The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by He, B.
Right arrow Articles by Cerutti, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by He, B.
Right arrow Articles by Cerutti, A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CHLOROQUINE
The Journal of Immunology, 2004, 173: 4479-4491.
Copyright © 2004 by The American Association of Immunologists

CpG DNA Induces IgG Class Switch DNA Recombination by Activating Human B Cells through an Innate Pathway That Requires TLR9 and Cooperates with IL-101

Bing He*, Xugang Qiao* and Andrea Cerutti2,*,{dagger}

* Department of Pathology, Weill Medical College, and {dagger} Immunology Graduate Program, Weill Graduate School of Medical Sciences, Cornell University, New York, NY 10021


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TLRs are pattern recognition receptors that initiate innate immune responses. TLR9 detects microbial DNA with hypomethylated CpG motifs and in humans is preferentially expressed by IFN-{alpha}-producing plasmacytoid dendritic cells and B cells. In addition to favoring IFN-{alpha} release, TLR9 signals B cell activation, proliferation, and IgM production. Recent findings suggest that CpG DNA-TLR9 interaction plays a key role in systemic lupus erythematosus and rheumatoid arthritis, two autoimmune disorders characterized by dysregulated production of DNA-reactive IgG. We show that CpG DNA initiates germline C{gamma}1, C{gamma}2, and C{gamma}3 gene transcription by activating B cells through a TLR9-mediated NF-{kappa}B-Rel-dependent innate pathway that cooperates with IL-10 through STAT proteins and IFN-responsive factors. This pathway is inhibited by chloroquine, a drug that attenuates the clinical manifestations of IgG-mediated autoimmune disorders. Germline C{gamma} gene transcription is associated with up-regulation of activation-induced cytidine deaminase, a key element of the B cell class switch-inducing machinery, and is followed by class switch DNA recombination from Cµ to C{gamma}1, C{gamma}2, and C{gamma}3. Subsequent IgG production requires additional signals from BCR and a B cell-activating factor of the TNF family (BAFF), produced by dendritic cells upon exposure to IFN-{alpha}. Our findings suggest that CpG DNA-TLR9 interaction may be important to initiate or amplify early T cell-independent IgG responses against pathogens. This implies that CpG DNA released during infections may exacerbate autoimmunity by stimulating autoreactive B cells to switch from an IgM to a more pathogenic IgG isotype.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
By substituting the Ig CH region of IgM and IgD with that of IgG, IgA, or IgE, class switching endows Abs with new effector functions that enhance the clearance of invading pathogens (1). Germinal center B cells undergo IgH class switching through class switch DNA recombination (CSR), 3 a process that promotes recombination of the switch region µ(Sµ) 5' of the Cµ gene with a targeted downstream S{gamma}, S{alpha}, or S{epsilon} region 5' of C{gamma}, C{alpha}, and C{epsilon}, respectively (2, 3). Complex microbial proteins initiate CSR by up-regulating the TNF family member CD40L on CD4+ T cells (1). Engagement of CD40 on B cells by CD40L activates NF-{kappa}B-Rel (4), which initiates germline IH-S-CH transcription by binding cis-acting {kappa}B elements within intronic IH promoters 5' of S regions (1). Germline transcription is further enhanced by T cell-derived IL-4 through STAT6, which binds a IFN-{gamma}-activated sequence (GAS) adjacent to {kappa}B sites (1). By inducing chromatin opening, germline transcription facilitates the recruitment of activation-induced cytidine deaminase (AID), an enzyme that initiates CSR by introducing DNA breaks within S regions (5). Subsequent looping-out deletion of the DNA between the two recombined S regions juxtaposes the somatically recombined VHDJH exon, which encodes the Ag-binding Ig VH region, to a new CH gene (3).

In addition to inducing CSR, T cell-dependent (TD) Ags stimulate germinal center B cells to undergo V(D)J gene somatic hypermutation, a process that increases the affinity of Abs for Ag (2, 5). Although generating high affinity Ig-secreting plasma cells and long-lived memory B cells (6), TD B cell responses require 5–7 days, which is too much of a delay to neutralize quickly replicating pathogens. To compensate for this limitation, marginal zone B cells and mucosal B-1 cells rapidly undergo T cell-independent (TI) Ab production in response to highly conserved microbial Ags with repetitive structure (7, 8). These compounds include type 1 TI Ags, such as bacterial wall LPS, and type 2 TI Ags, such as bacterial capsule polysaccharides (9). Both TI-1 and TI-2 Ags encompass pathogen-associated molecular patterns (PAMPs) (10), which stimulate marginal zone and B-1 cells by cross-linking poorly diversified surface BCRs encoded by a restricted set of V(D)J genes carrying no or few mutations (11). TI Ab production also requires interaction of B cells with dendritic cells (DCs) and macrophages (8, 12). These innate immune cells recognize PAMPs through pattern recognition receptors, including TLR family members (13).

In addition to triggering immediate innate responses (10), PAMP-TLR interaction favors TI B cell Ab production. For instance, engagement of TLR4 by LPS stimulates myeloid DCs to up-regulate B cell-activating factor of the TNF family (BAFF) (10, 14), which cooperates with signals emanating from BCR to stimulate B cell survival, CSR, and Ab production (15, 16, 17). Myeloid DCs also up-regulate BAFF upon exposure to IFN-{alpha} (16), a key innate cytokine released by circulating plasmacytoid DCs upon TLR9 engagement by microbial products, including DNA with unmethylated CpG motifs (18, 19, 20, 21). Unlike TLR4, which is expressed on the cell surface (10), TLR9 is expressed in the endoplasmic reticulum and signals from an endosomal compartment upon CpG DNA internalization (22, 23). Not only do PAMPs stimulate B cells through BAFF, but they also directly activate B cells via TLRs. This is exemplified by LPS, which triggers mouse B cell CSR and Ab production by engaging TLR4 (1, 10). Human B cells lack TLR4, but express TLR9, and undergo proliferation and IgM production in response to CpG DNA (24, 25). The role of CpG DNA in human B cell CSR remains elusive.

Unmethylated microbial CpG DNA is similar to certain CpG DNA islands within the mammalian genome (22, 26, 27). Hypomethylated genomic CpG DNA is increased in subjects with systemic lupus erythematosus (SLE) and rheumatoid arthritis (RA) (28), two autoimmune disorders characterized by abnormal B cell reactivity to a relatively restricted set of self-Ags, including DNA and DNA-bound proteins (29, 30, 31). Recent studies suggest that dual TLR9 and BCR engagement by endogenous CpG DNA released from dying cells and CpG DNA-IgG complexes stimulates autoreactive B cells to produce DNA-reactive IgM and IgM rheumatoid factors (RFs), which recognize DNA-bound IgG (32, 33). Considering that anti-DNA IgG is usually more abundant than anti-DNA IgM and that RF-expressing B cells produce IgG in addition to IgM (29, 30), it is conceivable that CpG DNA stimulates autoreactive IgG CSR in addition to IgM production.

CD40L and BAFF induce CSR through p50, p52, p65, c-Rel, and RelB (1, 16). These NF-{kappa}B-Rel proteins are retained in a cytoplasmic inactive form by I{kappa}B{alpha}, an inhibitor of NF-{kappa}B (34, 35). By recruiting TNF receptor-associated factors (TRAFs) to their receptors, CD40L and, to a lesser extent, BAFF activate I{kappa}B kinase {beta} (IKK{beta}) (4, 17), which is part of an IKK complex that includes two catalytic {alpha} and {beta} subunits and a regulatory {gamma} subunit (34, 35). Phosphorylation of I{kappa}B{alpha} by IKK{beta} is followed by I{kappa}B{alpha} degradation and p50, p65, and c-Rel nuclear translocation (34, 35). CD40L and, to a greater extent, BAFF also activate IKK{alpha} through NF-{kappa}B-inducing kinase (NIK) (34, 35). Phosphorylation of p100 by IKK{alpha} is followed by p100 processing to p52, which then translocates to the nucleus in association with RelB (34, 35). Similarly to CD40 and BAFF receptors, TLRs activate p50, p52, p65, c-Rel, and RelB through NIK and IKK (10). These kinases are turned on upon recruitment of MyD88, IL-1R-associated kinases (IRAKs), and TRAF6 to a cytoplasmic TLR/IL-1R (TIR) domain (36, 37, 38). This prompted us to hypothesize that TLR9 signaling initiates IgG CSR through NF-{kappa}B-Rel.

We show that CpG-containing oligodeoxynucleotides (ODNs) and bacterial DNA initiate germline C{gamma} gene transcription in human B cells by turning on a TLR9 pathway that activates NF-{kappa}B-Rel, STATs, and IFN-responsive factors (IRFs) in cooperation with IL-10. CpG DNA-induced germline C{gamma} gene transcription is inhibited by chloroquine, a compound used to treat patients with SLE and RA (39), and ultimately leads to CSR from Cµto C{gamma}1, C{gamma}2, and C{gamma}3. Subsequent IgG production requires additional B cell stimulation through BCR engagement, BAFF, or CD40L.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cells and reagents

Peripheral blood IgD+IgM+ naive B cells were obtained as previously described (16). 2E2 B cells are characterized by high TLR9 expression levels and were obtained by subcloning CL-01, an IgD+IgM+ B cell line that undergoes CSR upon in vitro exposure to appropriate stimuli (40). CL-01 subclones were obtained by limiting dilution and tested for TLR9 expression through semiquantitative RT-PCR. Purified phosphorothioate-modified ODNs (Operon Technologies, Alameda, CA; lowercase letters represent nuclease-resistant phosphorothioate linkage, uppercase letters represent phosphorodiester linkage 3' of the base, and underlined letters represent CpG dinucleotides), including 5'-tcgtcgttttgtcgttttgtcgtt-3' ODN-2006/type B CpG DNA and 5'-ggGGGACGATCGTCgggggg-3' ODN-2216/type-A CpG DNA, were used at 5 µg/ml. Control 5'-tgctgcttttgtgcttttgtgctt-3' GpC DNA and 5'-GCTTGATGACTCAGCCGGAA-3' non-CpG DNA (Operon Technologies) were used at 5 µg/ml. Escherichia coli DNA was purified by extraction with phenol/chloroform/isoamyl alcohol and ethanol precipitation, suspended in DNase-free distillated water, and used at 200 µg/ml. In some experiments E. coli DNA was digested with 50 µg/ml DNase I. Recombinant BAFF (Alexis Biochemicals, San Diego, CA), CD40L (Immunex, Seattle, WA), IL-2 (from Dr. K. A. Smith, Cornell University, New York, NY), IL-4 (Schering-Plough, Kenilworth, NJ), IL-10, IL-15, LPS (Sigma-Aldrich, St. Louis, MO), IL-6, and IL-13 (R&D Systems, Minneapolis, MN) were used at 500 ng/ml, 500 ng/ml, 50 U/ml, 200 U/ml, 200 ng/ml, 100 ng/ml, 1 µg/ml, 5 ng/ml, and 10 ng/ml, respectively, unless otherwise indicated. Immunobead reagent (Irvine Scientifics, Camarillo, CA), which binds both H and L chains of human Igs, was used at 2 µg/ml to mimic extensive BCR cross-linking by a TI Ag. Bafilomycin A and chloroquine (Sigma-Aldrich) were used at 10 nM and 20 ng/ml, respectively.

Flow cytometry and ELISAs

B cell surface CD19 and IgG were labeled with FITC- and PE-conjugated Abs (BD Pharmingen, San Diego, CA). Cells (104) were acquired using a FACSCalibur analyzer. IgG ELISA was performed as previously described (16, 40).

RT-PCRs

cDNA was reverse transcribed from 3 µg of total RNA. TLR9 was RT-PCR amplified for 25 cycles using forward primer 5'-ACAACAACATCCACAGCCAAGTGTC-3' and reverse primer 5'-AAGGCCAGGTAATTGTCACGGAG-3'. I{gamma}1-C{gamma}1 (603 bp), I{gamma}2-C{gamma}2 (597 bp), I{gamma}3-C{gamma}3 (670 bp), I{gamma}4-C{gamma}4 (411 bp), I{epsilon}-C{epsilon} (409 bp), Iµ-Cµ (537 bp), I{gamma}1/2-Cµ (557 bp), I{gamma}3-Cµ (608 bp), AID (382 bp), and {beta}-actin (593 bp) transcripts were amplified for 25 cycles as previously described (16).

Genomic DNA PCRs

Genomic DNA was extracted by using the QIAmp DNA Mini Kit (Qiagen, Valencia, CA). Total S{gamma}-Sµ switch circles and {beta}-actin were amplified from 500 ng of genomic DNA as previously described (16). The conditions were denaturation 1 min at 94°C, annealing 1 min at 68°C, and extension 4 min at 72°C for two rounds of 30 cycles each. Before each PCR, DNA was denatured for 5 min at 94°C. The identity of PCR products with switch circles was confirmed by DNA sequencing.

