|
|
||||||||

* Department of Pathology, Weill Medical College, and
Immunology Graduate Program, Weill Graduate School of Medical Sciences, Cornell University, New York, NY 10021
| Abstract |
|---|
|
|
|---|
-producing plasmacytoid dendritic cells and B cells. In addition to favoring IFN-
release, TLR9 signals B cell activation, proliferation, and IgM production. Recent findings suggest that CpG DNA-TLR9 interaction plays a key role in systemic lupus erythematosus and rheumatoid arthritis, two autoimmune disorders characterized by dysregulated production of DNA-reactive IgG. We show that CpG DNA initiates germline C
1, C
2, and C
3 gene transcription by activating B cells through a TLR9-mediated NF-
B-Rel-dependent innate pathway that cooperates with IL-10 through STAT proteins and IFN-responsive factors. This pathway is inhibited by chloroquine, a drug that attenuates the clinical manifestations of IgG-mediated autoimmune disorders. Germline C
gene transcription is associated with up-regulation of activation-induced cytidine deaminase, a key element of the B cell class switch-inducing machinery, and is followed by class switch DNA recombination from Cµ to C
1, C
2, and C
3. Subsequent IgG production requires additional signals from BCR and a B cell-activating factor of the TNF family (BAFF), produced by dendritic cells upon exposure to IFN-
. Our findings suggest that CpG DNA-TLR9 interaction may be important to initiate or amplify early T cell-independent IgG responses against pathogens. This implies that CpG DNA released during infections may exacerbate autoimmunity by stimulating autoreactive B cells to switch from an IgM to a more pathogenic IgG isotype. | Introduction |
|---|
|
|
|---|
, S
, or S
region 5' of C
, C
, and C
, respectively (2, 3). Complex microbial proteins initiate CSR by up-regulating the TNF family member CD40L on CD4+ T cells (1). Engagement of CD40 on B cells by CD40L activates NF-
B-Rel (4), which initiates germline IH-S-CH transcription by binding cis-acting
B elements within intronic IH promoters 5' of S regions (1). Germline transcription is further enhanced by T cell-derived IL-4 through STAT6, which binds a IFN-
-activated sequence (GAS) adjacent to
B sites (1). By inducing chromatin opening, germline transcription facilitates the recruitment of activation-induced cytidine deaminase (AID), an enzyme that initiates CSR by introducing DNA breaks within S regions (5). Subsequent looping-out deletion of the DNA between the two recombined S regions juxtaposes the somatically recombined VHDJH exon, which encodes the Ag-binding Ig VH region, to a new CH gene (3). In addition to inducing CSR, T cell-dependent (TD) Ags stimulate germinal center B cells to undergo V(D)J gene somatic hypermutation, a process that increases the affinity of Abs for Ag (2, 5). Although generating high affinity Ig-secreting plasma cells and long-lived memory B cells (6), TD B cell responses require 57 days, which is too much of a delay to neutralize quickly replicating pathogens. To compensate for this limitation, marginal zone B cells and mucosal B-1 cells rapidly undergo T cell-independent (TI) Ab production in response to highly conserved microbial Ags with repetitive structure (7, 8). These compounds include type 1 TI Ags, such as bacterial wall LPS, and type 2 TI Ags, such as bacterial capsule polysaccharides (9). Both TI-1 and TI-2 Ags encompass pathogen-associated molecular patterns (PAMPs) (10), which stimulate marginal zone and B-1 cells by cross-linking poorly diversified surface BCRs encoded by a restricted set of V(D)J genes carrying no or few mutations (11). TI Ab production also requires interaction of B cells with dendritic cells (DCs) and macrophages (8, 12). These innate immune cells recognize PAMPs through pattern recognition receptors, including TLR family members (13).
In addition to triggering immediate innate responses (10), PAMP-TLR interaction favors TI B cell Ab production. For instance, engagement of TLR4 by LPS stimulates myeloid DCs to up-regulate B cell-activating factor of the TNF family (BAFF) (10, 14), which cooperates with signals emanating from BCR to stimulate B cell survival, CSR, and Ab production (15, 16, 17). Myeloid DCs also up-regulate BAFF upon exposure to IFN-
(16), a key innate cytokine released by circulating plasmacytoid DCs upon TLR9 engagement by microbial products, including DNA with unmethylated CpG motifs (18, 19, 20, 21). Unlike TLR4, which is expressed on the cell surface (10), TLR9 is expressed in the endoplasmic reticulum and signals from an endosomal compartment upon CpG DNA internalization (22, 23). Not only do PAMPs stimulate B cells through BAFF, but they also directly activate B cells via TLRs. This is exemplified by LPS, which triggers mouse B cell CSR and Ab production by engaging TLR4 (1, 10). Human B cells lack TLR4, but express TLR9, and undergo proliferation and IgM production in response to CpG DNA (24, 25). The role of CpG DNA in human B cell CSR remains elusive.
Unmethylated microbial CpG DNA is similar to certain CpG DNA islands within the mammalian genome (22, 26, 27). Hypomethylated genomic CpG DNA is increased in subjects with systemic lupus erythematosus (SLE) and rheumatoid arthritis (RA) (28), two autoimmune disorders characterized by abnormal B cell reactivity to a relatively restricted set of self-Ags, including DNA and DNA-bound proteins (29, 30, 31). Recent studies suggest that dual TLR9 and BCR engagement by endogenous CpG DNA released from dying cells and CpG DNA-IgG complexes stimulates autoreactive B cells to produce DNA-reactive IgM and IgM rheumatoid factors (RFs), which recognize DNA-bound IgG (32, 33). Considering that anti-DNA IgG is usually more abundant than anti-DNA IgM and that RF-expressing B cells produce IgG in addition to IgM (29, 30), it is conceivable that CpG DNA stimulates autoreactive IgG CSR in addition to IgM production.
