRV-SalI fragment was removed from the plasmid. A 5.0-kb EcoRI proCPR DNA fragment containing exon 3B was inserted at the 3' end of the neo cassette. As a result, the neo cassette was flanked by 1.3 and 5.0 kb of homologous sequences. The 8.0-kb BamHI-XhoI fragment containing the neo cassette and the homologous sequences was subcloned into the BamHI-XhoI-restricted pPGKTk ApaI/R vector composed of a PGK promoter, an HSV thymidine kinase gene, and a PGK poly(A) sequence. The construction of the targeting vector is shown in Fig. 1.
|
The BamHI-linearized targeting vector was introduced by electroporation into E14 embryonic stem (ES) cells derived from the murine 129/Ola strain with Gene Pulser (two pulses of 300 V and 125 µF; Bio-Rad, Hercules, CA). Selection was started 24 h later with G418 (0.3 mg/ml) and ganciclovir (2 µM), and cells were subsequently cultured for 7 days. Correctly targeted ES clones were identified by PCR with a pair of primers specific to the proCPR gene-flanking sequence of the targeting construct (5'-CCAAAGTAAAACCTCCTCACCAAG-3') and the pLoxNeoB-P1/R vector (5'-GCTATACGAAGTTATTAGGTCCCTCG-3'), respectively, and were confirmed by Southern blot analysis. Germline chimera were generated by Japan SLC (Hamamatsu, Japan). Chimeric mice were produced by microinjecting ES cells from four different targeted clones into C57BL/6 blastocytes. Male chimeras were mated to BALB/c females and germline transmission of the mutant proCPR gene in all progeny was confirmed by PCR and Southern blot analysis of tail DNA. Germline transmission was obtained from one of four clones injected. Brother-sister mating was conducted to generate homozygous proCPR-deficient mutants. The background of their progeny was 129/Ola, BALB/c, and C57BL/6. The experimental protocol was approved by the Animal Studies Committee of Nagoya City University Graduate School of Medical Sciences.
Analysis of genotypes
Genomic DNA was isolated from mouse tail and used for genotypic PCR analysis. PCR products from the wild-type allele derived from primers exon 5+ (GCTTTCTGTTTGTGGTTCATAGGCTAC) and SA– (GAATGTTCTCCAGCAGGTGAAATCA), and from the mutant allele derived from primers neo/4.3 (368+) (GCTATACGAAGTTATTAGGTCCCTCG) and neo/4.3 (1775–) (CCAAAGTAAAACCTCCTCACCAAG), were both 1.4 kb. The DNA fragment was amplified with rTaq DNA polymerase (Toyobo, Osaka, Japan) for 32 cycles of 94°C for 1 min, 60°C for 90 s, and 72°C for 90 s, followed by 72°C for 10 min. PCR products were separated by electrophoresis on 2% agarose gels and visualized by ethidium bromide staining.
RT-PCR
Total RNA was extracted from mouse liver using TRIzol reagent (Invitrogen Life Technologies, Gaithersburg, MD). cDNA was synthesized from total RNA with Superscript II reverse transcriptase (Invitrogen Life Technologies, San Diego, CA) and used as a template for PCR. The following primers were used; exons 2–3, ex2S (CTGCTCTTCCAAGAACCTCCA) and ex3A (ACACTGTCGACATCAGACGC); exons 1–6, ex1S (GCTTCGCCTTTCAGAGTGG) and ex6A (ACGTGTAGTCATAGCCATCCACG); exons 4–5, ex4S (CTGAACAGCATCCTGACA) and ex5A (GCAGGTGAAATCCATTCTCTGGC); exons 6–10, ex6S (GTGGATGGCTATGACTACACGT) and ex10A (TGTATCTCTCAGGCAGC). DNA was amplified with rTaq DNA polymerase for 30 cycles of 95°C for 30 s, 50°C for 30 s, and 72°C for 1 min, followed by 72°C for 5 min. PCR products were analyzed by electrophoresis on 2% agarose gels.