Southern blots

PCR products were fractionated onto agarose gels, transferred overnight to nylon membranes, and hybridized with radiolabeled probes as described. Switch circles were hybridized with a probe recognizing the recombined Sµ region (16). I{gamma}-Cµ transcripts were hybridized with a probe encompassing nt 1–250 of the first Cµ exon. I{gamma}-C{gamma} transcripts were hybridized with a 5'-CAGGGGGAAGACCGATGG-3' oligoprobe recognizing a consensus C{gamma} sequence. Finally, I{epsilon}-C{epsilon} transcripts were hybridized with a 5'-TCCACACAGAGCCCATC-3' oligoprobe recognizing C{epsilon}.

Plasmids

Genomic DNA fragments encompassing I{gamma}1, I{gamma}2, I{gamma}3, I{gamma}4, and I{epsilon} promoters were inserted into a promoterless pGL3-Basic luciferase (Luc) reporter vector (Promega, Madison, WI) as previously reported (40, 41, 42). {kappa}B1–, {kappa}B2–, IFN-stimulated responsive element (ISRE)-{kappa}B3–, B cell-specific activating protein-binding site (BSAP–), and GAS– I{gamma}3 mutants were generated through a PCR-based strategy that disrupts the targeted motif by replacing six nucleotides of the wild-type sequence with a SacI restriction site (40). Briefly, 5' and 3' DNA fragments were amplified using appropriate primers with 5' overhangs containing KpnI (sense)/SacI (antisense) and SacI (sense)/BglII (antisense) sites, respectively. Then, DNA fragments were digested with KpnI/SacI, and SacI/BglII, respectively, and cloned into the KpnI/BglII-digested pGL3-Basic vector. Reporter vectors driven by two {kappa}B sites from the Ig{kappa} gene (from Dr. H.-C. Liou, Cornell University, New York, NY), three GAS sites from the Ly-6/E gene (from Dr. J. J. Zhang, Cornell University), four GAS sites from the CD23b gene (from Dr. J. J. Zhang), and ISRE sites from the ISG15 gene (from Dr. K. Horvath, Mount Sinai Medical Center, New York, NY) are reported elsewhere (43, 44, 45). Expression vectors for TLR9, Toll-like interacting protein (InvivoGen, San Diego, CA), dominant negative (DN)-I{kappa}B{alpha} (S32/36A; from Dr. E. Cesarman, Cornell University), DN-MyD88 (residues 152–296), DN-IRAK1 (residues 1–208; Tularik, San Francisco, CA), DN-TRAF2 (residues 248–501), DN-TRAF6 (residues 301–530; ScienceReagents, El Cajon, CA), DN-IKK{alpha} (K44M), DN-IKK{beta} (K49A), DN-NIK (K429/430A; from Dr. J.-D. Li, University of South California, Los Angeles, CA), DN-STAT1 (Tyr701F), DN-STAT3 (Y705F; from Drs. J. E. Darnell, Jr., and J. Bromberg, Rockefeller University, New York, NY), and DN-IRF4 (residues 1–150; from Dr. A. B. Pernis, Columbia University) were described previously (18, 20, 36, 44, 46, 47, 48). {Delta}TIR-TLR9 (residues 1–870) was PCR-amplified from a TLR9 plasmid (InvivoGen) using forward primer 5'-GGGGATATCTACTAGATTTATCAAAAAGAG-3' and reverse primer 5'-GGGGCTAGCTAGGGCAGGGCATCCTCATC-3'.

Luciferase reporter assays

2E2 B cells (20 x 106/ml) were transfected with 40 µl of plasmid DNA-TE solution containing 10 µg of I{gamma}-Luc, I{epsilon}-Luc, ISRE-Luc, or STAT-Luc plasmid expressing firefly luciferase and 200 ng of control pRL-TK plasmid expressing Renilla luciferase under control of the thymidine kinase promoter (Promega). Similar transfections were performed in the presence or the absence of 10 µg of empty expression plasmid or 10 µg of DN-MyD88, DN-IRAK1, DN-TRAF6, DN-TRAF2, Toll-interacting protein (TOLLIP), I{kappa}B{alpha}, DN-IKK{alpha}, DN-IKK{beta}, DN-NIK, DN-STAT1, DN-STAT3, or DN-IRF4 expression plasmid. Electroporations were performed at 625 V/cm and 950 µF using a Gene Pulser II apparatus (Bio-Rad, Hercules, CA). After electroporation, B cells were resuspended in complete medium (2 x 106/ml), split into aliquots, and cultured with or without stimuli. After 48 h, firefly and Renilla luciferase activities were measured using the dual luciferase assay system (Promega) to assess promoter activity and transfection efficiency, respectively. Luciferase activity was expressed as relative light units normalized to a cotransfected pRL-TK control plasmid or as fold induction, i.e., normalized luciferase activity of extracts from stimulated B cells/normalized luciferase activity of extracts from unstimulated B cells.

Immunoblots

Equal amounts of total, cytoplasmic, or nuclear proteins (10 µg) were fractionated onto a 10% SDS-polyacrylamide gel and transferred to nylon membranes (Bio-Rad). After blocking, membranes were probed with primary Abs to TLR9 (InvivoGen), p50, p52, p65, c-Rel, RelB, I{kappa}B{alpha}, STAT1, STAT2, STAT3, STAT6, IRF1, IRF9, actin, Oct1 (Santa Cruz Biotechnologies, Santa Cruz, CA), IRF4 (from Dr. A. B. Pernis, Columbia University, New York, NY), (Ser32p/Ser36p)-I{kappa}B{alpha}, (Tyr701p)-STAT1, (Tyr705p)-STAT3, (Tyr641p)-STAT6 (Cell Signaling Technology, Beverly, MA), or (Tyr689p)-STAT2 (Upstate Biotechnology, Lake Placid, NY). Membranes were then washed and incubated with an appropriate secondary Ab (Santa Cruz Biotechnology). Proteins were detected with an ECL detection system (Amersham Biosciences, Little Chalfont, U.K.).

EMSAs

Nuclear proteins were extracted from 5 x 106 cells (40). Double-stranded oligonucleotide probes (consensus sequences are underlined or, when partially overlapping, underlined and in bold) encompassing {kappa}B2 cis-I{gamma}3 (residues –216 to –192, 5'-CCTCTGACACAGAAACCACCAGAAG-3'), ISRE-{kappa}B3 cis-I{gamma}3 (residues –198 to –176, 5'-CCAGAAGAAAAGGGAACTTCAGG-3') and GAS cis-I{gamma}3 (residues –96 to –69, 5'-GAGCTGTGATTTCCTAGGAAGACAAA-3') sites were end-labeled with [{gamma}-32P]ATP by T4 kinase and used at ~20,000 cpm in each EMSA reaction. A control Oct1-binding oligonucleotide (TGTCGAATGCAAATCACTAGAA; Santa Cruz Biotechnologies) was labeled in a similar fashion. Reaction samples were prepared as described, incubated at room temperature for 15 min, and electrophoresed through a 6% nondenaturing polyacrylamide gel. The compositions of DNA-bound protein complexes were determined by incubating reaction mixtures with 1 µl of a DNA-binding inhibiting/supershifting Ab to p65, c-Rel, Rel-B, p50, p52, STAT1, STAT2, STAT3, STAT6, IRF1, IRF9 (Santa Cruz Biotechnology), or IRF4 (from Dr. A. B. Pernis) for 15 min at room temperature before adding the probe.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
B cells up-regulate TLR9 expression upon exposure to IL-10

IL-10 and IL-4 are two major CSR-inducing cytokines (1, 16). Recent studies indicate that CpG DNA cooperates with autocrine IL-10 to enhance IgG production in B cells (25, 49). Additional reports show that CpG DNA inhibits IgG and IgE production in B cells exposed to IL-4 (49, 50). These observations prompted us to verify whether TLR9 expression differs in B cells exposed to IL-10 or IL-4. Human IgD+IgM+ naive B cells up-regulated TLR9 transcripts and proteins as early as 1 h after incubation with IL-10 (Fig. 1A). This up-regulation peaked after 48 h and progressively increased upon B cell exposure to growing amounts of IL-10 (Fig. 1B). Conversely, naive B cells down-regulated TLR9transcripts and proteins as early as 1 h after exposure to IL-4. This down-regulation was more evident after 48 h and progressively increased upon B cell exposure to growing amounts of IL-4. Thus, IL-10 and IL-4 may control B cell responses to CpG DNA by up- and down-modulating TLR9 expression, respectively.



View larger version (62K):
[in this window]
[in a new window]
  		FIGURE 1. IL-10 up-regulates TLR9 expression in human B cells. A, TLR9 and actin (loading control) transcripts and proteins in naive B cells incubated with IL-10 or IL-4 for different time points. Transcripts were RT-PCR amplified for 30 cycles. B, TLR9 and {beta}-actin transcripts in naive B cells incubated with different doses of IL-10 or IL-4 for 2 days. Transcripts were RT-PCR amplified for 25 cycles. Data in A and B depict one of three experiments yielding similar results.

 
CpG DNA up-regulates germline C{gamma}1, C{gamma}1, and C{gamma}3 transcription in B cells by cooperating with IL-10

CSR from Cµ to a targeted downstream CH gene is preceded by germline IH-CH transcription (1). This early CSR event requires activation of the IH promoter 5' of the targeted CH gene and yields a germline IH-CH transcript encompassing a noncoding IH exon (3). To verify whether CpG DNA initiates germline I{gamma}-C{gamma} and I{epsilon}-C{epsilon} gene transcription, primary IgD+IgM+ naive B cells or IgD+IgM+ 2E2 B cells, a subclone of the CL-01 B cell line (40), were incubated for 48 h with a CpG DNA-containing ODN (ODN-2006). Cultures were conducted in the presence or the absence of IL-10, which facilitates switching to IgG1, IgG2, and IgG3, and with or without IL-4, which favors switching to IgG1, IgG2, IgG3, IgG4, and IgE (1, 51). When exposed to CpG ODN-2006, naive B cells up-regulated germline I{gamma}1-C{gamma}1, I{gamma}2-C{gamma}2, and I{gamma}3-C{gamma}3, but not I{gamma}4-C{gamma}4 and I{epsilon}-C{epsilon} transcripts (Fig. 2), whereas 2E2 B cells activated I{gamma}1, I{gamma}2, and I{gamma}3, but not I{gamma}4 and I{epsilon} promoters (Fig. 3). The combination of CpG ODN-2006 and IL-10 up-regulated I{gamma}1-C{gamma}1, I{gamma}2-C{gamma}2, and I{gamma}3-C{gamma}3 and activated I{gamma}1, I{gamma}2, and I{gamma}3 more effectively than CpG ODN-2006 or IL-10 alone. Control GpC ODN-2006 with inverted CpG motifs did not up-regulate I{gamma}1-C{gamma}1, I{gamma}2-C{gamma}2, and I{gamma}3-C{gamma}3, nor did it enhance the IL-10-induced up-regulation of I{gamma}1-C{gamma}1, I{gamma}2-C{gamma}2, and I{gamma}3-C{gamma}3. Similarly, GpC ODN-2006 did not activate I{gamma}1, I{gamma}2, and I{gamma}3 or enhance IL-10-mediated activation of I{gamma}1, I{gamma}2, and I{gamma}3.



View larger version (66K):
[in this window]
[in a new window]
  		FIGURE 2. CpG DNA cooperates with IL-10 to up-regulate germline I{gamma}1-C{gamma}1, I{gamma}2-C{gamma}2, and I{gamma}3-C{gamma}3 transcripts in human B cells. Germline I{gamma}1-C{gamma}1, I{gamma}2-C{gamma}2, I{gamma}3-C{gamma}3, I{gamma}4-C{gamma}4, I{epsilon}-C{epsilon}, and Iµ-Cµtranscripts in naive B cells cultured with or without CpG DNA ODN-2006, GpC ODN-2006, IL-10, and/or IL-4 for 2 days. Data depict one of three experiments yielding similar results.

 


View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 3. CpG DNA cooperates with IL-10 to induce germline C{gamma}1, C{gamma}2, and C{gamma}3 gene transcription in human B cells. Induction of I{gamma}1-Luc, I{gamma}2-Luc, I{gamma}3-Luc, I{gamma}4-Luc, and I{epsilon}-Luc in 2E2 B cells cultured with or without CpG DNA ODN-2006, GpC ODN-2006, IL-10, and/or IL-4 for 2 days. Data correspond to one of three experiments yielding similar results (bars represent the SD of triplicate determinations).

 
Unlike IL-10, IL-4 up-regulated I{gamma}1-C{gamma}1, I{gamma}2-C{gamma}2, I{gamma}3-C{gamma}3, I{gamma}4-C{gamma}4, and I{epsilon}-C{epsilon} transcripts and activated I{gamma}1, I{gamma}2, I{gamma}3, I{gamma}4, and I{epsilon} promoters. These effects were attenuated by CpG ODN-2006, but not by GpC ODN-2006, suggesting that CpG DNA cooperate with some, but not all, cytokines to initiate CSR. Consistent with this, CpG ODN-2006 did not activate I{gamma}3 when combined with IL-2, IL-6, IL-12, IL-13, or IL-15 (Fig. 4A). The I{gamma}3-inducing activity of type B CpG ODN-2006 was comparable with that of CD40L, but was higher than that of type A CpG ODN-2216, and extended to bacterial CpG DNA. In addition to inducing I{gamma}3, bacterial DNA activated NF-{kappa}B-Rel, which is crucial for initiation of germline C{gamma} gene transcription (1). These effects were specific, because a non-CpG oligo, GpC ODN-2006, DNase I-treated bacterial DNA, and LPS did not activate NF-{kappa}B-Rel and I{gamma}3 (Fig. 4B). Our findings indicate that CpG DNA preferentially cooperates with IL-10 to activate B cells and initiate germline C{gamma}1, C{gamma}2, and C{gamma}3 transcription. They also suggest that CpG DNA inhibits IL-4-induced C{gamma} and C{epsilon} transcription.