CD40L and BAFF induce CSR through p50, p52, p65, c-Rel, and RelB (1, 16). These NF-
B-Rel proteins are retained in a cytoplasmic inactive form by I
B
, an inhibitor of NF-
B (34, 35). By recruiting TNF receptor-associated factors (TRAFs) to their receptors, CD40L and, to a lesser extent, BAFF activate I
B kinase
(IKK
) (4, 17), which is part of an IKK complex that includes two catalytic
and
subunits and a regulatory
subunit (34, 35). Phosphorylation of I
B
by IKK
is followed by I
B
degradation and p50, p65, and c-Rel nuclear translocation (34, 35). CD40L and, to a greater extent, BAFF also activate IKK
through NF-
B-inducing kinase (NIK) (34, 35). Phosphorylation of p100 by IKK
is followed by p100 processing to p52, which then translocates to the nucleus in association with RelB (34, 35). Similarly to CD40 and BAFF receptors, TLRs activate p50, p52, p65, c-Rel, and RelB through NIK and IKK (10). These kinases are turned on upon recruitment of MyD88, IL-1R-associated kinases (IRAKs), and TRAF6 to a cytoplasmic TLR/IL-1R (TIR) domain (36, 37, 38). This prompted us to hypothesize that TLR9 signaling initiates IgG CSR through NF-
B-Rel.
We show that CpG-containing oligodeoxynucleotides (ODNs) and bacterial DNA initiate germline C
gene transcription in human B cells by turning on a TLR9 pathway that activates NF-
B-Rel, STATs, and IFN-responsive factors (IRFs) in cooperation with IL-10. CpG DNA-induced germline C
gene transcription is inhibited by chloroquine, a compound used to treat patients with SLE and RA (39), and ultimately leads to CSR from Cµto C
1, C
2, and C
3. Subsequent IgG production requires additional B cell stimulation through BCR engagement, BAFF, or CD40L.
| Materials and Methods |
|---|
|
|
|---|
Peripheral blood IgD+IgM+ naive B cells were obtained as previously described (16). 2E2 B cells are characterized by high TLR9 expression levels and were obtained by subcloning CL-01, an IgD+IgM+ B cell line that undergoes CSR upon in vitro exposure to appropriate stimuli (40). CL-01 subclones were obtained by limiting dilution and tested for TLR9 expression through semiquantitative RT-PCR. Purified phosphorothioate-modified ODNs (Operon Technologies, Alameda, CA; lowercase letters represent nuclease-resistant phosphorothioate linkage, uppercase letters represent phosphorodiester linkage 3' of the base, and underlined letters represent CpG dinucleotides), including 5'-tcgtcgttttgtcgttttgtcgtt-3' ODN-2006/type B CpG DNA and 5'-ggGGGACGATCGTCgggggg-3' ODN-2216/type-A CpG DNA, were used at 5 µg/ml. Control 5'-tgctgcttttgtgcttttgtgctt-3' GpC DNA and 5'-GCTTGATGACTCAGCCGGAA-3' non-CpG DNA (Operon Technologies) were used at 5 µg/ml. Escherichia coli DNA was purified by extraction with phenol/chloroform/isoamyl alcohol and ethanol precipitation, suspended in DNase-free distillated water, and used at 200 µg/ml. In some experiments E. coli DNA was digested with 50 µg/ml DNase I. Recombinant BAFF (Alexis Biochemicals, San Diego, CA), CD40L (Immunex, Seattle, WA), IL-2 (from Dr. K. A. Smith, Cornell University, New York, NY), IL-4 (Schering-Plough, Kenilworth, NJ), IL-10, IL-15, LPS (Sigma-Aldrich, St. Louis, MO), IL-6, and IL-13 (R&D Systems, Minneapolis, MN) were used at 500 ng/ml, 500 ng/ml, 50 U/ml, 200 U/ml, 200 ng/ml, 100 ng/ml, 1 µg/ml, 5 ng/ml, and 10 ng/ml, respectively, unless otherwise indicated. Immunobead reagent (Irvine Scientifics, Camarillo, CA), which binds both H and L chains of human Igs, was used at 2 µg/ml to mimic extensive BCR cross-linking by a TI Ag. Bafilomycin A and chloroquine (Sigma-Aldrich) were used at 10 nM and 20 ng/ml, respectively.
Flow cytometry and ELISAs
B cell surface CD19 and IgG were labeled with FITC- and PE-conjugated Abs (BD Pharmingen, San Diego, CA). Cells (104) were acquired using a FACSCalibur analyzer. IgG ELISA was performed as previously described (16, 40).
RT-PCRs
cDNA was reverse transcribed from 3 µg of total RNA. TLR9 was RT-PCR amplified for 25 cycles using forward primer 5'-ACAACAACATCCACAGCCAAGTGTC-3' and reverse primer 5'-AAGGCCAGGTAATTGTCACGGAG-3'. I
1-C
1 (603 bp), I
2-C
2 (597 bp), I
3-C
3 (670 bp), I
4-C
4 (411 bp), I
-C
(409 bp), Iµ-Cµ (537 bp), I
1/2-Cµ (557 bp), I
3-Cµ (608 bp), AID (382 bp), and
-actin (593 bp) transcripts were amplified for 25 cycles as previously described (16).