Preparation of fresh sera for measurement of CP activity
ProCPR+/+, proCPR+/–, and proCPR–/– mice, 8–12 wk of age, were anesthetized with pentobarbital and blood was collected by venipuncture of the inferior vena cava. The blood sample was immediately put into a 1.5-ml Eppendorf tube on ice and incubated overnight at 4°C before centrifugation at 3000 rpm for 15 min at 4°C to remove clots. The supernatant was used as the source of serum for determination of CP activity.
Determination of CP activity
CP activity was determined by means of a colorimetric assay using hippuryl-L-arginine (Peptide Institute, Osaka, Japan) as a synthetic substrate (16, 17). In fresh sera, we found CP activity of the CPR generated during coagulation in addition to that of CPN, which is constantly present in the active form in plasma. Total CP activity in sera was determined before or after preincubation at 37°C for 1 h, conditions which inactivate CPR. All sera were diluted 1/10 in 50 mM Tris-HCl buffer (pH 8.0) before using. In fresh sera, an appreciable amount of unactivated proCPR remained. To convert all proCPR to CPR, thrombin and thrombomodulin complexes (T-TM) were added for determination of total proCPR as follows. For determination of both proCPR and CPN activities, sera were diluted 1/10 in 50 mM Tris-HCl (pH 8.0) containing 2 NIH U/ml thrombin (Nihon Pharmaceutical, Tokyo, Japan), 1.4 µg/ml thrombomodulin (a generous gift from A. Kasei, Tokyo, Japan), and 4 mM CaCl2 (each quantity represented the final concentration), and incubated for 20 min at room temperature. Ten microliters of these samples were mixed with 5 µl of 50 mM hippuryl-L-arginine in 50 mM HEPES (pH 8.2) as the substrate solution before incubation for 1 h at room temperature. After the incubation, 100 µM of 0.25 M phosphate buffer (pH 8.3) and 75 µM 3% cyanuric chloride in 1,4 dioxane were added to the mixtures which were then stirred for 20 s on a vortex mixer and centrifuged at 5,000 rpm for 10 min at 4°C. A 100-µl aliquot of the supernatant of each tube was transferred to a 96-well microtiter plate for measurement of absorbance at 405 nm. Each value was compared with a hippuric acid standard curve and the CP activity of each serum sample was then determined as the amount of hippuric acid produced within 1 h.
Histopathology
ProCPR+/+ and proCPR–/– mice, 8–12 wk of age, were killed under anesthesia with pentobarbital. Samples of tissues were immediately fixed in 10% phosphate-buffered formalin, then dehydrated in ethanol, cleared in xylene, and embedded in paraffin. The treated tissues were as follows: brain, heart, lungs, liver, kidneys, intestines, stomach, esophagus, spleen, salivary glands, seminal vesicles, testes, thymus, urinary bladder, trachea, adrenal glands, pancreas, and skeletal muscle. Sections were cut at 3-µm thickness and subjected to H&E staining.
Inflammatory model using LPS injection
For the acute inflammatory model, mice were injected i.p. with 15 mg/kg body weight of LPS (Escherichia coli O111:B4, Sigma-Aldrich, St. Louis, MO) dissolved in sterile saline. For the chronic inflammatory model, mice were injected i.p. with 3 mg/kg LPS in sterile saline every 24 h for 1 wk (seven times).
Complement activation model using cobra venom factor (CVF)
CVF was purified from lyophilized cobra venom (Naja naja; Sigma-Aldrich) as described elsewhere (16). Each mouse was injected i.p. with 100 U of CVF or injected i.v. into the tail vein with 200 U of CVF.
Complement activation model using C5aR up-regulation
For up-regulation of C5aR, 5 mg/kg LPS in sterile saline were injected i.v. into the tail (18). After 6 h, CVF was injected i.p. at a dose of 30 U/mouse. As a control group, some mice were not injected with CVF.