View larger version (21K):
[in this window]
[in a new window]
  		FIGURE 4. CpG DNA induces germline C{gamma}3 gene transcription and NF-{kappa}B-Rel activation in human B cells through a highly specific mechanism. A, Induction of I{gamma}3-Luc in 2E2 B cells cultured with or without CpG DNA ODN-2006, IL-2, IL-6, IL-10, IL-12, IL-13, and IL-15 for 2 days. B, Induction of I{gamma}3-Luc and {kappa}B-Luc in 2E2 B cells cultured with or without non-CpG DNA, GpC ODN-2006, CpG ODN-2216, CpG ODN-2006, bacterial DNA, DNase I-treated bacterial DNA, LPS, or htCD40L for 2 days. Data correspond to one of three experiments yielding similar results (bars represent the SD of triplicate determinations).

 
CpG DNA and IL-10 up-regulate AID and induce CSR from Cµ to C{gamma}1, C{gamma}2, and C{gamma}3 in B cells

Additional experiments verified whether CpG DNA triggers IgG CSR in B cells. CSR requires AID and generates a circular DNA upon looping-out deletion of the IgH locus lying between Sµ and the targeted downstream S region, such as S{gamma} (Fig. 5A). The resulting S{gamma}-Sµ switch circle transcribes a chimeric I{gamma}-Cµ circle transcript, which includes the I{gamma} promoter 5' of the targeted C{gamma} gene, a noncoding I{gamma} exon, and the Cµ exon. Both switch circles and circle transcripts constitute specific markers of ongoing CSR (5). Naive B cells exposed to IL-10 and/or control GpC ODN-2006 for 4 days did not contain S{gamma}-Sµ switch circles (Fig. 5B), a byproduct of IgG CSR, nor did they express I{gamma}1/2-Cµ and I{gamma}3-Cµ circle transcripts, a byproduct of IgG1/IgG2 CSR and IgG3 CSR, respectively. Similarly treated B cells lacked AID transcripts. In contrast, naive B cells induced S{gamma}-Sµ, I{gamma}1/3-Cµ, I{gamma}3-Cµ, and AID upon exposure to CpG ODN-2006, and this induction further increased when CpG ODN-2006 was combined with IL-10. Conversely, IL-4 attenuated the expression of S{gamma}-Sµ, I{gamma}1/3-Cµ, I{gamma}3-Cµ, and AID in B cells exposed to CpG ODN-2006 (not shown). These findings indicate that CpG DNA triggers CSR to C{gamma}1, C{gamma}2, and C{gamma}3 by cooperating with IL-10.



View larger version (31K):
[in this window]
[in a new window]
  		FIGURE 5. CpG DNA cooperates with IL-10 to induce CSR from Cµ to C{gamma}1, C{gamma}2, and C{gamma}3 in human B cells. A, Diagram of CSR from Cµ to a downstream C{gamma} gene. Ovals indicate S regions; rectangles are VHDJH, IH and CH exons; V-shaped lines indicate splicing. B, S{gamma}-SµSCs, genomic {beta}-actin, I{gamma}1/2-Cµ2 and I{gamma}3-CµCTs, and AID and {beta}-actin transcripts in naive B cells cultured with or without CpG DNA ODN-2006, GpC ODN-2006, IL-10, and/or IL-4 for 4 days. C and D, Surface IgG expression and IgG secretion by naive B cells cultured with or without CpG DNA ODN-2006, GpC ODN-2006, IL-10, IL-4, anti-BCR, BAFF, and/or CD40L for 8 days. n.d., not determined. Data in B–D represent one of three independent experiments yielding similar results (bars represent the SD).

 
BCR engagement, BAFF, and CD40L enhance IgG production in B cells exposed to CpG DNA and IL-10

To verify whether CpG DNA up-regulates IgG production, naive B cells were exposed to CpG ODN-2006 and IL-10 in the presence or the absence of known CpG DNA-costimulating molecules, including anti-BCR and CD40L (24, 25, 49). Cultures also included BAFF, which is produced by myeloid DCs upon exposure to CpG DNA-induced cytokines, including IFN-{alpha} (16, 19). Naive B cells up-regulated surface IgG upon exposure to CpG ODN-2006 (but not GpC ODN-2006) and IL-10, anti-BCR, BAFF, or CD40L for 5 days (Fig. 5C). The proportion of IgG-expressing B cells further increased when CpG ODN-2006 was combined with either IL-10 and anti-BCR or IL-10 and BAFF, or IL-10 and CD40L. This increase was incremental over that induced by either IL-10 and anti-BCR or IL-10 and BAFF, or IL-10 and CD40L. Finally, CpG ODN-2006 and IL-10 elicited IgG secretion only in B cells concomitantly exposed to anti-BCR, BAFF, or CD40L for 8 days (Fig. 5D). This suggests that CpG DNA requires IL-10 as well as additional TI or TD stimuli, including BAFF or CD40L, to stimulate IgG production in Ag-activated B cells.

CpG DNA requires TLR9, MyD88, IRAK1, and TRAF6 to induce germline C{gamma}3 gene transcription

CD40 activates initiates NF-{kappa}B-Rel-dependent germline C{gamma} transcription by recruiting TRAFs, including TRAF2 and TRAF6 (47, 52). Because TLR9 activates NF-{kappa}B-Rel by recruiting MyD88, IRAK, and TRAF6 through a cytoplasmic TIR domain (10), it was hypothesized that the TLR9-MyD88-IRAK-TRAF6 axis is crucial for the initiation of IgG CSR by CpG DNA. Consistent with this, enforced expression of TIR-less TLR9 ({Delta}TIR-TLR9), DN-MyD88, DN-IRAK1, or TOLLIP, an adapter protein that negatively regulates TLR signaling (53), inhibited the activation of I{gamma}3-Luc in 2E2 B cells exposed to CpG ODN-2006 for 48 h (Fig. 6A). In these cells, {Delta}TIR-TLR9, DN-MyD88, DN-IRAK1, or TOLLIP inhibited NF-{kappa}B-Rel-dependent activation of a minimal {kappa}B-Luc reporter vector. As expected, DN-MyD88, DN-IRAK1, or TOLLIP did not inhibit activation of I{gamma}3-Luc and {kappa}B-Luc by CD40L. Furthermore, a DN form of TRAF2 attenuated activation of I{gamma}3-Luc and {kappa}B-Luc by CD40L, but not by CpG ODN-2006. Finally, a DN form of TRAF6 attenuated the activation of I{gamma}3-Luc and {kappa}B-Luc by either CpG ODN-2006 or CD40L. These findings suggest that CpG DNA activates I{gamma} promoters as well as NF-{kappa}B-Rel through an innate pathway that requires TLR9, MyD88, IRAK1, and TRAF6.



View larger version (22K):
[in this window]
[in a new window]
  		FIGURE 6. CpG DNA requires TLR9, MyD88, IRAK, and TRAF6 to activate the I{gamma}3 promoter in human B cells. A, Induction of I{gamma}3-Luc and {kappa}B-Luc in 2E2 B cells transfected with empty vector (control), {Delta}TIR-TLR9, DN-MyD88, DN-IRAK1, DN-TRAF6, DN-TRAF2, or TOLLIP and subsequently incubated with CpG DNA ODN-2006 or CD40L for 2 days. Data are presented as a percentage of the yield (fold activation with expression vector/fold activation without expression vector x 100). B, Induction of I{gamma}3-Luc and {kappa}B-Luc in 2E2 B cells incubated for 48 h with CpG DNA ODN-2006 or CD40L in the presence or the absence of control H2O, bafilomycin A (BFLM) or chloroquine (CHLQ). H2O, BFLM or CHLQ were added 6 h before CpG DNA ODN-2006 or CD40L. Data are presented as a percentage of the yield (fold activation with H2O, BFLM or CHLQ/fold activation without H2O, BFLM or CHLQ x 100). Data in A and B correspond to one of three experiments yielding similar results (bars represent the SD of triplicate determinations).

 
CpG DNA triggers germline C{gamma}3 gene transcription through a chloroquine-sensitive pathway

Innate immune cells internalize CpG DNA and initiate TLR9 signaling through a mechanism that requires endosomal maturation and acidification (23). Consistent with this, inhibitors of endosomal maturation and acidification, such as bafilomycin-A and chloroquine, attenuate cell activation by CpG DNA (32, 39). Chloroquine and its derivatives might also block CpG DNA signaling by preventing CpG DNA binding to as yet elusive surface receptors (22, 26). Bafilomycin-A and chloroquine attenuated the activation of both I{gamma}3-Luc and {kappa}B-Luc in 2E2 B cells exposed to CpG ODN-2006 (Fig. 6B). In contrast, bafilomycin-A and chloroquine did not affect the activation of I{gamma}3-Luc and {kappa}B-Luc in 2E2 B cells exposed to CD40L. These data suggest that CpG DNA activates I{gamma} promoters and NF-{kappa}B-Rel through a chloroquine-sensitive B cell pathway.

CpG DNA and IL-10 trans-activate the I{gamma}3 promoter through {kappa}B, ISRE, and GAS cis-acting elements

Germline C{gamma} gene transcription requires key cis-acting DNA regulatory elements located within the evolutionarily conserved sequence (ECS) of I{gamma} promoters (Fig. 7A). The human ECS includes three {kappa}B sites ({kappa}B1, {kappa}B2, and {kappa}B3), a BSAP, and a STAT-binding GAS (1, 40). CD40L-induced C{gamma} gene transcription involves binding of NF-{kappa}B-Rel and BSAP to {kappa}B1, {kappa}B2, and BSAP sites, whereas IL-4-induced C{gamma} gene transcription requires binding of STAT6 to the GAS site. This latter can bind STAT1, STAT2, STAT3, and IRF4 in addition to STAT6 (44, 46, 54, 55, 56). Interestingly, the ECS contains also an ISRE site, which partially overlaps with {kappa}B3 (ISRE-{kappa}B3) (40). In general, ISRE binds the STAT1-STAT2-IFR9 complex as well as IRFs, including IRF1 and IRF4 (44, 56). STATs and IRFs are induced by several receptors, including TLRs and IL-10Rs, and cooperate with NF-{kappa}B-Rel proteins to modulate B cell activation, differentiation, and IgG production (44, 46, 50, 54, 55, 56, 57, 58, 59). Thus, it was postulated that CpG DNA and IL-10 initiate C{gamma} transcription upon NF-{kappa}B-Rel, STAT, and IRF binding to cooperative {kappa}B, ISRE, and GAS cis-I{gamma} sites. To verify this, 2E2 B cells were transfected with reporter vectors carrying wild-type I{gamma}3 or mutated I{gamma}3 with targeted disruptions of {kappa}B1, {kappa}B2, ISRE-{kappa}B3, BSAP, and GAS (43). In 2E2 B cells incubated with medium alone, wild-type and mutated I{gamma}3 promoters displayed similar transcriptional activity (Fig. 7B). Disruption of {kappa}B1 or BSAP did not affect activation of I{gamma}3 by CpG ODN-2006 and/or IL-10. In contrast, disruption of {kappa}B2, {kappa}B3-ISRE, or GAS impaired activation of I{gamma}3 by CpG ODN-2006 and/or IL-10. These findings suggest that CpG DNA and IL-10 require {kappa}B2, {kappa}B3, ISRE, and GAS, but not {kappa}B1 and BSAP, cis-acting motifs to initiate germline C{gamma}3 transcription.



View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 7. CpG DNA and IL-10 require adjacent {kappa}B2, ISRE-{kappa}B3, and GAS cis-acting motifs to trans-activate the I{gamma}3 promoter in human B cells. A, Diagram of the I{gamma}3 promoter. Boxes depict cis-{kappa}B, ISRE, BSAP, and GAS motifs within the ECS. –239 and –65 residues span the ECS, and the turned arrow indicates the transcription initiation site. P{gamma}3 indicates the promoter sequence 5' of the noncoding I{gamma}3 exon. B, Transcriptional activity of wild-type (wt) I{gamma}3 or mutated {kappa}B1–, {kappa}B2–, ISRE-{kappa}B3–, BSAP–, and GAS– I{gamma}3 Luc constructs in 2E2 B cells cultured with or without CpG DNA ODN-2006 and/or IL-10 for 2 days. The luciferase activity of 2E2 cells incubated with medium alone (control) is expressed as relative luciferase units (RLU). Data correspond to one of three independent experiments (bars represent the SD of triplicate determinations).