Genomic DNA PCRs
Genomic DNA was extracted by using the QIAmp DNA Mini Kit (Qiagen, Valencia, CA). Total S
-Sµ switch circles and
-actin were amplified from 500 ng of genomic DNA as previously described (16). The conditions were denaturation 1 min at 94°C, annealing 1 min at 68°C, and extension 4 min at 72°C for two rounds of 30 cycles each. Before each PCR, DNA was denatured for 5 min at 94°C. The identity of PCR products with switch circles was confirmed by DNA sequencing.
Southern blots
PCR products were fractionated onto agarose gels, transferred overnight to nylon membranes, and hybridized with radiolabeled probes as described. Switch circles were hybridized with a probe recognizing the recombined Sµ region (16). I
-Cµ transcripts were hybridized with a probe encompassing nt 1250 of the first Cµ exon. I
-C
transcripts were hybridized with a 5'-CAGGGGGAAGACCGATGG-3' oligoprobe recognizing a consensus C
sequence. Finally, I
-C
transcripts were hybridized with a 5'-TCCACACAGAGCCCATC-3' oligoprobe recognizing C
.
Plasmids
Genomic DNA fragments encompassing I
1, I
2, I
3, I
4, and I
promoters were inserted into a promoterless pGL3-Basic luciferase (Luc) reporter vector (Promega, Madison, WI) as previously reported (40, 41, 42).
B1,
B2, IFN-stimulated responsive element (ISRE)-
B3, B cell-specific activating protein-binding site (BSAP), and GAS I
3 mutants were generated through a PCR-based strategy that disrupts the targeted motif by replacing six nucleotides of the wild-type sequence with a SacI restriction site (40). Briefly, 5' and 3' DNA fragments were amplified using appropriate primers with 5' overhangs containing KpnI (sense)/SacI (antisense) and SacI (sense)/BglII (antisense) sites, respectively. Then, DNA fragments were digested with KpnI/SacI, and SacI/BglII, respectively, and cloned into the KpnI/BglII-digested pGL3-Basic vector. Reporter vectors driven by two
B sites from the Ig
gene (from Dr. H.-C. Liou, Cornell University, New York, NY), three GAS sites from the Ly-6/E gene (from Dr. J. J. Zhang, Cornell University), four GAS sites from the CD23b gene (from Dr. J. J. Zhang), and ISRE sites from the ISG15 gene (from Dr. K. Horvath, Mount Sinai Medical Center, New York, NY) are reported elsewhere (43, 44, 45). Expression vectors for TLR9, Toll-like interacting protein (InvivoGen, San Diego, CA), dominant negative (DN)-I
B
(S32/36A; from Dr. E. Cesarman, Cornell University), DN-MyD88 (residues 152296), DN-IRAK1 (residues 1208; Tularik, San Francisco, CA), DN-TRAF2 (residues 248501), DN-TRAF6 (residues 301530; ScienceReagents, El Cajon, CA), DN-IKK
(K44M), DN-IKK
(K49A), DN-NIK (K429/430A; from Dr. J.-D. Li, University of South California, Los Angeles, CA), DN-STAT1 (Tyr701F), DN-STAT3 (Y705F; from Drs. J. E. Darnell, Jr., and J. Bromberg, Rockefeller University, New York, NY), and DN-IRF4 (residues 1150; from Dr. A. B. Pernis, Columbia University) were described previously (18, 20, 36, 44, 46, 47, 48).
TIR-TLR9 (residues 1870) was PCR-amplified from a TLR9 plasmid (InvivoGen) using forward primer 5'-GGGGATATCTACTAGATTTATCAAAAAGAG-3' and reverse primer 5'-GGGGCTAGCTAGGGCAGGGCATCCTCATC-3'.
Luciferase reporter assays
2E2 B cells (20 x 106/ml) were transfected with 40 µl of plasmid DNA-TE solution containing 10 µg of I
-Luc, I
-Luc, ISRE-Luc, or STAT-Luc plasmid expressing firefly luciferase and 200 ng of control pRL-TK plasmid expressing Renilla luciferase under control of the thymidine kinase promoter (Promega). Similar transfections were performed in the presence or the absence of 10 µg of empty expression plasmid or 10 µg of DN-MyD88, DN-IRAK1, DN-TRAF6, DN-TRAF2, Toll-interacting protein (TOLLIP), I
B
, DN-IKK
, DN-IKK
, DN-NIK, DN-STAT1, DN-STAT3, or DN-IRF4 expression plasmid. Electroporations were performed at 625 V/cm and 950 µF using a Gene Pulser II apparatus (Bio-Rad, Hercules, CA). After electroporation, B cells were resuspended in complete medium (2 x 106/ml), split into aliquots, and cultured with or without stimuli. After 48 h, firefly and Renilla luciferase activities were measured using the dual luciferase assay system (Promega) to assess promoter activity and transfection efficiency, respectively. Luciferase activity was expressed as relative light units normalized to a cotransfected pRL-TK control plasmid or as fold induction, i.e., normalized luciferase activity of extracts from stimulated B cells/normalized luciferase activity of extracts from unstimulated B cells.