Guinea pig skin test for anaphylatoxin activity
The mouse serum was incubated with 1 mg/ml zymosan A (Sigma-Aldrich) at 37°C for 1 h and centrifuged at 1000 rpm for 5 min to remove this agent. As a control, the mouse serum was incubated without zymosan A using the same conditions. Guinea pigs were injected i.v. with 4 mg of Evans blue (Nacalai Tesque, Kyoto, Japan) 30 min before intradermal injection of 50 µl of mouse serum. After 1 h, guinea pigs were killed by stunning and cervical dislocation before removal of the skin. The blue spots were evaluated from the inner surface of the skin.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Genomic DNA from mouse tails was used for genotyping by PCR. One of the primers used to detect the wild-type allele matched sequences within exon 5 of proCPR and the other matched that within the intron preceeding exon 6 of proCPR. Therefore, the bands synthesized with these primers were detected only with genomic DNA of proCPR+/+ and proCPR+/– mice. In contrast, both of the primers for detecting the mutant allele matched the sequences included in the neo vector sequences, and the bands were synthesized with only the genomic DNA of proCPR–/– and proCPR+/– mice (Fig. 1b).
RT-PCR with liver mRNA
To confirm the deficiency of proCPR mRNA, RT-PCR was performed with four sets of primers to detect four positions on the mRNA isolated from the liver. All of the PCR products were full length for the mRNA from the proCPR+/+ mouse (Fig. 2). In contrast, with the mRNA of the proCPR–/– mouse, the sizes of the PCR product of exons 1–6 were shorter by 
200 bp than those of proCPR+/+, although those of exons 2–3 and 6–10 were the same as those of the proCPR+/+ mouse. The 200 nucleotide bp length was consistent with the length of exons 4 and 5 coding for proCPR. A band for exons 4–5 was not detected with mRNA isolated from the proCPR–/– mouse. With mRNA from proCPR+/–mice, the bands detected on the agarose gel consisted of all the sizes found with both proCPR+/+ and proCPR–/– mice. This confirmed generation of the proCPR+/– and proCPR–/– mice. ProCPR synthesized in the proCPR–/– mice is defective in the region encoded by exons 4 and 5, which includes the genes for two of three zinc-binding sites and one of nine substrate-binding sites in humans (10).
|
We generated 129/B6/BALB/c (129/Ola, C57BL/6, and BALB/c) proCPR-deficient mice. By the mating of male 129/B6 (129/Ola and C57BL/6) chimeras and female wild-type BALB/c, we obtained one proCPR+/– F1 mouse. This proCPR+/– mouse was mated with other wild-type littermates, and proCPR+/+ and proCPR+/– F2 offspring with the strain backgrounds of 129/B6/BALB/c were obtained. ProCPR+/+, proCPR+/–, and proCPR–/– F3 mice were generated by the mating of proCPR+/– F2 mice. However, as shown in Table I, proCPR–/– F3 mice represented only 14 of 124, and proCPR–/– F4 mice represented 9 of 138. The ratios of these offspring did not conform to Mendel’s laws.
|
The CP activity of sera from a proCPR–/– mouse and a proCPR+/– mouse was determined and compared with that of a proCPR+/+ mouse. Because only a portion of proCPR is activated to CPR during coagulation, the addition of T-TM and Ca2+ can be used to activate the remaining proCPR (17, 19). In this experiment, the serum was incubated with T-TM and Ca2+ for 20 min at room temperature and then used to determine the total proCPR and CPN activity. The half-lives of CPR in sera of humans and other animals tested were within 6.3–16 min at 37°C (6, 17, 19). Mouse CPR was also labile at 37°C. Therefore, serum incubated for 1 h at 37°C was used to determine CPN activity, because almost all CPR would have been inactivated during the incubation. The CPR activities of proCPR+/+, proCPR+/–, and proCPR–/– mice were 12.48 ± 1.73 nmol/h (n = 7), 5.03 ± 0.30 nmol/h (n = 8), and 0.60 ± 0.17 nmol/h (n = 12), respectively, and CPN activities were 4.79 ± 0.35 nmol/h (n = 7), 5.01 ± 0.16 nmol/h (n = 8), and 5.00 ± 0.13 nmol/h (n = 12), respectively (Fig. 3).