 
CpG DNA and IL-10 activate NF-{kappa}B-Rel

Given the key role of {kappa}B2 and ISRE-{kappa}B3 in the activation of I{gamma}3 by CpG ODN-2006 and IL-10, it was postulated that CpG DNA and IL-10 synergistically induce C{gamma} gene transcription by cooperatively activating NF-{kappa}B-Rel. Initial experiments tested the induction of transcriptionally active NF-{kappa}B-Rel. 2E2 B cells activated a minimal {kappa}B-Luc reporter vector upon exposure to CpG ODN-2006, but not GpC ODN-2006, for 48 h (Figs. 3B and 8A). When combined, CpG ODN-2006 and IL-10 induced {kappa}B-Luc more than either CpG ODN-2006 or IL-10 alone (Fig. 8A). Additional studies evaluated NF-{kappa}B-Rel nuclear translocation. When exposed to CpG ODN-2006 for 3 h, naive B cells up-regulated I{kappa}B{alpha} phosphorylation and down-regulated total I{kappa}B{alpha}, a hallmark of increased I{kappa}B{alpha} degradation (Fig. 8B). After 6 h, CpG ODN-2006 up-regulated the expression of nuclear p65, p50, c-Rel, p52, and RelB (Fig. 8C). Also, IL-10 activated {kappa}B-Luc and up-regulated I{kappa}B{alpha} phosphorylation, I{kappa}B{alpha} degradation, and NF-{kappa}B-Rel nuclear translocation, although less than CpG ODN-2006. When combined, CpG ODN-2006 and IL-10 induced more I{kappa}B{alpha} phosphorylation, I{kappa}B{alpha} degradation, and NF-{kappa}B-Rel nuclear translocation than CpG ODN-2006 or IL-10 alone. Thus, CpG DNA and IL-10 cooperatively activate p65, p50, c-Rel, p52, and RelB in B cells.



View larger version (34K):
[in this window]
[in a new window]
  		FIGURE 8. CpG DNA and IL-10 induce transcriptionally active NF-{kappa}B-Rel and up-regulate NF-{kappa}B-Rel binding to {kappa}B2 cis-I{gamma}3 in human B cells. A, {kappa}B-Luc activity in 2E2 B cells incubated with or without CpG ODN-2006, IL-10, and/or IL-4 for 2 days. B and C, Cytoplasmic pI{kappa}B{alpha}, I{kappa}B{alpha}, and actin proteins as well as nuclear p65, p50, c-Rel, p52, and RelB proteins in naive B cells cultured as in A for 1 h. The ubiquitous nuclear protein octamer 1 (Oct1) was used as loading control. D, Aligned –232/–176 I{gamma}3, I{gamma}1, and I{gamma}2 DNA sequences. The boxed sequence corresponds to the {kappa}B2 cis-I{gamma}3 motif. Left gels show nuclear protein binding to an oligonucleotide encompassing {kappa}B2 cis-I{gamma}3 or a consensus Oct1-binding motif. Nuclear extracts were from naive B cells cultured for 6 h as described in A. Italic letters indicate protein-DNA complexes. Right gel shows protein-DNA complexes from naive B cells activated with CpG DNA after nuclear protein incubation with a cold {kappa}B2 cis-I{gamma}3 probe or Abs to p50, p52, p65, c-Rel, and RelB. Asterisks indicate lanes in which complexes are attenuated or supershifted by the Ab. Data in A–D correspond to one of three experiments yielding similar results (bars represent the SD of triplicate determinations).

 
IL-4 activated {kappa}B-Luc and up-regulated I{kappa}B{alpha} phosphorylation, I{kappa}B{alpha} degradation, and NF-{kappa}B-Rel nuclear translocation. Compared with IL-4 or CpG ODN-2006 alone, CpG ODN-2006 and IL-4 did not significantly increase {kappa}B-Luc activation, I{kappa}B{alpha} phosphorylation, I{kappa}B{alpha} degradation, or NF-{kappa}B-Rel nuclear translocation. These findings indicate that IL-4 does not cooperate with CpG DNA to activate NF-{kappa}B-Rel.

CpG DNA and IL-10 up-regulate NF-{kappa}B-Rel binding to {kappa}B2 and ISRE-{kappa}B3 cis-I{gamma}3

We next evaluated whether CpG DNA and IL-10 up-regulate the binding of nuclear NF-{kappa}B-Rel to {kappa}B2 cis-I{gamma}3. Naive B cells up-regulated the binding of complexes a, b, c, d, e, f, and g to {kappa}B2 cis-I{gamma}3 upon incubation with CpG ODN-2006 for 6 h (Fig. 8D). These complexes were attenuated or supershifted by preincubating nuclear proteins with Abs to p65, p50 and p65, p50 and c-Rel, p52 and RelB, p50 and RelB, p50 and p52, and p50, respectively. IL-10 up-regulated complexes a, b, c, d, e, f, and g to {kappa}B2 less than CpG ODN-2006, whereas CpG ODN-2006 and IL-10 up-regulated complexes a, b, c, d, e, f, and g more than CpG ODN-2006 or IL-10 alone. Additional experiments evaluated whether CpG DNA and IL-10 up-regulate the binding of nuclear NF-{kappa}B-Rel to ISRE-{kappa}B3 cis-I{gamma}3. Naive B cells up-regulated the binding of nuclear complexes a, b, and c to ISRE-{kappa}B3 cis-I{gamma}3 upon incubation with CpG ODN-2006 for 6 h (Fig. 9A). These complexes were attenuated or supershifted by Abs to p50, p52, p65, c-Rel, and RelB; p50, p56, and c-Rel; and p50, respectively (Fig. 9B). IL-10 up-regulated complexes a, b, and c less than CpG ODN-2006, whereas CpG ODN-2006 and IL-10 up-regulated complexes a, b, and c more than CpG ODN-2006 or IL-10 alone. Thus, CpG DNA cooperates with IL-10 to increase p50, p52, p65, c-Rel, and RelB binding to I{gamma}3.



View larger version (49K):
[in this window]
[in a new window]
  		FIGURE 9. CpG DNA and IL-10 up-regulate NF-{kappa}B-Rel, STAT, and IRF binding to ISRE-{kappa}B3 cis-I{gamma}3 in human B cells. A, Aligned –232/–176 I{gamma}3, I{gamma}1, and I{gamma}2 DNA sequences. The boxed sequence corresponds to the ISRE-{kappa}B3 motif. Gels show nuclear protein binding to a radiolabeled oligonucleotide encompassing ISRE-{kappa}B3 cis-I{gamma}3 or a consensus Oct1-binding motif (loading control). Nuclear extracts were from naive B cells cultured with or without CpG ODN-2006, IL-10, and/or IL-4 for 6 h. Italic letters indicate shifted protein-DNA complexes. B, ISRE-{kappa}B3 cis-I{gamma}3-binding protein-DNA complexes from naive B cells activated with CpG DNA after nuclear protein incubation with a cold probe or Abs to p50, p52, p65, c-Rel, and RelB. Asterisks indicate lanes in which complexes are attenuated or supershifted by the Ab. C, ISRE-{kappa}B3 cis-I{gamma}3-binding protein complexes from naive B cells activated with CpG DNA after nuclear protein incubation with a cold probe or Abs to STAT1, STAT2, STAT3, STAT6, IRF1, IRF4, or IRF9. Asterisks indicate lanes in which complexes are attenuated or supershifted by the Ab. Data in A–C correspond to one of three experiments yielding similar results.

 
IL-4 up-regulated the binding of complexes a, b, c, d, e, f, and g to {kappa}B2 (Fig. 8D) as well as the binding of complex c to ISRE-{kappa}B3, but did not affect the binding of complexes a and b to ISRE-{kappa}B3 (Fig. 9A). Compared with IL-4 or CpG ODN-2006 alone, CpG ODN-2006 and IL-4 attenuated the binding of complexes d and e to {kappa}B2, but did not affect or even increased the binding of complexes a, b, c, f, and g to {kappa}B2 as well as the binding of complexes a, b, and c to ISRE-{kappa}B3. Finally, CpG ODN-2006 and IL-4 up-regulated the binding of complexes a, b, c, d, and e to {kappa}B2 less efficiently than CpG ODN-2006 and IL-10. These findings suggest that IL-4 does not cooperate with IL-10 to up-regulate p50, p52, p65, c-Rel, and RelB binding to I{gamma}3.

CpG DNA and IL-10 activate STAT1, STAT3, IRF1, and IRF4

Considering the key role of ISRE-{kappa}B3 and GAS sites in I{gamma}3 transcription, it was hypothesized that CpG DNA and IL-10 synergistically activate the C{gamma}3 gene by cooperatively activating STATs and IRFs. Reporter vectors carrying multiple ISRE sites (ISRE-Luc), STAT1/3-binding GAS sites (STAT1/3-Luc), and STAT6-specific GAS sites (STAT6-Luc) were used to test the induction of transcriptionally active STATs and IRFs. 2E2 B cells activated ISRE-Luc, STAT1/3-Luc, and, to a lesser extent, STAT6-Luc upon exposure to CpG ODN-2006 or IL-10, but not GpC ODN2006, for 48 h (Fig. 10A). When combined, CpG ODN-2006 and IL-10 activated ISRE-Luc and STAT1/3-Luc more efficiently than CpG ODN-2006 or IL-10 alone. Although unable to significantly activate ISRE-Luc and STAT1/3-Luc, IL-4 activated STAT6-Luc more efficiently than CpG ODN-2006 and IL-10. This activation was attenuated by CpG ODN-2006, but not by GpC ODN-2006. These findings indicate that CpG DNA cooperates with IL-10, but not IL-4, to induce transcriptionally active STATs and IRFs. They also suggest that CpG DNA attenuates IL-4-induced, STAT6-dependent gene transcription.



View larger version (50K):
[in this window]
[in a new window]
  		FIGURE 10. CpG DNA and IL-10 induce transcriptionally active STAT1, STAT3, IRF1, and IRF4 in human B cells. A, Activation of ISRE-Luc, GAS-STAT1/3-Luc, or GAS-STAT6-Luc in 2E2 B cells incubated with or without with or without CpG ODN-2006, GpC ODN-2006, IL-10, and/or IL-4 for 2 days. B, Cytoplasmic pSTAT1 and total STAT1 (91- and 84-kDa isoforms), pSTAT2, total STAT2, pSTAT3, and total STAT3 (88- and 83-kDa isoforms), pSTAT6, and total STAT6 in naive B cells cultured with or without CpG ODN-2006, IL-10, and/or IL-4 for 1 h. Nuclear IRF1, IRF4, and IRF9 are also shown. NS, nonspecific band. Data in A and B correspond to one of three experiments yielding similar results.

 
STATs undergo nuclear translocation upon phosphorylation by Jaks (44), whereas IRFs undergo nuclear translocation upon phosphorylation by as yet elusive kinases, including IKK{epsilon} and TANK-binding kinase 1 (TBK1) (56, 59). Naive B cells up-regulated STAT1 and STAT3 phosphorylation and induced IRF1 and IRF4 nuclear translocation upon exposure to CpG ODN-2006 or IL-10 for 1 h (Fig. 10B). In contrast, CpG ODN-2006 or IL-10 did not affect STAT2 and STAT6 phosphorylation or IRF9 nuclear translocation. When combined with IL-10, CpG ODN-2006 elicited more STAT1 and STAT3 phosphorylation and more IRF1 and IRF4 nuclear translocation than CpG ODN-2006 or IL-10 alone. In addition to inducing IRF1 and IRF4 nuclear translocation, IL-4 elicited STAT2 and STAT6 phosphorylation. Notably, CpG ODN-2006 attenuated STAT6 (but not STAT2) phosphorylation and IRF4 (but not IRF1) nuclear translocation in B cells exposed to IL-4. Conversely, IL-4 attenuated STAT1 and STAT3 phosphorylation as well as IRF1 and IRF4 nuclear translocation in B cells exposed to CpG ODN-2006. Collectively, these findings indicate that CpG DNA cooperates with IL-10, but not IL-4, to activate STAT1, STAT3, IRF1, and IRF4 in B cells. They also suggest that CpG DNA interferes with the activation of STAT6 and IRF4 by IL-4.

CpG DNA and IL-10 up-regulate STAT1, STAT3, IRF1, and IRF4 binding to ISRE and GAS cis-I{gamma}3

Having shown that CpG DNA cooperates with IL-10 to increase the binding of NF-{kappa}B-Rel-containing complexes a and b to ISRE-{kappa}B3 cis-I{gamma}3 (Fig. 9, A and B), it was determined whether these complexes include IRFs and STATs (Fig. 10). Consistent with this, the binding of complexes a and b to ISRE-{kappa}B3 was attenuated by incubating nuclear proteins from CpG ODN-2006-stimulated B cells with Abs to STAT1, IRF1, and IRF4 (Fig. 9C). Further assays evaluated STAT and IRF binding to the GAS element of I{gamma}3. Naive B cells up-regulated the binding of complexes a, f, g, h, and i to GAS cis-I{gamma}3 upon exposure to CpG ODN-2006 for 6 h (Fig. 11A). These complexes were attenuated or supershifted by Abs to STAT1, STAT3, IRF1, and IRF4; STAT1, STAT3, and IRF1; STAT1, IRF1, and IRF4; STAT1 and IRF4; and IRF4, respectively (Fig. 11B). Finally, IL-10 alone or combined with CpG ODN-2006 induced more binding of complexes a, f, g, h, and i to GAS cis-I{gamma}3 than did CpG ODN-2006 alone. These findings indicate that CpG DNA and IL-10 cooperatively increase STAT and IRF binding to I{gamma}3.