Immunoblots
Equal amounts of total, cytoplasmic, or nuclear proteins (10 µg) were fractionated onto a 10% SDS-polyacrylamide gel and transferred to nylon membranes (Bio-Rad). After blocking, membranes were probed with primary Abs to TLR9 (InvivoGen), p50, p52, p65, c-Rel, RelB, I
B
, STAT1, STAT2, STAT3, STAT6, IRF1, IRF9, actin, Oct1 (Santa Cruz Biotechnologies, Santa Cruz, CA), IRF4 (from Dr. A. B. Pernis, Columbia University, New York, NY), (Ser32p/Ser36p)-I
B
, (Tyr701p)-STAT1, (Tyr705p)-STAT3, (Tyr641p)-STAT6 (Cell Signaling Technology, Beverly, MA), or (Tyr689p)-STAT2 (Upstate Biotechnology, Lake Placid, NY). Membranes were then washed and incubated with an appropriate secondary Ab (Santa Cruz Biotechnology). Proteins were detected with an ECL detection system (Amersham Biosciences, Little Chalfont, U.K.).
EMSAs
Nuclear proteins were extracted from 5 x 106 cells (40). Double-stranded oligonucleotide probes (consensus sequences are underlined or, when partially overlapping, underlined and in bold) encompassing
B2 cis-I
3 (residues 216 to 192, 5'-CCTCTGACACAGAAACCACCAGAAG-3'), ISRE-
B3 cis-I
3 (residues 198 to 176, 5'-CCAGAAGAAAAGGGAACTTCAGG-3') and GAS cis-I
3 (residues 96 to 69, 5'-GAGCTGTGATTTCCTAGGAAGACAAA-3') sites were end-labeled with [
-32P]ATP by T4 kinase and used at
20,000 cpm in each EMSA reaction. A control Oct1-binding oligonucleotide (TGTCGAATGCAAATCACTAGAA; Santa Cruz Biotechnologies) was labeled in a similar fashion. Reaction samples were prepared as described, incubated at room temperature for 15 min, and electrophoresed through a 6% nondenaturing polyacrylamide gel. The compositions of DNA-bound protein complexes were determined by incubating reaction mixtures with 1 µl of a DNA-binding inhibiting/supershifting Ab to p65, c-Rel, Rel-B, p50, p52, STAT1, STAT2, STAT3, STAT6, IRF1, IRF9 (Santa Cruz Biotechnology), or IRF4 (from Dr. A. B. Pernis) for 15 min at room temperature before adding the probe.
| Results |
|---|
|
|
|---|
IL-10 and IL-4 are two major CSR-inducing cytokines (1, 16). Recent studies indicate that CpG DNA cooperates with autocrine IL-10 to enhance IgG production in B cells (25, 49). Additional reports show that CpG DNA inhibits IgG and IgE production in B cells exposed to IL-4 (49, 50). These observations prompted us to verify whether TLR9 expression differs in B cells exposed to IL-10 or IL-4. Human IgD+IgM+ naive B cells up-regulated TLR9 transcripts and proteins as early as 1 h after incubation with IL-10 (Fig. 1A). This up-regulation peaked after 48 h and progressively increased upon B cell exposure to growing amounts of IL-10 (Fig. 1B). Conversely, naive B cells down-regulated TLR9transcripts and proteins as early as 1 h after exposure to IL-4. This down-regulation was more evident after 48 h and progressively increased upon B cell exposure to growing amounts of IL-4. Thus, IL-10 and IL-4 may control B cell responses to CpG DNA by up- and down-modulating TLR9 expression, respectively.
|
1, C
1, and C
3 transcription in B cells by cooperating with IL-10
CSR from Cµ to a targeted downstream CH gene is preceded by germline IH-CH transcription (1). This early CSR event requires activation of the IH promoter 5' of the targeted CH gene and yields a germline IH-CH transcript encompassing a noncoding IH exon (3). To verify whether CpG DNA initiates germline I
-C
and I
-C
gene transcription, primary IgD+IgM+ naive B cells or IgD+IgM+ 2E2 B cells, a subclone of the CL-01 B cell line (40), were incubated for 48 h with a CpG DNA-containing ODN (ODN-2006). Cultures were conducted in the presence or the absence of IL-10, which facilitates switching to IgG1, IgG2, and IgG3, and with or without IL-4, which favors switching to IgG1, IgG2, IgG3, IgG4, and IgE (1, 51). When exposed to CpG ODN-2006, naive B cells up-regulated germline I
1-C
1, I
2-C
2, and I
3-C
3, but not I
4-C
4 and I
-C
transcripts (Fig. 2), whereas 2E2 B cells activated I
1, I
2, and I
3, but not I
4 and I
promoters (Fig. 3). The combination of CpG ODN-2006 and IL-10 up-regulated I
1-C
1, I
2-C
2, and I
3-C
3 and activated I
1, I
2, and I
3 more effectively than CpG ODN-2006 or IL-10 alone. Control GpC ODN-2006 with inverted CpG motifs did not up-regulate I
1-C
1, I
2-C
2, and I
3-C
3, nor did it enhance the IL-10-induced up-regulation of I
1-C
1, I
2-C
2, and I
3-C
3. Similarly, GpC ODN-2006 did not activate I
1, I
2, and I
3 or enhance IL-10-mediated activation of I
1, I
2, and I
3.
|
|
1-C
1, I
2-C
2, I
3-C
3, I
4-C
4, and I
-C
transcripts and activated I
1, I
2, I
3, I
4, and I
promoters. These effects were attenuated by CpG ODN-2006, but not by GpC ODN-2006, suggesting that CpG DNA cooperate with some, but not all, cytokines to initiate CSR. Consistent with this, CpG ODN-2006 did not activate I
3 when combined with IL-2, IL-6, IL-12, IL-13, or IL-15 (Fig. 4A). The I
3-inducing activity of type B CpG ODN-2006 was comparable with that of CD40L, but was higher than that of type A CpG ODN-2216, and extended to bacterial CpG DNA. In addition to inducing I
3, bacterial DNA activated NF-
B-Rel, which is crucial for initiation of germline C
gene transcription (1). These effects were specific, because a non-CpG oligo, GpC ODN-2006, DNase I-treated bacterial DNA, and LPS did not activate NF-
B-Rel and I
3 (Fig. 4B). Our findings indicate that CpG DNA preferentially cooperates with IL-10 to activate B cells and initiate germline C
1, C
2, and C
3 transcription. They also suggest that CpG DNA inhibits IL-4-induced C
and C
transcription.