|
Possible morphological abnormality was observed in the kidney. The epithelial cells lining the inner surface of most of the renal Bowman’s capsules of the proCPR–/– mouse kidney, many of which were flat in the proCPR+/+ mice, showed a cuboidal shape continuing to the proximal urinary tubular cells (Fig. 4). This change was seen only in some renal glomeruli of proCPR+/+ mice (n = 5), however, proCPR–/– mice (n = 4) showed a significant increase in the number of changes; the mean (mean ± SD) percentages of glomeruli with this change were 73 ± 7.5% in proCPR–/– mice, and 24 ± 3.5% in proCPR+/+ mice. Statistical analysis using the Mann-Whitney U test showed significant difference between the two groups (p = 0.0143).
|
In preliminary experiments, a portion of proCPR+/+ mice survived the i.p. challenge with 15 mg/kg LPS although none survived challenge with 30 mg/kg LPS. Therefore, we used 15 mg/kg LPS to demonstrate increased susceptibility to LPS in proCPR–/– mice. However, some of the proCPR–/– mice survived the LPS challenge as did other types of mice. (Table II). For a chronic inflammation model, a lower concentration of LPS (3 mg/kg) was injected i.p. every 24 h for 1 wk (seven times). After the first injection, some mice in all groups died, and additional deaths occurred from the second to fifth injections (Fig. 5). However, the remaining mice recovered and lived for at least 1 wk after the final LPS injection. From this data, no difference was noted between the proCPR–/– group and any other group of mice.
|
|
As CVF is a strong activator of the alternative complement pathway (20), its injection induces an enhanced production of anaphylatoxins C3a and C5a. Because CVF injection did not result in serious symptoms under normal conditions, we hypothesized that CPR could play an important role in inactivation of these anaphylatoxins in the acute phase. However, i.v. injection of CVF even at a high dose (200 U) did not induce lethal shock in proCPR–/– mice (Table III). It was reported that an i.v. injection of LPS induced the up-regulation of C5aR in mice and rats (18, 21). Furthermore, LPS sensitization of rats induced lethal shock with i.v. injection of a mAb to Crry, a membrane inhibitor of C (22). Therefore, we injected CVF i.p. 6 h after i.v. injection of LPS (5 mg/kg). In preliminary experiments, sensitization of mice with 5 mg/kg LPS rendered the mice, including proCPR+/+ mice, susceptible to lethal challenge with 200 U of CVF and proCPR+/– mice susceptible to challenge with 50 U of CVF. Therefore, we used 30 U of CVF to demonstrate the difference in the susceptibility between the proCPR–/– mice and other mice following LPS sensitization (Table III). The survival rate of proCPR+/+ and proCPR+/– mice 24 h after the CVF injection was 100% and only one proCPR+/– mouse died 3 days later. In contrast, 6 of 10 proCPR–/– mice died within 24 h of CVF injection.
|
Local inflammation in the skin of guinea pig induced by inoculation of mouse serum was visualized with exudation of Evans blue injected i.v. (Fig. 6). Exudation only occurred where proCPR–/– serum was inoculated, and the lesion was apparently stronger at sites inoculated with proCPR–/– mouse serum treated with zymosan A. However, proCPR+/+ serum induced no exudation even after treatment with zymosan A. Repeated experiments gave the same result.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
30% that of proCPR+/+ mice, whereas proCPR–/– mice had little CPR activity at a level which was 3% that of proCPR+/+ mice. It remains to be determined whether sera of mice harboring the mutant proCPR gene deficient in exons 4 and 5 could retain a slight amount of CPR activity. Although it was reported that CPN is stable at 37°C for at least 25 min (6, 19), murine CPN activity might have been impaired during the 1-h incubation at 37°C performed to inactivate CPR completely. If this were the case, CPN activity in fresh serum of proCPR–/– mice would be slightly higher than that in serum incubated for 1 h at 37°C.