View larger version (50K):
[in this window]
[in a new window]
  		FIGURE 11. CpG DNA and IL-10 up-regulate STAT and IRF binding to GAS cis-I{gamma}3 in human B cells. A, Aligned –93/–70 I{gamma}3, I{gamma}1 and I{gamma}2 DNA sequences. The boxed sequence corresponds to the GAS motif. Gel shows binding of nuclear proteins to a radiolabeled oligonucleotide encompassing GAS cis-I{gamma}3 or a consensus Oct1 motif (loading control). Nuclear proteins were from naive B cells incubated with or without CpG ODN-2006, IL-10, and/or IL-4 for 6 h. Italic letters indicate shifted protein-DNA complexes. B, GAS cis-I{gamma}3-binding protein-DNA complexes from naive B cells activated with CpG DNA after nuclear protein incubation with a cold probe or Abs to STAT1, STAT2, STAT3, STAT6, IRF1, IRF4, or IRF9. Asterisks indicate lanes in which complexes are attenuated or supershifted by the Ab. C, GAS cis-I{gamma}3-binding protein complexes from naive B cells activated with IL-4 after nuclear protein incubation with a cold probe or Abs to STAT1, STAT2, STAT3, STAT6, IRF1, IRF4, or IRF9. Asterisks indicate lanes in which complexes are attenuated or supershifted by the Ab. Data in A–C correspond to one of three experiments yielding similar results.

 
IL-4 up-regulated the binding of complexes b, c, d, e, and i, but not a, f, g, and h, to GAS cis-I{gamma}3 (Fig. 11A). Complexes b, c, d, e, and i were attenuated or supershifted by preincubating nuclear proteins with Abs to STAT6 and IRF4 (not shown), STAT6, STAT2 and STAT6, STAT2, and IRF4, respectively (Fig. 11C). Compared with IL-4 alone, IL-4 and CpG ODN-2006 induced less binding of complexes b, c, and i to GAS cis-I{gamma}3, whereas the binding of complexes d and e remained unchanged. Finally, CpG ODN-2006 and IL-4 induced less binding of complexes f, g, h, and i to GAS cis-I{gamma}3 than CpG ODN-2006 alone. Thus, CpG DNA impairs IL-4-induced binding of STAT6 and IRF4 to I{gamma}3; conversely, IL-4 prevents CpG DNA-induced STAT1, STAT3, IRF1, and IRF4 binding to I{gamma}3.

CpG DNA and IL-10 require NF-{kappa}B-Rel, STAT1, STAT3, and IRF4 to activate I{gamma}3

The involvement of NF-{kappa}B-Rel, STAT, and IRF proteins in CpG DNA-induced germline C{gamma} gene transcription was further evaluated in 2E2 B cells transfected with DN plasmids inhibiting the activation and/or DNA-binding activity of endogenous NF-{kappa}B-Rel, STAT1, STAT3, and IRF4. Enforced expression of DN-I{kappa}B{alpha}, DN-IKK{alpha}, DN-IKK{beta}, or, to a lesser extent, DN-NIK attenuated the activation of both I{gamma}3-Luc and {kappa}B-Luc in 2E2 B cells exposed to CpG ODN-2006 and IL-10 for 48 h (Fig. 12). In similar B cells, enforced expression of DN-STAT1, DN-IRF4, or, to a lesser extent, DN-STAT3 attenuated activation of I{gamma}3-Luc but not that of {kappa}B-Luc. These findings provide additional evidence that CpG DNA and IL-10 initiate IgG CSR by activating NF-{kappa}B-Rel, STAT, and IRF proteins.



View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 12. CpG DNA and IL-10 require NIK, IKK, STAT1, STAT3, and IRF4 to activate the I{gamma}3 promoter in human B cells. I{gamma}3-Luc and {kappa}B-Luc activities in 2E2 B cells transfected with an empty expression vector (control) or with DN-I{kappa}B{alpha}, DN-IKK{alpha}, DN-IKK{beta}, DN-NIK, DN-STAT1, DN-STAT3, and DN-IRF4 expression vectors and subsequently incubated with CpG DNA ODN-2006 and IL-10 for 2 days. Data are presented as a percentage of the yield (fold activation of B cells transfected with an expression vector/fold activation of B cells not transfected with an expression vector x 100). Data correspond to one of three independent experiments yielding similar results (bars represent the SD of triplicate determinations).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Marginal zone B cells and mucosal CD5+ B-1 cells generate a massive wave of extrafollicular Ab-producing plasmablasts in the initial 3 days of a primary Ab response through a mechanism that does not require T cell help (7). Although unable to induce affinity maturation and immune memory, early TI B cell responses lead to the production of IgM, IgG, and IgA, which play important roles in the initial control of infections by quickly replicating pathogens (7, 8). Previous evidence indicates that PAMPs initiate TI Ab responses by inducing extensive BCR cross-linking (9). Consistent with this, marginal zone and B-1 B cells recognize PAMPs through semiconserved BCRs encoded by a restricted set of Ig V(D)J genes carrying no or few mutations (11). In addition to cross-linking poorly diversified BCRs, PAMPs activate innate Ag receptors on B cells.

This is exemplified by LPS, which stimulates TI IgM production and IgG CSR by engaging TLR4 on mouse B cells (1). Not only does LPS stimulate mouse B cells to produce bacteria-specific IgM and IgG upon dual BCR and TLR4 engagement, but it also elicits polyclonal Ab production through TLR4 only (1). LPS-induced IgG CSR and Ab production would be further enhanced by BAFF, a B cell-stimulating TNF family member produced by LPS-stimulated myeloid DCs (14, 16). Like BCR and TLR4 (10, 60), BAFF receptors on B cells activate NF-{kappa}B-Rel proteins (61), which are essential for both CSR and Ab production (1). This implies that early TI IgM and IgG production results from the stimulation of both germline and somatically recombined Ag receptors with intersecting NF-{kappa}B-Rel pathways.

Human B cells lack TLR4 but express TLR9 (22), an intracellular pattern recognition receptor that detects CpG DNA from viruses and bacteria (18). Previous studies show that CpG DNA triggers B cell proliferation and TI IgM production (20, 24, 25), but do not clarify the role of CpG DNA in IgG CSR. By showing that CpG DNA elicits CSR to C{gamma}1, C{gamma}2, and C{gamma}3, our findings extend to human B cells recent data demonstrating that CpG DNA stimulates CSR to C{gamma}2a, C{gamma}2b, and C{gamma}3 in mouse B cells (62). Unlike LPS (1), CpG DNA does not elicit significant IgG production in the absence of additional stimuli. This might stem from the fact that TLR9 signals through a pathway distinct from that emanating from TLR4 (10, 22). In line with studies showing that CpG DNA induces IL-10 (22, 49) and synergizes with both IL-10 and BCR to activate B cells (24, 25), we found that CpG DNA cooperates with IL-10 and BCR cross-linking to up-regulate IgG. The expression of IgG is also enhanced by BAFF, which is released by myeloid DCs upon exposure to CpG DNA-inducible cytokines, such as IFN-{alpha} and IL-10 (14, 16, 19, 49).

Low concentrations of microbial CpG DNA are thought to favor the activation of DNA-specific B cells through dual TLR9 and BCR engagement (27, 32, 33). This response would involve B-1 and marginal zone B cells expressing poorly diversified BCRs and might be important to facilitate rapid removal of immunogenic CpG DNA released by invading pathogens. Higher concentrations of microbial CpG DNA would trigger polyclonal B cell activation mainly through TLR9 (25). Although less specific, this response might be important to amplify IgG class switching and production in Ag-primed B cells. Not only would CpG DNA favor the initiation of early TI IgG responses, but it would also amplify later-appearing TD IgG responses. Consistent with this, our results extend previous findings indicating that CpG DNA enhances IgG production in B cells exposed to CD40L (49), a TNF family member expressed by CD4+ T cells upon activation by APCs (4). CpG DNA would further enhance TD IgG production by favoring the release of IFN-{alpha} (19, 22), a powerful inducer of key T cell-costimulating molecules on APCs (21).

By showing that enforced B cell expression of {Delta}TIR-TLR9, DN-MyD88, DN-IRAK1, or DN-TRAF6 attenuates CpG DNA-induced, but not CD40L-induced, I{gamma}3 transcription and NF-{kappa}B-Rel activation, our data suggest that CpG DNA requires TLR9, MyD88, IRAK1, and TRAF6 to initiate IgG CSR. These findings are consistent with recently published data showing that TLR9 and MyD88 are required for the induction of IgG CSR in mouse B cells (62). That TLR9 accounts for CpG DNA-induced IgG CSR is also indicated by our observation that enforced B cell expression of TOLLIP, an adaptor protein that negatively regulates TLR signaling (53), or B cell exposure to chloroquine, an endosomal maturation inhibitor that interferes with CpG DNA-TLR9 interaction (39), attenuates the induction of I{gamma}3 transcription and NF-{kappa}B-Rel activation by CpG DNA. This inhibitory effect is specific, because TOLLIP and chloroquine do not affect I{gamma}3 transcription and NF-{kappa}B-Rel activation in B cells exposed to CD40L. In addition to inhibiting the CpG DNA-TLR9 interaction within the endosome, chloroquine and its derivatives might block as yet elusive CpG DNA receptors on the cell surface (22). This alternative mechanism could account for the inhibition of IgG CSR observed in our experiments, which were conducted with concentrations of chloroquine lower than those required to aspecifically inhibit the endocytic pathway. In agreement with the idea that CD40 signals through both TRAF2 and TRAF6, whereas TLR9 requires TRAF6, but not TRAF2 (10, 36, 47, 52), overexpression of DN-TRAF6 impairs I{gamma}3 and NF-{kappa}B-Rel activation in B cells exposed to either CpG DNA or CD40L. Conversely, overexpression of DN-TRAF2 dampens I{gamma}3 and NF-{kappa}B-Rel activation in B cells exposed to CD40L, but not in those exposed to CpG DNA. These findings imply that CpG DNA and CD40L trigger CpG DNA-induced IgG CSR through partially overlapping signaling pathways.

NF-{kappa}B-Rel activation is essential for CpG DNA-induced IgG CSR, because overexpression of DN-I{kappa}B{alpha} and DN-IKK or disruption of {kappa}B2 and {kappa}B3 cis-I{gamma}3 sites impairs C{gamma}3 gene transcription in B cells exposed to CpG DNA. In agreement with previous studies showing that CpG DNA cooperates with IL-10, but not IL-4, to activate B cells (51, 52), we found that CpG DNA-induced C{gamma} transcription is selectively increased by IL-10. That CpG DNA preferentially cooperates with IL-10 to initiate IgG CSR is also indicated by our observation that IL-2, IL-6, IL-12, IL-13, and IL-15 fail to increase CpG DNA-induced C{gamma} gene transcription even though they are involved in various CpG DNA-mediated immune responses (22, 25, 49). Our findings suggest that IL-10 amplifies CpG DNA-induced CSR by increasing TLR9 expression and subsequent TLR9-mediated NF-{kappa}B-Rel activation. It is also likely that B cells exposed to CpG DNA and IL-10 rapidly up-regulate autocrine NF-{kappa}B-Rel-activating factors, including BAFF (14, 61, 63).

In addition to inducing NF-{kappa}B-Rel, CpG DNA and IL-10 cooperatively activate STAT1, STAT3, IRF1, and IRF4, which are all implicated in the regulation of IgG CSR and Ab production (46, 54, 55, 56, 57, 58). IL-10 would activate STATs and IRFs through Jak1 (44), whereas CpG DNA would activate IRFs through IKK{epsilon} and TBK1 (59). CpG DNA would also activate STATs by inducing autocrine release of IL-10 (22, 49). Our findings suggest that binding of STAT1, STAT3, IRF1, and IRF4 to ISRE and GAS cis-I{gamma} sites proximal to or partially overlapping with {kappa}B2 and {kappa}B3 enhances NF-{kappa}B-Rel-mediated germline C{gamma} gene transcription. This effect might be associated with STAT and IRF interaction with NF-{kappa}B-Rel. Consistent with this, STATs and IRFs enhance the transcription of several Ig and non-Ig gene promoters by forming heterocomplexes with NF-{kappa}B-Rel (1, 44, 54, 64). These heterocomplexes would stabilize NF-{kappa}B-Rel binding to the {kappa}B cis-acting site, thereby enhancing NF-{kappa}B-Rel-dependent gene trans-activation. That STATs and IRFs play a key role in CpG DNA-induced IgG CSR is further indicated by our observation that disruption of ISRE-{kappa}B3 and GAS cis-I{gamma}3 sites or enforced DN-STAT-1, DN-STAT3, or DN-IRF4 expression inhibits germline C{gamma}3 gene transcription in B cells exposed to CpG DNA and IL-10.