|
1, C
2, and C
3 in B cells
Additional experiments verified whether CpG DNA triggers IgG CSR in B cells. CSR requires AID and generates a circular DNA upon looping-out deletion of the IgH locus lying between Sµ and the targeted downstream S region, such as S
(Fig. 5A). The resulting S
-Sµ switch circle transcribes a chimeric I
-Cµ circle transcript, which includes the I
promoter 5' of the targeted C
gene, a noncoding I
exon, and the Cµ exon. Both switch circles and circle transcripts constitute specific markers of ongoing CSR (5). Naive B cells exposed to IL-10 and/or control GpC ODN-2006 for 4 days did not contain S
-Sµ switch circles (Fig. 5B), a byproduct of IgG CSR, nor did they express I
1/2-Cµ and I
3-Cµ circle transcripts, a byproduct of IgG1/IgG2 CSR and IgG3 CSR, respectively. Similarly treated B cells lacked AID transcripts. In contrast, naive B cells induced S
-Sµ, I
1/3-Cµ, I
3-Cµ, and AID upon exposure to CpG ODN-2006, and this induction further increased when CpG ODN-2006 was combined with IL-10. Conversely, IL-4 attenuated the expression of S
-Sµ, I
1/3-Cµ, I
3-Cµ, and AID in B cells exposed to CpG ODN-2006 (not shown). These findings indicate that CpG DNA triggers CSR to C
1, C
2, and C
3 by cooperating with IL-10.
|
To verify whether CpG DNA up-regulates IgG production, naive B cells were exposed to CpG ODN-2006 and IL-10 in the presence or the absence of known CpG DNA-costimulating molecules, including anti-BCR and CD40L (24, 25, 49). Cultures also included BAFF, which is produced by myeloid DCs upon exposure to CpG DNA-induced cytokines, including IFN-
(16, 19). Naive B cells up-regulated surface IgG upon exposure to CpG ODN-2006 (but not GpC ODN-2006) and IL-10, anti-BCR, BAFF, or CD40L for 5 days (Fig. 5C). The proportion of IgG-expressing B cells further increased when CpG ODN-2006 was combined with either IL-10 and anti-BCR or IL-10 and BAFF, or IL-10 and CD40L. This increase was incremental over that induced by either IL-10 and anti-BCR or IL-10 and BAFF, or IL-10 and CD40L. Finally, CpG ODN-2006 and IL-10 elicited IgG secretion only in B cells concomitantly exposed to anti-BCR, BAFF, or CD40L for 8 days (Fig. 5D). This suggests that CpG DNA requires IL-10 as well as additional TI or TD stimuli, including BAFF or CD40L, to stimulate IgG production in Ag-activated B cells.
CpG DNA requires TLR9, MyD88, IRAK1, and TRAF6 to induce germline C
3 gene transcription
CD40 activates initiates NF-
B-Rel-dependent germline C
transcription by recruiting TRAFs, including TRAF2 and TRAF6 (47, 52). Because TLR9 activates NF-
B-Rel by recruiting MyD88, IRAK, and TRAF6 through a cytoplasmic TIR domain (10), it was hypothesized that the TLR9-MyD88-IRAK-TRAF6 axis is crucial for the initiation of IgG CSR by CpG DNA. Consistent with this, enforced expression of TIR-less TLR9 (
TIR-TLR9), DN-MyD88, DN-IRAK1, or TOLLIP, an adapter protein that negatively regulates TLR signaling (53), inhibited the activation of I
3-Luc in 2E2 B cells exposed to CpG ODN-2006 for 48 h (Fig. 6A). In these cells,
TIR-TLR9, DN-MyD88, DN-IRAK1, or TOLLIP inhibited NF-
B-Rel-dependent activation of a minimal
B-Luc reporter vector. As expected, DN-MyD88, DN-IRAK1, or TOLLIP did not inhibit activation of I
3-Luc and
B-Luc by CD40L. Furthermore, a DN form of TRAF2 attenuated activation of I
3-Luc and
B-Luc by CD40L, but not by CpG ODN-2006. Finally, a DN form of TRAF6 attenuated the activation of I
3-Luc and
B-Luc by either CpG ODN-2006 or CD40L. These findings suggest that CpG DNA activates I
promoters as well as NF-
B-Rel through an innate pathway that requires TLR9, MyD88, IRAK1, and TRAF6.
|
3 gene transcription through a chloroquine-sensitive pathway
Innate immune cells internalize CpG DNA and initiate TLR9 signaling through a mechanism that requires endosomal maturation and acidification (23). Consistent with this, inhibitors of endosomal maturation and acidification, such as bafilomycin-A and chloroquine, attenuate cell activation by CpG DNA (32, 39). Chloroquine and its derivatives might also block CpG DNA signaling by preventing CpG DNA binding to as yet elusive surface receptors (22, 26). Bafilomycin-A and chloroquine attenuated the activation of both I
3-Luc and
B-Luc in 2E2 B cells exposed to CpG ODN-2006 (Fig. 6B). In contrast, bafilomycin-A and chloroquine did not affect the activation of I
3-Luc and
B-Luc in 2E2 B cells exposed to CD40L. These data suggest that CpG DNA activates I
promoters and NF-
B-Rel through a chloroquine-sensitive B cell pathway.