Thrombin-activatable fibrinolysis inhibitor (proCPR)-deficient mice generated from 129/Sv and C57BL/6 (25) were reported to have delivered the Mendelian ratio with the heterozygote (+/–) intercross. However, although the proCPR-deficient mice produced here developed normally, the genomic ratios of F3 and F4 offspring of proCPR+/– intercrosses were not in accordance with Mendel’s laws. Disaccordances for F3 and F4 offspring were p < 0.001 and p < 0.00001 using the 
2 goodness-of-fit test. The proCPR-deficient mice used in this study have a background of 120/Ola, C57BL/6, and BALB/c. Therefore, the BALB/c background might be related to the suppressed number of proCPR–/– offspring. ProCPR might have a role in protecting the fetus in early ontogeny from some stress affecting mice with a BALB/c background.
Some cuboidal transformation of epithelial cells lining Bowman’s capsules is normally seen in kidneys of mice (26) and humans (27), but in the present study, the incidence of this was significantly higher as seen from the increased number of affected glomeruli in the proCPR–/– mice compared with the control mice. It could be hypothesized that these cuboidal epithelial cells might aid in some active transport process such as reabsorption of protein (28), but the pathological significance of this change is not well understood. These cuboidal cells were similar to those of proximal convoluted tubules, and might therefore be a metaplasia of Bowman’s parietal epithelium (29). In contrast, this epithelial morphology had some resemblance to fetal glomerular structure, and it is possible that a disturbance in histological differentiation was induced in the proCPR–/– mice. Because the mice of 129 background could have certain abnormalities, further analysis is remaining to determine whether the morphological abnormality in the kidney could be a direct consequence of the gene targeting, and whether the morphological abnormality might induce functional disturbance.
ProCPR has been established as an acute phase protein (12, 13) because of the up-regulation of mouse proCPR mRNA expression in the liver and proCPR protein in plasma after LPS injection. Therefore, proCPR-deficient mice might be more sensitive to LPS-induced inflammation. When we injected a sublethal dose of LPS into proCPR+/– and proCPR–/– mice, the survival rate was not different from that of proCPR+/+ mice. This indicated that LPS could induce cascades of inflammation independent of C5a and other inflammatory peptides which could be inactivated by CPR.
In a rat model, i.v. administration of mAb against Crry, a membrane inhibitor of C, induced lethal shock following LPS sensitization (22), although the mAb alone did not induce this serious outcome (30). This phenomenon might involve the increased expression of C5aR by LPS (18, 21, 31, 32, 33). Therefore, we sensitized mice with 5 mg/kg LPS 6 h before i.v. administration of CVF (20), which activates the alternative complement pathway so completely as to exhaust the total amount of complement in vivo. In preliminary experiments, mice sensitized with the LPS preparation hardly survived administration of 200 U of CVF (to proCPR+/+ mice) and 100 U of CVF (to proCPR+/– mice), although 50 U of CVF killed all proCPR–/– mice sensitized with LPS. In mice pretreated with LPS, C5aR had been up-regulated and the extensive generation of C5a could overcome restriction by CPR in proCPR+/+ mice. Therefore, we used 30 U of CVF to compare the sensitivity in proCPR+/+, proCPR+/–, and proCPR–/– mice presensitized with LPS. We found that the injection of 30 U of CVF 6 h after i.v. injection of LPS induced lethality only in proCPR–/– mice but not in proCPR+/+ or proCPR+/– mice. This result suggests that CPR generated from proCPR in vivo plays a role in regulation of excessive inflammation due to inflammatory peptides such as C5a anaphylatoxin generated by C activation, which could be inactivated by CPR.