By showing that CpG DNA impairs the IL-4-induced activation of I{gamma} and I{epsilon} promoters, our results extend previous findings indicating that CpG DNA inhibits IgG1 and IgE production in B cells exposed to IL-4 (49, 50). The mechanism underlying this inhibition remains unclear. IL-4 initiates CSR by eliciting phosphorylation-dependent activation of Jak3, an IL-4R-associated kinase that triggers STAT6 phosphorylation and nuclear translocation (65). Once in the nucleus, STAT6 triggers germline C{gamma} and C{epsilon} gene transcription upon binding to cis-acting GAS sites on I{gamma} and I{epsilon} promoters (1, 41, 64). This early CSR-associated event would be further amplified by IRF4 (57), an IL-4-inducible protein that binds GAS sites in association with STAT6 (46, 56). Our experiments suggest that CpG DNA inhibits IL-4-dependent germline C{gamma} and C{epsilon} gene transcription by attenuating IL-4-induced phosphorylation and nuclear translocation of STAT6 and IRF4. This effect might derive from the activation of Jak3 phosphatases, including CD45, a transmembrane receptor with Jak phosphatase activity (66). Consistent with this, recent studies indicate that CD45 engagement attenuates IL-4-induced IgE CSR in B cells by preventing the phosphorylation of STAT6 by Jak3 (67).

Notably, CpG DNA does not attenuate the IL-4-induced activation and nuclear translocation of STAT2. This transcription factor is activated by IFN-{alpha} (44), a known IL-4 signaling inhibitor (68), and would negatively regulate IL-4-induced C{gamma} and C{epsilon} gene transcription by limiting the GAS-binding and/or the transcriptional activity of STAT6 (55). CpG DNA might also attenuate IL-4-induced C{gamma} and C{epsilon} gene transcription by up-regulating the transcriptional repressor Bcl-6 (69). A similar function has been recently attributed to T-bet, a T-box transcriptional regulator induced by CpG DNA (50). Yet, the fact that T-bet is heavily involved in TI IgG production (70) suggests that T-bet may induce, rather than inhibit, IgG CSR at least in B cells exposed to CpG DNA and IL-10. Notably, not only is IL-4 signaling inhibited by CpG DNA, but it also inhibits CpG DNA-induced STAT1, STAT3, and IRF4 activation, possibly through a mechanism involving down-regulation of TLR9 expression. This implies that CpG DNA and IL-4 reciprocally turn off their signaling pathways.

Marginal zone and B-1 B cells express poorly diversified Abs that target microbial molecular patterns, such as CpG DNA, often shared by highly conserved intracellular self-Ags (11). This would explain the facility with which marginal zone and B-1 clones are recruited into autoreactive responses (11, 71). If tightly controlled, the natural self-reactivity of marginal zone and B-1 B cells would be important to optimize the removal of immune-stimulating products released by dying cells. This is exemplified by natural anti-DNA Abs, which facilitate the removal of apoptotic CpG DNA in addition to neutralizing microbial CpG DNA. The clearance of CpG DNA would be further enhanced by RFs, which target IgG-bound DNA (11). Thus, autoreactive marginal zone and B-1 B cells might be useful to prevent untoward autoimmune responses initiated by cross-reactive TI Ags. Yet in the presence of persistent or repetitive TI activation, the natural autoantibody repertoire would become pathogenic. This would entail both quantitative and qualitative changes, including increased switching from IgM to IgG. Previous studies indicate that dual TLR9 and BCR engagement by endogenous hypomethylated CpG stimulates autoreactive B cells to produce anti-DNA IgM and IgM-RFs (32, 33). Our findings suggest that a similar TI pathway might induce the production of autoreactive IgG. Consistent with this, CpG DNA administration augments the production of pathogenic DNA-reactive IgG in lupus-prone mice (72).

In SLE and RA, tissue damage stems from deposition of pathogenic IgG targeting a relatively limited set of self-Ags, including DNA (31). Unlike IgM, IgG activate powerful Fc{gamma}Rs on proinflammatory immune cells, including neutrophils, and therefore are highly pathogenic (29, 30). Although IgG CSR is known to play a key role in the pathogenesis of SLE and RA, the mechanisms leading to its dysregulation remain unclear. By showing that TLR9 signaling initiates IgG CSR in B cells, our findings suggest that factors increasing the availability of hypomethylated CpG DNA may facilitate the production of pathogenic IgG in predisposed subjects. Consistent with this, microbial infections, extensive cell death, or drugs inhibiting DNA methylation, such as procainamide, often initiate or exacerbate anti-DNA IgG responses as well as SLE and RA manifestations (29, 30, 71, 73).

Low concentrations of CpG DNA and CpG DNA-IgG immune complexes would induce anti-DNA IgG and RF-IgG by stimulating B cells through both TLR9 and BCR (26, 27, 32, 33), whereas high concentrations of CpG DNA would elicit polyclonal IgG production by stimulating B cells through TLR9 only (25). The IgG-inducing activity of self and microbial CpG DNA would be further enhanced by IFN-{alpha} and IL-10 (16, 70, 74), two CpG DNA-inducible cytokines abnormally increased in patients with SLE and RA (22, 31, 49, 75, 76). CpG DNA, IFN-{alpha}, and IL-10 would further amplify autoreactive IgG production by up-regulating BAFF (14, 16, 77), a key innate player in the pathogenesis of IgG-mediated autoimmune disorders (17, 31, 78). Thus, it is conceivable that chloroquine attenuates SLE and RA clinical manifestations because of its ability to inhibit multiple CpG DNA-inducible pathways, leading autoreactive B cells to switch from IgM to a more pathogenic IgG isotype.


   Acknowledgments
 
We thank Drs. A. B. Pernis (Columbia University College of Physicians and Surgeons, New York, NY); K. Horvath (Mount Sinai Medical Center, New York, NY); J. J. Zhang, J. E. Darnell, Jr., and Jackeline Bromberg (Rockefeller University, New York, NY); Z. Cao (Tularik, San Francisco, CA); and J.-D. Li (University of South California, Los Angeles, CA) for their help with reagents.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grants AR47872 and AI057130 (to A.C.). Back

2 Address correspondence and reprint requests to Dr. Andrea Cerutti, Weill Medical College, Cornell University, 1300 York Avenue, New York, NY 10021. E-mail address: acerutti{at}med.cornell.edu Back

3 Abbreviations used in this paper: CSR, class switch DNA recombination; AID, activation-induced deaminase; BAFF, B cell-activating factor of the TNF family; BSAP, B cell-specific activating protein-binding site; DC, dendritic cell; DN, dominant negative; ECS, evolutionarily conserved sequence; GAS, IFN-{gamma}-activated sequence; IKK, I{kappa}B kinase; IRAK, IL-1R-associated kinase; IRF, IFN-responsive factor; ISRE, IFN-stimulated responsive element; Luc, luciferase reporter plasmid; NIK, NF-{kappa}B-inducing kinase; ODN, oligodeoxynucleotide; p, phospho; PAMP, pathogen-associated molecular pattern; RA, rheumatoid arthritis; RF, rheumatoid factor; SLE, systemic lupus erythematosus; TD, T cell-dependent; TI, T cell-independent; TIR, TLR/IL-1R domain; TOLLIP, Toll-interacting protein; TRAF, TNFR-associated factor. Back