CpG DNA and IL-10 trans-activate the I
3 promoter through
B, ISRE, and GAS cis-acting elements
Germline C
gene transcription requires key cis-acting DNA regulatory elements located within the evolutionarily conserved sequence (ECS) of I
promoters (Fig. 7A). The human ECS includes three
B sites (
B1,
B2, and
B3), a BSAP, and a STAT-binding GAS (1, 40). CD40L-induced C
gene transcription involves binding of NF-
B-Rel and BSAP to
B1,
B2, and BSAP sites, whereas IL-4-induced C
gene transcription requires binding of STAT6 to the GAS site. This latter can bind STAT1, STAT2, STAT3, and IRF4 in addition to STAT6 (44, 46, 54, 55, 56). Interestingly, the ECS contains also an ISRE site, which partially overlaps with
B3 (ISRE-
B3) (40). In general, ISRE binds the STAT1-STAT2-IFR9 complex as well as IRFs, including IRF1 and IRF4 (44, 56). STATs and IRFs are induced by several receptors, including TLRs and IL-10Rs, and cooperate with NF-
B-Rel proteins to modulate B cell activation, differentiation, and IgG production (44, 46, 50, 54, 55, 56, 57, 58, 59). Thus, it was postulated that CpG DNA and IL-10 initiate C
transcription upon NF-
B-Rel, STAT, and IRF binding to cooperative
B, ISRE, and GAS cis-I
sites. To verify this, 2E2 B cells were transfected with reporter vectors carrying wild-type I
3 or mutated I
3 with targeted disruptions of
B1,
B2, ISRE-
B3, BSAP, and GAS (43). In 2E2 B cells incubated with medium alone, wild-type and mutated I
3 promoters displayed similar transcriptional activity (Fig. 7B). Disruption of
B1 or BSAP did not affect activation of I
3 by CpG ODN-2006 and/or IL-10. In contrast, disruption of
B2,
B3-ISRE, or GAS impaired activation of I
3 by CpG ODN-2006 and/or IL-10. These findings suggest that CpG DNA and IL-10 require
B2,
B3, ISRE, and GAS, but not
B1 and BSAP, cis-acting motifs to initiate germline C
3 transcription.
|
B-Rel
Given the key role of
B2 and ISRE-
B3 in the activation of I
3 by CpG ODN-2006 and IL-10, it was postulated that CpG DNA and IL-10 synergistically induce C
gene transcription by cooperatively activating NF-
B-Rel. Initial experiments tested the induction of transcriptionally active NF-
B-Rel. 2E2 B cells activated a minimal
B-Luc reporter vector upon exposure to CpG ODN-2006, but not GpC ODN-2006, for 48 h (Figs. 3B and 8A). When combined, CpG ODN-2006 and IL-10 induced
B-Luc more than either CpG ODN-2006 or IL-10 alone (Fig. 8A). Additional studies evaluated NF-
B-Rel nuclear translocation. When exposed to CpG ODN-2006 for 3 h, naive B cells up-regulated I
B
phosphorylation and down-regulated total I
B
, a hallmark of increased I
B
degradation (Fig. 8B). After 6 h, CpG ODN-2006 up-regulated the expression of nuclear p65, p50, c-Rel, p52, and RelB (Fig. 8C). Also, IL-10 activated
B-Luc and up-regulated I
B
phosphorylation, I
B
degradation, and NF-
B-Rel nuclear translocation, although less than CpG ODN-2006. When combined, CpG ODN-2006 and IL-10 induced more I
B
phosphorylation, I
B
degradation, and NF-
B-Rel nuclear translocation than CpG ODN-2006 or IL-10 alone. Thus, CpG DNA and IL-10 cooperatively activate p65, p50, c-Rel, p52, and RelB in B cells.
|
B-Luc and up-regulated I
B
phosphorylation, I
B
degradation, and NF-
B-Rel nuclear translocation. Compared with IL-4 or CpG ODN-2006 alone, CpG ODN-2006 and IL-4 did not significantly increase
B-Luc activation, I
B
phosphorylation, I
B
degradation, or NF-
B-Rel nuclear translocation. These findings indicate that IL-4 does not cooperate with CpG DNA to activate NF-
B-Rel.
CpG DNA and IL-10 up-regulate NF-
B-Rel binding to
B2 and ISRE-
B3 cis-I
3
We next evaluated whether CpG DNA and IL-10 up-regulate the binding of nuclear NF-
B-Rel to
B2 cis-I
3. Naive B cells up-regulated the binding of complexes a, b, c, d, e, f, and g to
B2 cis-I
3 upon incubation with CpG ODN-2006 for 6 h (Fig. 8D). These complexes were attenuated or supershifted by preincubating nuclear proteins with Abs to p65, p50 and p65, p50 and c-Rel, p52 and RelB, p50 and RelB, p50 and p52, and p50, respectively. IL-10 up-regulated complexes a, b, c, d, e, f, and g to
B2 less than CpG ODN-2006, whereas CpG ODN-2006 and IL-10 up-regulated complexes a, b, c, d, e, f, and g more than CpG ODN-2006 or IL-10 alone. Additional experiments evaluated whether CpG DNA and IL-10 up-regulate the binding of nuclear NF-
B-Rel to ISRE-
B3 cis-I
3. Naive B cells up-regulated the binding of nuclear complexes a, b, and c to ISRE-
B3 cis-I
3 upon incubation with CpG ODN-2006 for 6 h (Fig. 9A). These complexes were attenuated or supershifted by Abs to p50, p52, p65, c-Rel, and RelB; p50, p56, and c-Rel; and p50, respectively (Fig. 9B). IL-10 up-regulated complexes a, b, and c less than CpG ODN-2006, whereas CpG ODN-2006 and IL-10 up-regulated complexes a, b, and c more than CpG ODN-2006 or IL-10 alone. Thus, CpG DNA cooperates with IL-10 to increase p50, p52, p65, c-Rel, and RelB binding to I
3.