The presence of inflammatory peptides such as C5a in the serum of proCPR–/– mice was demonstrated in the guinea pig skin by means of Evans blue exudation (34), and the exudation was strongly enhanced by preincubation of the serum with zymosan A that has a capacity to activate C. In contrast, exudation was not observed with the serum of proCPR+/+ and proCPR+/– mice, even after treatment with zymosan A. This evidence indicates that CPR efficiently inactivates inflammatory peptides such as C5a in serum, and the absence of the enzyme delayed the inactivation although the deficient mouse serum contained CPN. This phenomenon could be explained by the finding that C5a octapeptide was efficiently inactivated by CPR but not by CPN (14).
|
Acknowledgments |
|---|
|
Footnotes |
|---|
1 This work was supported in part by a grant for Research on Specific Diseases of the Ministry of Health, Labour, and Welfare, Japan. 
2 Address correspondence and reprint requests to Dr. Noriko Okada, Department of Biodefense, Graduate School of Medical Sciences, Nagoya City University, Mizuho-cho, Mizuho-ku, Nagoya 467-8601, Japan. E-mail address: drnoriko{at}med.nagoya-cu.ac.jp
3 Abbreviations used in this paper: CP, carboxypeptidase; proCPR, procarboxypeptidase R; neo, neomycin; ES, embryonic stem; CVF, cobra venom factor; T-TM, thrombin and thrombomodulin complex; PGK, phosphoglycerate kinase.
Received for publication January 28, 2004. Accepted for publication July 13, 2004.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and -
augment pulmonary artery transendothelial albumin flux in vitro. Am. J. Physiol. 263:L128.
This article has been cited by other articles:
|
|
 |
|
  M. E. Meltzer, C. J.M. Doggen, P. G. de Groot, J. C.M. Meijers, F. R. Rosendaal, and T. Lisman Low thrombin activatable fibrinolysis inhibitor activity levels are associated with an increased risk of a first myocardial infarction in men Haematologica, June 1, 2009; 94(6): 811 - 818. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. L. Mueller-Ortiz, D. Wang, J. E. Morales, L. Li, J.-Y. Chang, and R. A. Wetsel Targeted Disruption of the Gene Encoding the Murine Small Subunit of Carboxypeptidase N (CPN1) Causes Susceptibility to C5a Anaphylatoxin-Mediated Shock J. Immunol., May 15, 2009; 182(10): 6533 - 6539. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. B. Boffa, D. Maret, J. D. Hamill, N. Bastajian, P. Crainich, N. S. Jenny, Z. Tang, E. M. Macy, R. P. Tracy, R. F. Franco, et al. Effect of single nucleotide polymorphisms on expression of the gene encoding thrombin-activatable fibrinolysis inhibitor: a functional analysis Blood, January 1, 2008; 111(1): 183 - 189. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. O. Mosnier, X. V. Yang, and J. H. Griffin Activated Protein C Mutant with Minimal Anticoagulant Activity, Normal Cytoprotective Activity, and Preservation of Thrombin Activable Fibrinolysis Inhibitor-dependent Cytoprotective Functions J. Biol. Chem., November 9, 2007; 282(45): 33022 - 33033. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. M. Ravindranath, M. Goto, O. Iqbal, M. Florian-Kujawski, D. Hoppensteadt, R. Hammadeh, M. M. Sayeed, and J. Fareed Plasma Thrombin Activatable Fibrinolysis Inhibitor and Tissue Factor Pathway Inhibitor Changes Following Sepsis Clinical and Applied Thrombosis/Hemostasis, October 1, 2007; 13(4): 362 - 368. [Abstract] [PDF]
|
|
|
|
|
|
T. Nishimura, T. Myles, A. M. Piliposky, P. N. Kao, G. J. Berry, and L. L. K. Leung Thrombin-activatable procarboxypeptidase B regulates activated complement C5a in vivo Blood, March 1, 2007; 109(5): 1992 - 1997. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Renckens, J. J. T. H. Roelofs, S. A. J. ter Horst, C. van 't Veer, S. R. Havik, S. Florquin, G. T. M. Wagenaar, J. C. M. Meijers, and T. van der Poll Absence of Thrombin-Activatable Fibrinolysis Inhibitor Protects against Sepsis-Induced Liver Injury in Mice J. Immunol., November 15, 2005; 175(10): 6764 - 6771. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
).