Received for publication April 2, 2004. Accepted for publication July 28, 2004.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Stavnezer, J.. 1996. Antibody class switching. Adv. Immunol. 61:79.[Medline]
  2. MacLennan, I. C.. 1994. Germinal centers. Annu. Rev. Immunol. 12:117.[Medline]
  3. Manis, J. P., M. Tian, F. W. Alt. 2002. Mechanism and control of class-switch recombination. Trends Immunol. 23:31.[Medline]
  4. Van Kooten, C., J. Banchereau. 1996. CD40-CD40 ligand: a multifunctional receptor-ligand pair. Adv. Immunol. 61:1.[Medline]
  5. Honjo, T., K. Kinoshita, M. Muramatsu. 2002. Molecular mechanism of class switch recombination: linkage with somatic hypermutation. Annu. Rev. Immunol. 20:165.[Medline]
  6. Tarlinton, D. M., K. G. Smith. 2000. Dissecting affinity maturation: a model explaining selection of antibody-forming cells and memory B cells in the germinal centre. Immunol. Today 21:436.[Medline]
  7. Fagarasan, S., T. Honjo. 2000. T-Independent immune response: new aspects of B cell biology. Science 290:89.[Abstract/Free Full Text]
  8. MacLennan, I., C. Vinuesa. 2002. Dendritic cells, BAFF, and APRIL: innate players in adaptive antibody responses. Immunity 17:235.[Medline]
  9. Mond, J. J., Q. Vos, A. Lees, C. M. Snapper. 1995. T cell independent antigens. Curr. Opin. Immunol. 7:349.[Medline]
  10. Medzhitov, R.. 2001. Toll-like receptors and innate immunity. Nat. Rev. Immunol. 1:135.[Medline]
  11. Bendelac, A., M. Bonneville, J. F. Kearney. 2001. Autoreactivity by design: innate B and T lymphocytes. Nat. Rev. Immunol. 1:177.[Medline]
  12. Balazs, M., F. Martin, T. Zhou, J. Kearney. 2002. Blood dendritic cells interact with splenic marginal zone B cells to initiate T-independent immune responses. Immunity 17:341.[Medline]
  13. Janeway, C. A., C. A. Jr, R. Medzhitov. 2002. Innate immune recognition. Annu. Rev. Immunol. 20:197.[Medline]
  14. Nardelli, B., O. Belvedere, V. Roschke, P. A. Moore, H. S. Olsen, T. S. Migone, S. Sosnovtseva, J. A. Carrell, P. Feng, J. G. Giri, et al 2001. Synthesis and release of B-lymphocyte stimulator from myeloid cells. Blood 97:198.[Abstract/Free Full Text]
  15. Schneider, P., F. MacKay, V. Steiner, K. Hofmann, J. L. Bodmer, N. Holler, C. Ambrose, P. Lawton, S. Bixler, H. Acha-Orbea, et al 1999. BAFF, a novel ligand of the tumor necrosis factor family, stimulates B cell growth. J. Exp. Med. 189:1747.[Abstract/Free Full Text]
  16. Litinskiy, M. B., B. Nardelli, D. M. Hilbert, B. He, A. Schaffer, P. Casali, A. Cerutti. 2002. DCs induce CD40-independent immunoglobulin class switching through BLyS and APRIL. Nat. Immunol. 3:822.[Medline]
  17. Mackay, F., P. Schneider, P. Rennert, J. Browning. 2003. BAFF and APRIL: a tutorial on B cell survival. Annu. Rev. Immunol. 21:231.[Medline]
  18. Hemmi, H., O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, et al 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408:740.[Medline]
  19. Kadowaki, N., S. Ho, S. Antonenko, R. W. Malefyt, R. A. Kastelein, F. Bazan, Y. J. Liu. 2001. Subsets of human dendritic cell precursors express different Toll-like receptors and respond to different microbial antigens. J. Exp. Med. 194:863.[Abstract/Free Full Text]
  20. Bauer, S., C. J. Kirschning, H. Hacker, V. Redecke, S. Hausmann, S. Akira, H. Wagner, G. B. Lipford. 2001. Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition. Proc. Natl. Acad. Sci. USA 98:9237.[Abstract/Free Full Text]
  21. Katze, M. G., Y. He, M. Gale, Jr. 2002. Viruses and interferon: a fight for supremacy. Nat. Rev. Immunol. 2:675.[Medline]
  22. Krieg, A. M.. 2002. CpG motifs in bacterial DNA and their immune effects. Annu. Rev. Immunol. 20:709.[Medline]
  23. Latz, E., A. Schoenemeyer, A. Visintin, K. A. Fitzgerald, B. G. Monks, C. F. Knetter, E. Lien, N. J. Nilsen, T. Espevik, D. T. Golenbock. 2004. TLR9 signals after translocating from the ER to CpG DNA in the lysosome. Nat. Immunol. 5:190.[Medline]
  24. Krieg, A. M., A. K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. A. Koretzky, D. M. Klinman. 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374:546.[Medline]
  25. Bernasconi, N. L., E. Traggiai, A. Lanzavecchia. 2002. Maintenance of serological memory by polyclonal activation of human memory B cells. Science 298:2199.[Abstract/Free Full Text]
  26. Krieg, A. M.. 2002. A role for Toll in autoimmunity. Nat. Immunol. 3:423.[Medline]
  27. Vinuesa, C. G., C. C. Goodnow. 2002. Immunology: DNA drives autoimmunity. Nature 416:595.[Medline]
  28. Richardson, B., L. Scheinbart, J. Strahler, L. Gross, S. Hanash, M. Johnson. 1990. Evidence for impaired T cell DNA methylation in systemic lupus erythematosus and rheumatoid arthritis. Arthritis Rheum. 33:1665.[Medline]
  29. Goronzy, J. J., C. M. Weyand. 1995. T and B cell-dependent pathways in rheumatoid arthritis. Curr. Opin. Rheumatol. 7:214.[Medline]
  30. Kotzin, B. L.. 1996. Systemic lupus erythematosus. Cell 85:303.[Medline]
  31. Plotz, P. H.. 2003. The autoantibody repertoire: searching for order. Nat. Rev. Immunol. 3:73.[Medline]
  32. Leadbetter, E. A., I. R. Rifkin, A. M. Hohlbaum, B. C. Beaudette, M. J. Shlomchik, A. Marshak-Rothstein. 2002. Chromatin-IgG complexes activate B cells by dual engagement of IgM and Toll-like receptors. Nature 416:603.[Medline]
  33. Viglianti, G. A., C. M. Lau, T. M. Hanley, B. A. Miko, M. J. Shlomchik, A. Marshak-Rothstein. 2003. Activation of autoreactive B cells by CpG dsDNA. Immunity 19:837.[Medline]
  34. Ghosh, S., M. Karin. 2002. Missing pieces in the NF-{kappa}B puzzle. Cell 109:(Suppl.):S81.
  35. Pomerantz, J. L., D. Baltimore. 2002. Two pathways to NF-{kappa}B. Mol. Cell 10:693.[Medline]
  36. Cao, Z., J. Xiong, M. Takeuchi, T. Kurama, D. V. Goeddel. 1996. TRAF6 is a signal transducer for interleukin-1. Nature 383:443.[Medline]
  37. Wesche, H., W. J. Henzel, W. Shillinglaw, S. Li, Z. Cao. 1997. MyD88: an adapter that recruits IRAK to the IL-1 receptor complex. Immunity 7:837.[Medline]
  38. Medzhitov, R., P. Preston-Hurlburt, E. Kopp, A. Stadlen, C. Chen, S. Ghosh, C. A. Janeway, Jr. 1998. MyD88 is an adaptor protein in the hToll/IL-1 receptor family signaling pathways. Mol. Cell 2:253.[Medline]
  39. Yi, A. K., R. Tuetken, T. Redford, M. Waldschmidt, J. Kirsch, A. M. Krieg. 1998. CpG motifs in bacterial DNA activate leukocytes through the pH-dependent generation of reactive oxygen species. J. Immunol. 160:4755.[Abstract/Free Full Text]
  40. Schaffer, A., A. Cerutti, H. Zan, P. Casali. 1999. The evolutionary conserved sequence upstream of the human S{gamma}3 region is a functional promoter: synergistic activation by CD40 ligand and IL-4 via distinct cis regulatory elements. J. Immunol. 162:5327.[Abstract/Free Full Text]
  41. Thienes, C. P., L. De Monte, S. Monticelli, M. Busslinger, H. J. Gould, D. Vercelli. 1997. The transcription factor B cell-specific activator protein (BSAP) enhances both IL-4- and CD40-mediated activation of the human {epsilon} germline promoter. J. Immunol. 158:5874.[Abstract]
  42. Schaffer, A., E. C. Kim, X. Wu, H. Zan, L. Testoni, S. Salamon, A. Cerutti, P. Casali. 2003. Selective inhibition of class switching to IgG and IgE by recruitment of the HoxC4 and Oct-1 homeodomain proteins and Ku70/Ku86 to newly identified ATTT cis-elements. J. Biol. Chem. 278:23141.[Abstract/Free Full Text]
  43. Sha, W., H.-C. Liou, E. Tuomanen, D. Baltimore. 1995. Targeted disruptionof the p50 subunit of NF-{kappa}B leads to multifocal defects in immune responses. Cell 80:321.[Medline]
  44. Levy, D. E., J. E. Darnell, Jr. 2002. Stats: transcriptional control and biological impact. Nat. Rev. Mol. Cell. Biol. 3:651.[Medline]
  45. Rodriguez, J. J., J. P. Parisien, C. M. Horvath. 2002. Nipah virus V protein evades {alpha} and {gamma} interferons by preventing STAT1 and STAT2 activation and nuclear accumulation. J. Virol. 76:11476.[Abstract/Free Full Text]
  46. Gupta, S., M. Jiang, A. Anthony, A. B. Pernis. 1999. Lineage-specific modulation of interleukin 4 signaling by interferon regulatory factor 4. J. Exp. Med. 190:1837.[Abstract/Free Full Text]
  47. Leo, E., J. M. Zapata, J. Reed. 1999. CD40-mediated activation of Ig C{gamma}1 and Ig C{epsilon} germ-line promoters involves multiple TRAF family proteins. Eur. J. Immunol. 29:3908.[Medline]
  48. Shuto, T., H. Xu, B. Wang, J. Han, H. Kai, X. X. Gu, T. F. Murphy, D. J. Lim, J. D. Li. . 2001. Activation of NF-{kappa}B by nontypeable Hemophilus influenzae is mediated by Toll-like receptor 2-TAK1-dependent NIK-IKK{alpha}/{beta}-I{kappa}B{alpha} and MKK3/6-p38 MAP kinase signaling pathways in epithelial cells. Proc. Natl. Acad. Sci. USA 98:8774.[Abstract/Free Full Text]
  49. Gantner, F., P. Hermann, K. Nakashima, S. Matsukawa, K. Sakai, K. B. Bacon. 2003. CD40-dependent and -independent activation of human tonsil B cells by CpG oligodeoxynucleotides. Eur. J. Immunol. 33:1576.[Medline]
  50. Liu, N., N. Ohnishi, L. Ni, S. Akira, K. B. Bacon. 2003. CpG directly induces T-bet expression and inhibits IgG1 and IgE switching in B cells. Nat. Immunol. 4:687.[Medline]
  51. Cerutti, A., H. Zan, A. Schaffer, L. Bergsagel, N. Harindranath, E. E. Max, P. Casali. 1998. CD40 ligand and appropriate cytokines induce switching to IgG, IgA, and IgE and coordinated germinal center and plasmacytoid phenotypic differentiation in a human monoclonal IgM+IgD+ B cell line. J. Immunol. 160:2145.[Abstract/Free Full Text]
  52. Bishop, G. A., B. S. Hostager. 2001. B lymphocyte activation by contact-mediated interactions with T lymphocytes. Curr. Opin. Immunol. 13:278.[Medline]
  53. Burns, K., J. Clatworthy, L. Martin, F. Martinon, C. Plumpton, B. Maschera, A. Lewis, K. Ray, J. Tschopp, F. Volpe. 2000. Tollip, a new component of the IL-1RI pathway, links IRAK to the IL-1 receptor. Nat. Cell. Biol. 2:346.[Medline]
  54. Gupta, S., D. Xia, M. Jiang, S. Lee, A. B. Pernis. 1998. Signaling pathways mediated by the TNF- and cytokine-receptor families target a common cis-element of the IFN regulatory factor 1 promoter. J. Immunol. 161:5997.[Abstract/Free Full Text]
  55. Gupta, S., M. Jiang, A. B. Pernis. 1999. IFN-{alpha} activates Stat6 and leads to the formation of Stat2:Stat6 complexes in B cells. J. Immunol. 163:3834.[Abstract/Free Full Text]
  56. Taniguchi, T., K. Ogasawara, A. Takaoka, N. Tanaka. 2001. IRF family of transcription factors as regulators of host defense. Annu. Rev. Immunol. 19:623.[Medline]
  57. Mittrucker, H. W., T. Matsuyama, A. Grossman, T. M. Kundig, J. Potter, A. Shahinian, A. Wakeham, B. Patterson, P. S. Ohashi, T. W. Mak. 1997. Requirement for the transcription factor LSIRF/IRF4 for mature B and T lymphocyte function. Science 275:540.[Abstract/Free Full Text]
  58. Lu, B., C. Ebensperger, Z. Dembic, Y. Wang, M. Kvatyuk, T. Lu, R. L. Coffman, S. Pestka, P. B. Rothman. 1998. Targeted disruption of the interferon-{gamma} receptor 2 gene results in severe immune defects in mice. Proc. Natl. Acad. Sci. USA 95:8233.[Abstract/Free Full Text]
  59. Fitzgerald, K. A., S. M. McWhirter, K. L. Faia, D. C. Rowe, E. Latz, D. T. Golenbock, A. J. Coyle, S. M. Liao, T. Maniatis. 2003. IKKepsilon and TBK1 are essential components of the IRF3 signaling pathway. Nat. Immunol. 4:491.[Medline]
  60. Niiro, H., E. A. Clark. 2002. Regulation of B-cell fate by antigen-receptor signals. Nat. Rev. Immunol. 2:945.[Medline]
  61. Mackay, F., J. L. Browning. 2002. BAFF: a fundamental survival factor for B cells. Nat. Rev. Immunol. 2:465.[Medline]
  62. Lin, L., A. J. Gerth, S. L. Peng. 2004. CpG DNA redirects class-switching towards "Th1-like" Ig isotype production via TLR9 and MyD88. Eur. J. Immunol. 34:1483.[Medline]
  63. He, B., N. Raab-Traub, P. Casali, A. Cerutti. 2003. EBV-encoded latent membrane protein 1 cooperates with BAFF/BLyS and APRIL to induce T cell-independent Ig heavy chain class switching. J. Immunol. 171:5215.[Abstract/Free Full Text]
  64. Shen, C. H., J. Stavnezer. 1998. Interaction of stat6 and NF-{kappa}B: direct association and synergistic activation of interleukin-4-induced transcription. Mol. Cell. Biol. 18:3395.[Abstract/Free Full Text]
  65. Geha, R. S., H. H. Jabara, S. R. Brodeur. 2003. The regulation of immunoglobulin E class-switch recombination. Nat. Rev. Immunol. 3:721.[Medline]
  66. Irie-Sasaki, J., T. Sasaki, W. Matsumoto, A. Opavsky, M. Cheng, G. Welstead, E. Griffiths, C. Krawczyk, C. D. Richardson, K. Aitken, et al 2001. CD45 is a JAK phosphatase and negatively regulates cytokine receptor signalling. Nature 409:349.[Medline]
  67. Zhou, C., A. Saxon, K. Zhang. 2003. Human activation-induced cytidine deaminase is induced by IL-4 and negatively regulated by CD45: implication of CD45 as a Janus kinase phosphatase in antibody diversification. J. Immunol. 170:1887.[Abstract/Free Full Text]
  68. Pene, J., F. Rousset, F. Briere, I. Chretien, J. Y. Bonnefoy, H. Spits, T. Yokota, N. Arai, K. Arai, J. Banchereau, et al 1988. IgE production by normal human lymphocytes is induced by interleukin 4 and suppressed by interferons {gamma} and {alpha} and prostaglandin E2. Proc. Natl. Acad. Sci. USA 85:6880.[Abstract/Free Full Text]
  69. Harris, M. B., C. C. Chang, M. T. Berton, N. N. Danial, J. Zhang, D. Kuehner, B. H. Ye, M. Kvatyuk, P. P. Pandolfi, G. Cattoretti, et al 1999. Transcriptional repression of Stat6-dependent interleukin-4-induced genes by BCL-6: specific regulation of iepsilon transcription and immunoglobulin E switching. Mol. Cell. Biol. 19:7264.[Abstract/Free Full Text]
  70. Peng, S. L., S. J. Szabo, L. H. Glimcher. 2002. T-bet regulates IgG class switching and pathogenic autoantibody production. Proc. Natl. Acad. Sci. USA 99:5545.[Abstract/Free Full Text]
  71. Ray, S. K., C. Putterman, B. Diamond. 1996. Pathogenic autoantibodies are routinely generated during the response to foreign antigen: a paradigm for autoimmune disease. Proc. Natl. Acad. Sci. USA 93:2019.[Abstract/Free Full Text]
  72. Anders, H. J., V. Vielhauer, V. Eis, Y. Linde, M. Kretzler, G. Perez de Lema, F. Strutz, S. Bauer, M. Rutz, H. Wagner, et al 2004. Activation of Toll-like receptor-9 induces progression of renal disease in MRL-Fas(lpr) mice. FASEB J. 18:534.[Abstract/Free Full Text]
  73. Yung, R. L., J. Quddus, C. E. Chrisp, K. J. Johnson, B. C. Richardson. 1995. Mechanism of drug-induced lupus. I. Cloned Th2 cells modified with DNA methylation inhibitors in vitro cause autoimmunity in vivo. J. Immunol. 154:3025.[Abstract]
  74. Jego, G., A. K. Palucka, J. P. Blanck, C. Chalouni, V. Pascual, J. Banchereau. 2003. Plasmacytoid dendritic cells induce plasma cell differentiation through type I interferon and interleukin 6. Immunity 19:225.[Medline]
  75. Blanco, P., A. K. Palucka, M. Gill, V. Pascual, J. Banchereau. 2001. Induction of dendritic cell differentiation by IFN-{alpha} in systemic lupus erythematosus. Science 294:1540.[Abstract/Free Full Text]
  76. Bennett, L., A. K. Palucka, E. Arce, V. Cantrell, J. Borvak, J. Banchereau, V. Pascual. 2003. Interferon and granulopoiesis signatures in systemic lupus erythematosus blood. J. Exp. Med. 197:711.[Abstract/Free Full Text]
  77. Boule, M. W., C. Broughton, F. Mackay, S. Akira, A. Marshak-Rothstein, I. R. Rifkin. 2004. Toll-like receptor 9-dependent and -independent dendritic cell activation by chromatin-immunoglobulin G complexes. J. Exp. Med. 199:1631.[Abstract/Free Full Text]
  78. Banchereau, J., V. Pascual, A. K. Palucka. 2004. Autoimmunity through cytokine-induced dendritic cell activation. Immunity 20:539.[Medline]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
T. A. Barr, S. Brown, P. Mastroeni, and D. Gray
B Cell Intrinsic MyD88 Signals Drive IFN-{gamma} Production from T Cells and Control Switching to IgG2c
J. Immunol., July 15, 2009; 183(2): 1005 - 1012.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Microbiol. Rev.Home page
A. J. Fried and F. A. Bonilla
Pathogenesis, Diagnosis, and Management of Primary Antibody Deficiencies and Infections
Clin. Microbiol. Rev., July 1, 2009; 22(3): 396 - 414.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
N. S. Longo, P. L. Lugar, S. Yavuz, W. Zhang, P. H. L. Krijger, D. E. Russ, D. D. Jima, S. S. Dave, A. C. Grammer, and P. E. Lipsky
Analysis of somatic hypermutation in X-linked hyper-IgM syndrome shows specific deficiencies in mutational targeting
Blood, April 16, 2009; 113(16): 3706 - 3715.
[Abstract] [Full Text] [PDF]