|
B2 (Fig. 8D) as well as the binding of complex c to ISRE-
B3, but did not affect the binding of complexes a and b to ISRE-
B3 (Fig. 9A). Compared with IL-4 or CpG ODN-2006 alone, CpG ODN-2006 and IL-4 attenuated the binding of complexes d and e to
B2, but did not affect or even increased the binding of complexes a, b, c, f, and g to
B2 as well as the binding of complexes a, b, and c to ISRE-
B3. Finally, CpG ODN-2006 and IL-4 up-regulated the binding of complexes a, b, c, d, and e to
B2 less efficiently than CpG ODN-2006 and IL-10. These findings suggest that IL-4 does not cooperate with IL-10 to up-regulate p50, p52, p65, c-Rel, and RelB binding to I
3. CpG DNA and IL-10 activate STAT1, STAT3, IRF1, and IRF4
Considering the key role of ISRE-
B3 and GAS sites in I
3 transcription, it was hypothesized that CpG DNA and IL-10 synergistically activate the C
3 gene by cooperatively activating STATs and IRFs. Reporter vectors carrying multiple ISRE sites (ISRE-Luc), STAT1/3-binding GAS sites (STAT1/3-Luc), and STAT6-specific GAS sites (STAT6-Luc) were used to test the induction of transcriptionally active STATs and IRFs. 2E2 B cells activated ISRE-Luc, STAT1/3-Luc, and, to a lesser extent, STAT6-Luc upon exposure to CpG ODN-2006 or IL-10, but not GpC ODN2006, for 48 h (Fig. 10A). When combined, CpG ODN-2006 and IL-10 activated ISRE-Luc and STAT1/3-Luc more efficiently than CpG ODN-2006 or IL-10 alone. Although unable to significantly activate ISRE-Luc and STAT1/3-Luc, IL-4 activated STAT6-Luc more efficiently than CpG ODN-2006 and IL-10. This activation was attenuated by CpG ODN-2006, but not by GpC ODN-2006. These findings indicate that CpG DNA cooperates with IL-10, but not IL-4, to induce transcriptionally active STATs and IRFs. They also suggest that CpG DNA attenuates IL-4-induced, STAT6-dependent gene transcription.
|
and TANK-binding kinase 1 (TBK1) (56, 59). Naive B cells up-regulated STAT1 and STAT3 phosphorylation and induced IRF1 and IRF4 nuclear translocation upon exposure to CpG ODN-2006 or IL-10 for 1 h (Fig. 10B). In contrast, CpG ODN-2006 or IL-10 did not affect STAT2 and STAT6 phosphorylation or IRF9 nuclear translocation. When combined with IL-10, CpG ODN-2006 elicited more STAT1 and STAT3 phosphorylation and more IRF1 and IRF4 nuclear translocation than CpG ODN-2006 or IL-10 alone. In addition to inducing IRF1 and IRF4 nuclear translocation, IL-4 elicited STAT2 and STAT6 phosphorylation. Notably, CpG ODN-2006 attenuated STAT6 (but not STAT2) phosphorylation and IRF4 (but not IRF1) nuclear translocation in B cells exposed to IL-4. Conversely, IL-4 attenuated STAT1 and STAT3 phosphorylation as well as IRF1 and IRF4 nuclear translocation in B cells exposed to CpG ODN-2006. Collectively, these findings indicate that CpG DNA cooperates with IL-10, but not IL-4, to activate STAT1, STAT3, IRF1, and IRF4 in B cells. They also suggest that CpG DNA interferes with the activation of STAT6 and IRF4 by IL-4.
CpG DNA and IL-10 up-regulate STAT1, STAT3, IRF1, and IRF4 binding to ISRE and GAS cis-I
3
Having shown that CpG DNA cooperates with IL-10 to increase the binding of NF-
B-Rel-containing complexes a and b to ISRE-
B3 cis-I
3 (Fig. 9, A and B), it was determined whether these complexes include IRFs and STATs (Fig. 10). Consistent with this, the binding of complexes a and b to ISRE-
B3 was attenuated by incubating nuclear proteins from CpG ODN-2006-stimulated B cells with Abs to STAT1, IRF1, and IRF4 (Fig. 9C). Further assays evaluated STAT and IRF binding to the GAS element of I
3. Naive B cells up-regulated the binding of complexes a, f, g, h, and i to GAS cis-I
3 upon exposure to CpG ODN-2006 for 6 h (Fig. 11A). These complexes were attenuated or supershifted by Abs to STAT1, STAT3, IRF1, and IRF4; STAT1, STAT3, and IRF1; STAT1, IRF1, and IRF4; STAT1 and IRF4; and IRF4, respectively (Fig. 11B). Finally, IL-10 alone or combined with CpG ODN-2006 induced more binding of complexes a, f, g, h, and i to GAS cis-I
3 than did CpG ODN-2006 alone. These findings indicate that CpG DNA and IL-10 cooperatively increase STAT and IRF binding to I
3.
|
3 (Fig. 11A). Complexes b, c, d, e, and i were attenuated or supershifted by preincubating nuclear proteins with Abs to STAT6 and IRF4 (not shown), STAT6, STAT2 and STAT6, STAT2, and IRF4, respectively (Fig. 11C). Compared with IL-4 alone, IL-4 and CpG ODN-2006 induced less binding of complexes b, c, and i to GAS cis-I
3, whereas the binding of complexes d and e remained unchanged. Finally, CpG ODN-2006 and IL-4 induced less binding of complexes f, g, h, and i to GAS cis-I
3 than CpG ODN-2006 alone. Thus, CpG DNA impairs IL-4-induced binding of STAT6 and IRF4 to I
3; conversely, IL-4 prevents CpG DNA-induced STAT1, STAT3, IRF1, and IRF4 binding to I
3.
CpG DNA and IL-10 require NF-
B-Rel, STAT1, STAT3, and IRF4 to activate I
3
The involvement of NF-
B-Rel, STAT, and IRF proteins in CpG DNA-induced germline C
gene transcription was further evaluated in 2E2 B cells transfected with DN plasmids inhibiting the activation and/or DNA-binding activity of endogenous NF-
B-Rel, STAT1, STAT3, and IRF4. Enforced expression of DN-I
B
, DN-IKK
, DN-IKK
, or, to a lesser extent, DN-NIK attenuated the activation of both I
3-Luc and
B-Luc in 2E2 B cells exposed to CpG ODN-2006 and IL-10 for 48 h (Fig. 12). In similar B cells, enforced expression of DN-STAT1, DN-IRF4, or, to a lesser extent, DN-STAT3 attenuated activation of I
3-Luc but not that of
B-Luc. These findings provide additional evidence that CpG DNA and IL-10 initiate IgG CSR by activating NF-
B-Rel, STAT, and IRF proteins.
|
| Discussion |
|---|
|
|
|---|
This is exemplified by LPS, which stimulates TI IgM production and IgG CSR by engaging TLR4 on mouse B cells (1). Not only does LPS stimulate mouse B cells to produce bacteria-specific IgM and IgG upon dual BCR and TLR4 engagement, but it also elicits polyclonal Ab production through TLR4 only (1). LPS-induced IgG CSR and Ab production would be further enhanced by BAFF, a B cell-stimulating TNF family member produced by LPS-stimulated myeloid DCs (14, 16). Like BCR and TLR4 (10, 60), BAFF receptors on B cells activate NF-
B-Rel proteins (61), which are essential for both CSR and Ab production (1). This implies that early TI IgM and IgG production results from the stimulation of both germline and somatically recombined Ag receptors with intersecting NF-
B-Rel pathways.
Human B cells lack TLR4 but express TLR9 (22), an intracellular pattern recognition receptor that detects CpG DNA from viruses and bacteria (18). Previous studies show that CpG DNA triggers B cell proliferation and TI IgM production (20, 24, 25), but do not clarify the role of CpG DNA in IgG CSR. By showing that CpG DNA elicits CSR to C
1, C
2, and C
3, our findings extend to human B cells recent data demonstrating that CpG DNA stimulates CSR to C
2a, C
2b, and C
3 in mouse B cells (62). Unlike LPS (1), CpG DNA does not elicit significant IgG production in the absence of additional stimuli. This might stem from the fact that TLR9 signals through a pathway distinct from that emanating from TLR4 (10, 22). In line with studies showing that CpG DNA induces IL-10 (22, 49) and synergizes with both IL-10 and BCR to activate B cells (24, 25), we found that CpG DNA cooperates with IL-10 and BCR cross-linking to up-regulate IgG. The expression of IgG is also enhanced by BAFF, which is released by myeloid DCs upon exposure to CpG DNA-inducible cytokines, such as IFN-
and IL-10 (14, 16, 19, 49).
Low concentrations of microbial CpG DNA are thought to favor the activation of DNA-specific B cells through dual TLR9 and BCR engagement (27, 32, 33). This response would involve B-1 and marginal zone B cells expressing poorly diversified BCRs and might be important to facilitate rapid removal of immunogenic CpG DNA released by invading pathogens. Higher concentrations of microbial CpG DNA would trigger polyclonal B cell activation mainly through TLR9 (25). Although less specific, this response might be important to amplify IgG class switching and production in Ag-primed B cells. Not only would CpG DNA favor the initiation of early TI IgG responses, but it would also amplify later-appearing TD IgG responses. Consistent with this, our results extend previous findings indicating that CpG DNA enhances IgG production in B cells exposed to CD40L (49), a TNF family member expressed by CD4+ T cells upon activation by APCs (4). CpG DNA would further enhance TD IgG production by favoring the release of IFN-
(19, 22), a powerful inducer of key T cell-costimulating molecules on APCs (21).
By showing that enforced B cell expression of
TIR-TLR9, DN-MyD88, DN-IRAK1, or DN-TRAF6 attenuates CpG DNA-induced, but not CD40L-induced, I
3 transcription and NF-
B-Rel activation, our data suggest that CpG DNA requires TLR9, MyD88, IRAK1, and TRAF6 to initiate IgG CSR. These findings are consistent with recently published data showing that TLR9 and MyD88 are required for the induction of IgG CSR in mouse B cells (62). That TLR9 accounts for CpG DNA-induced IgG CSR is also indicated by our observation that enforced B cell expression of TOLLIP, an adaptor protein that negatively regulates TLR signaling (53), or B cell exposure to chloroquine, an endosomal maturation inhibitor that interferes with CpG DNA-TLR9 interaction (39), attenuates the induction of I
3 transcription and NF-