Home page
 CVIHome page
Y. Wang, S. A. Blozis, M. Lederman, A. Krieg, A. Landay, and C. J. Miller
Enhanced Antibody Responses Elicited by a CpG Adjuvant Do Not Improve the Protective Effect of an Aldrithiol-2-Inactivated Simian Immunodeficiency Virus Therapeutic AIDS Vaccine
Clin. Vaccine Immunol., April 1, 2009; 16(4): 499 - 505.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
D. Miyazaki, C. H. Kuo, T. Tominaga, Y. Inoue, and S. J. Ono
Regulatory Function of CpG-Activated B Cells in Late-Phase Experimental Allergic Conjunctivitis
Invest. Ophthalmol. Vis. Sci., April 1, 2009; 50(4): 1626 - 1635.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
D. C. Nacionales, J. S. Weinstein, X.-J. Yan, E. Albesiano, P. Y. Lee, K. M. Kelly-Scumpia, R. Lyons, M. Satoh, N. Chiorazzi, and W. H. Reeves
B Cell Proliferation, Somatic Hypermutation, Class Switch Recombination, and Autoantibody Production in Ectopic Lymphoid Tissue in Murine Lupus
J. Immunol., April 1, 2009; 182(7): 4226 - 4236.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
I. Bekeredjian-Ding, A. Doster, M. Schiller, P. Heyder, H.-M. Lorenz, B. Schraven, U. Bommhardt, and K. Heeg
TLR9-Activating DNA Up-Regulates ZAP70 via Sustained PKB Induction in IgM+ B Cells
J. Immunol., December 15, 2008; 181(12): 8267 - 8277.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
D. Chiron, I. Bekeredjian-Ding, C. Pellat-Deceunynck, R. Bataille, and G. Jego
Toll-like receptors: lessons to learn from normal and malignant human B cells
Blood, September 15, 2008; 112(6): 2205 - 2213.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. F. Porter, S. Vavassori, and L. R. Covey
A Polypyrimidine Tract-Binding Protein-Dependent Pathway of mRNA Stability Initiates with CpG Activation of Primary B Cells
J. Immunol., September 1, 2008; 181(5): 3336 - 3345.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
W. Xu, P. A. Santini, A. J. Matthews, A. Chiu, A. Plebani, B. He, K. Chen, and A. Cerutti
Viral Double-Stranded RNA Triggers Ig Class Switching by Activating Upper Respiratory Mucosa B Cells through an Innate TLR3 Pathway Involving BAFF
J. Immunol., July 1, 2008; 181(1): 276 - 287.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
N. Gao, P. Jennings, and D. Yuan
Requirements for the natural killer cell-mediated induction of IgG1 and IgG2a expression in B lymphocytes
Int. Immunol., May 1, 2008; 20(5): 645 - 657.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
F. Capolunghi, S. Cascioli, E. Giorda, M. M. Rosado, A. Plebani, C. Auriti, G. Seganti, R. Zuntini, S. Ferrari, M. Cagliuso, et al.
CpG Drives Human Transitional B Cells to Terminal Differentiation and Production of Natural Antibodies
J. Immunol., January 15, 2008; 180(2): 800 - 808.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
L. Busconi, J. W. Bauer, J. R. Tumang, A. Laws, K. Perkins-Mesires, A. S. Tabor, C. Lau, R. B. Corley, T. L. Rothstein, F. E. Lund, et al.
Functional Outcome of B Cell Activation by Chromatin Immune Complex Engagement of the B Cell Receptor and TLR9
J. Immunol., December 1, 2007; 179(11): 7397 - 7405.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
C. L. Montes, E. V. Acosta-Rodriguez, M. C. Merino, D. A. Bermejo, and A. Gruppi
Polyclonal B cell activation in infections: infectious agents' devilry or defense mechanism of the host?
J. Leukoc. Biol., November 1, 2007; 82(5): 1027 - 1032.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
C. Bitsaktsis, B. Nandi, R. Racine, K. C. MacNamara, and G. Winslow
T-Cell-Independent Humoral Immunity Is Sufficient for Protection against Fatal Intracellular Ehrlichia Infection
Infect. Immun., October 1, 2007; 75(10): 4933 - 4941.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
J. R. Groom, C. A. Fletcher, S. N. Walters, S. T. Grey, S. V. Watt, M. J. Sweet, M. J. Smyth, C. R. Mackay, and F. Mackay
BAFF and MyD88 signals promote a lupuslike disease independent of T cells
J. Exp. Med., August 6, 2007; 204(8): 1959 - 1971.
[Abstract] [Full Text] [PDF]

Home page
 Proc Am Thorac SocHome page
A. M. Krieg
Antiinfective Applications of Toll-like Receptor 9 Agonists
Proceedings of the ATS, July 1, 2007; 4(3): 289 - 294.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. R. Darce, B. K. Arendt, S. K. Chang, and D. F. Jelinek
Divergent Effects of BAFF on Human Memory B Cell Differentiation into Ig-Secreting Cells
J. Immunol., May 1, 2007; 178(9): 5612 - 5622.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
H. M. Guay, T. A. Andreyeva, R. L. Garcea, R. M. Welsh, and E. Szomolanyi-Tsuda
MyD88 Is Required for the Formation of Long-Term Humoral Immunity to Virus Infection
J. Immunol., April 15, 2007; 178(8): 5124 - 5131.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
I. Bekeredjian-Ding, S. Inamura, T. Giese, H. Moll, S. Endres, A. Sing, U. Zahringer, and G. Hartmann
Staphylococcus aureus Protein A Triggers T Cell-Independent B Cell Proliferation by Sensitizing B Cells for TLR2 Ligands
J. Immunol., March 1, 2007; 178(5): 2803 - 2812.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
P. Gourzi, T. Leonova, and F. N. Papavasiliou
Viral induction of AID is independent of the interferon and the Toll-like receptor signaling pathways but requires NF-{kappa}B
J. Exp. Med., February 19, 2007; 204(2): 259 - 265.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
J. Huggins, T. Pellegrin, R. E. Felgar, C. Wei, M. Brown, B. Zheng, E. C. B. Milner, S. H. Bernstein, I. Sanz, and M. S. Zand
CpG DNA activation and plasma-cell differentiation of CD27- naive human B cells
Blood, February 15, 2007; 109(4): 1611 - 1619.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
A. Chiu, W. Xu, B. He, S. R. Dillon, J. A. Gross, E. Sievers, X. Qiao, P. Santini, E. Hyjek, J.-w. Lee, et al.
Hodgkin lymphoma cells express TACI and BCMA receptors and generate survival and proliferation signals in response to BAFF and APRIL
Blood, January 15, 2007; 109(2): 729 - 739.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
N. Teleshova, J. Kenney, G. Van Nest, J. Marshall, J. D. Lifson, I. Sivin, J. Dufour, R. Bohm, A. Gettie, and M. Robbiani
Local and Systemic Effects of Intranodally Injected CpG-C Immunostimulatory-Oligodeoxyribonucleotides in Macaques
J. Immunol., December 15, 2006; 177(12): 8531 - 8541.
[Abstract] [Full Text] [PDF]

Home page
 Rheumatology (Oxford)Home page
P. Szodoray, P. Alex, M. B. Frank, M. Turner, S. Turner, N. Knowlton, C. Cadwell, I. Dozmorov, Y. Tang, P. C. Wilson, et al.
A genome-scale assessment of peripheral blood B-cell molecular homeostasis in patients with rheumatoid arthritis
Rheumatology, December 1, 2006; 45(12): 1466 - 1476.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. E. Butler and N. Wertz
Antibody Repertoire Development in Fetal and Neonatal Piglets. XVII. IgG Subclass Transcription Revisited with Emphasis on New IgG3
J. Immunol., October 15, 2006; 177(8): 5480 - 5489.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. F. Fecteau, G. Cote, and S. Neron
A New Memory CD27-IgG+ B Cell Population in Peripheral Blood Expressing VH Genes with Low Frequency of Somatic Mutation
J. Immunol., September 15, 2006; 177(6): 3728 - 3736.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
L. A. Minns, L. C. Menard, D. M. Foureau, S. Darche, C. Ronet, D. W. Mielcarz, D. Buzoni-Gatel, and L. H. Kasper
TLR9 Is Required for the Gut-Associated Lymphoid Tissue Response following Oral Infection of Toxoplasma gondii.
J. Immunol., June 15, 2006; 176(12): 7589 - 7597.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. P. Miller, J. E. Stadanlick, and M. P. Cancro
Space, Selection, and Surveillance: Setting Boundaries with BLyS.
J. Immunol., June 1, 2006; 176(11): 6405 - 6410.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
X. Han, S. Wang, Y. Fan, J. Yang, L. Jiao, H. Qiu, and X. Yang
Chlamydia Infection Induces ICOS Ligand-Expressing and IL-10-Producing Dendritic Cells That Can Inhibit Airway Inflammation and Mucus Overproduction Elicited by Allergen Challenge in BALB/c Mice
J. Immunol., May 1, 2006; 176(9): 5232 - 5239.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
F. Suarez, O. Lortholary, O. Hermine, and M. Lecuit
Infection-associated lymphomas derived from marginal zone B cells: a model of antigen-driven lymphoproliferation
Blood, April 15, 2006; 107(8): 3034 - 3044.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
B. He, X. Qiao, P. J. Klasse, A. Chiu, A. Chadburn, D. M. Knowles, J. P. Moore, and A. Cerutti
HIV-1 Envelope Triggers Polyclonal Ig Class Switch Recombination through a CD40-Independent Mechanism Involving BAFF and C-Type Lectin Receptors
J. Immunol., April 1, 2006; 176(7): 3931 - 3941.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
N. Teleshova, J. Kenney, V. Williams, G. Van Nest, J. Marshall, J. D. Lifson, I. Sivin, J. Dufour, R. Bohm, A. Gettie, et al.
CpG-C ISS-ODN activation of blood-derived B cells from healthy and chronic immunodeficiency virus-infected macaques
J. Leukoc. Biol., February 1, 2006; 79(2): 257 - 267.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
C. Cunningham-Rundles, L. Radigan, A. K. Knight, L. Zhang, L. Bauer, and A. Nakazawa
TLR9 Activation Is Defective in Common Variable Immune Deficiency
J. Immunol., February 1, 2006; 176(3): 1978 - 1987.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
Z. Guo, S. Garg, K. M. Hill, L. Jayashankar, M. R. Mooney, M. Hoelscher, J. M. Katz, J. M. Boss, and S. Sambhara
A Distal Regulatory Region Is Required for Constitutive and IFN-{beta}-Induced Expression of Murine TLR9 Gene
J. Immunol., December 1, 2005; 175(11): 7407 - 7418.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. E. Butler, D. H. Francis, J. Freeling, P. Weber, and A. M. Krieg
Antibody Repertoire Development in Fetal and Neonatal Piglets. IX. Three Pathogen-Associated Molecular Patterns Act Synergistically to Allow Germfree Piglets to Respond to Type 2 Thymus-Independent and Thymus-Dependent Antigens
J. Immunol., November 15, 2005; 175(10): 6772 - 6785.
[Abstract] [Full Text] [PDF]

Home page
 Rheumatology (Oxford)Home page
G. Riemekasten and B. H. Hahn
Key autoantigens in SLE
Rheumatology, August 1, 2005; 44(8): 975 - 982.
[Full Text] [PDF]

Home page
 J. Immunol.Home page
R. Yang, F. M. Murillo, M. J. Delannoy, R. L. Blosser, W. H. Yutzy IV, S. Uematsu, K. Takeda, S. Akira, R. P. Viscidi, and R. B. S. Roden
B Lymphocyte Activation by Human Papillomavirus-Like Particles Directly Induces Ig Class Switch Recombination via TLR4-MyD88
J. Immunol., June 15, 2005; 174(12): 7912 - 7919.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by He, B.
Right arrow Articles by Cerutti, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by He, B.
Right arrow Articles by Cerutti, A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CHLOROQUINE

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS