|
|
||||||||

,

* Lautenberg Center for General and Tumor Immunology, Hebrew University Hadassah Medical School, Jerusalem, Israel;
Gastroenterology Division, Brigham and Womens Hospital, Harvard Medical School, Boston, MA 02115;
Department of Urology, Ludwig Maximilians University, Munich, Germany; and
Institute for Molecular Immunology, GSF National Research Center for the Environment and Health, Munich, Germany
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The various CEACAM proteins have different biochemical features, such as anchorage to cell surface (GPI-linked, transmembrane or secreted forms), length of cytoplasmic tail (long or short), and the presence or absence of various signal transduction motifs. It is not surprising, therefore, that these proteins are actively involved in numerous physiological and pathological processes.
CEACAM1 is a transmembrane protein that can be detected on some immune cells as well as on epithelial cells (1). Many different functions were attributed to the CEACAM1 protein. It was shown that the CEACAM1 protein exhibits antiproliferative properties in carcinomas of colon (3), prostate (4), as well as other types of cancer. Additional data support the central involvement of CEACAM1 in angiogenesis (5) and metastasis (6). CEACAM1 also has a role in the modulation of innate and adaptive immune responses. We have recently provided substantial evidence that CEACAM1 homophilic interactions inhibit NK-mediated killing activity independently of MHC class I recognition (7). This novel mechanism plays a pivotal role in the inhibition of activated decidual lymphocytes in vitro (8) and most likely also in vivo after CMV infections (8). The CEACAM1 homophilic interactions are probably important in some cases of metastatic melanoma, as increased CEACAM1 expression was observed on NK cells derived from some patients compared with healthy donors (7). Indeed, it was recently reported that there is a clear association of CEACAM1 expression on primary cutaneous melanoma lesions with the development of metastatic disease and poor survival (6). In addition, we have recently demonstrated the cardinal role of CEACAM1-mediated inhibition in maintaining NK self-tolerance in TAP2-deficient patients (9). Additional reports indicate that CEACAM1 engagement either by TCR cross-linking with mAb or by Neisseria gonorrhoeae Opa proteins inhibits T cell activation and proliferation (10, 11).
The CEACAM1 protein interacts with other CEACAM protein family members, such as CEACAM1 itself and CEACAM5 (12). It was suggested that the binding site of human CEACAM1 is located at the N-terminal Ig-V-type domain of the CEACAM1 protein, and in particular, amino acids 39V and 40D and the salt bridge between 64R and 82D were predicted to play an important role in this binding (13). Most amino acid sequences of the N-terminal domain of CEACAM1, -3, -5, and -6 are identical, and all of the predicted binding residues are conserved among the four proteins. Thus, it is expected that all these proteins would interact with each other. However, there is still no conclusive evidence for heterophilic interaction between CEACAM1 and CEACAM6, for example. This is of particular importance, because in certain tumors the CEACAM1 protein is down-regulated, followed by up-regulation of CEACAM6 protein expression (14, 15).
In this work, we demonstrate the inability of CEACAM1 to bind CEACAM6. We also directly show that the presence of both residues 43R and 44Q in the CEACAM1 is crucial for the homophilic CEACAM1 interaction and that substitution of these residues with the 43S and 44L residues that are present in CEACAM6 abolishes the inhibitory effect. Importantly, the reciprocal substitution of 43S and 44L of CEACAM6 to the 43R and 44Q residues, respectively, results in the gain of inhibitory heterophilic interactions with the CEACAM1 protein. Thus, the dichotomy of CEACAM family members by recognition of CEACAM1 is determined by the presence of R and Q at positions 43 and 44.
| Materials and Methods |
|---|
|
|
|---|
The cell lines used in this work were the MHC class I-negative 721.221 human cell line, the murine thymoma BW cell line that lacks expression of
- and
-chains of the TCR, and the NK tumor line YTS. Primary NK cells were isolated from PBL using the human NK isolation kit and the autoMACS instrument (Miltenyi Biotec, Auburn, CA). For the enrichment of CEACAM1-positive NK cells, isolated NK cells were further purified by depletion of CD16-positive NK cells, using the anti-CD16 mAb B73.1.1 and the autoMACS instrument. NK cells were grown in culture as previously described (16). CEACAM1-positive NK clones were identified by flow cytometry using the anti-CEACAM1 mAb 5F4 and were tested for inhibition in killing assays against .221/CEACAM1 cells.
Antibodies
The Abs used in this work were mAb Kat4c (DakoCytomation, Carpenteria, CA), directed against CEACAM1, -5, - 6, and -8; the anti-CD99 mAb 12E7; the rabbit polyclonal anti-CEACAM (DakoCytomation); and the specific anti-CEACAM1 mAb 5F4 (10). Rabbit polyclonal Abs against purified ubiquitin were used as the control.
Generation of CEACAM1-Ig fusion protein
The extracellular portion of the CEACAM1 protein was amplified by PCR using the following primers: the 5' primer CCCAAGCTTGGGGCCGCCACCATGGGGCACCTCTCAGCC (including the HindIII restriction site) and the 3' primer GCGGATCCCCAGGTGAGAGGC (including the BamHI restriction site). A silent mutation, adenine885guanidine (no change in glycine281) was performed by site-directed mutagenesis to cancel the BamHI site in the amplified sequence. The production of the CEACAM1-Ig and CD99-Ig fusion proteins by COS-7 cells and purification on a protein G column were previously described (8, 17). The fusion proteins were periodically analyzed for degradation by SDS-PAGE.
Generation of transfectants
The 721.221 cells expressing CEACAM1 and CEACAM6 proteins were generated as previously described (7). The CEACAM5 cDNA was subcloned into pcDNA3 vector. This construct was permanently transfected to 721.221 cells. For the generation of 721.221 cells expressing the CEACAM6 protein fused to the tail of CEACAM1, we first amplified the extracellular portion of the CEACAM6 without the GPI-anchoring sequence using the 5' primer CCCAAGCTTGCCGCCACCATGGGACCCCCCTCAGCC (including the HindIII restriction site) and the 3' primer AATGGCCCCTCCAGAGACTGTGATCATCGT (including the first nine nucleotides of the CEACAM1 transmembrane portion). The transmembrane and tail of the CEACAM1 protein were amplified with the 5' primer GTCTCTGGAGGGGCCATTGCTGGCATTG (including the last nine nucleotides of the CEACAM6 extracellular portion before the GPI anchor motif) and the 3' primer GGAATTCCTTACTGCTTTTTTACTTCTGAATA (including the EcoRI restriction site). Amplified fragments were mixed and fused by an additional PCR that was performed with the 5'-HindIII primer and the 3'-EcoRI primer. The construct was cloned into pcDNA3 vector (Invitrogen Life Technologies, Carlsbad, CA) and permanently transfected to 721.221 cells.
For the generation of BW cells expressing the chimeric CEACAM1-
protein, we used the same technique. The extracellular portion of the human CEACAM1 protein was amplified by PCR using the 5' primer CCCAAGCTTGGGGCCGCCACCATGGGGCACCTCTCAGCC (including HindIII restriction site) and the 3' primer GTAGCAGAGAGGTGAGAGGCCATTTTCTTG (including the first nine nucleotides of the mouse
-chain transmembrane portion). The mouse
-chain was amplified by PCR using the 5' primer CTCTCACCTCTCTGCTACTTGCTAGATGGA (including last nine nucleotides of human CEACAM1 extracellular portion) and the 3' primer GGAATTCCTTAGCGAGGGGCCAGGGTCTG (including EcoRI restriction site). The two amplified fragments were mixed, and PCR was performed with the 5' HindIII primer and the 3' EcoRI primer for generation of the CEACAM1-
construct. The CEACAM1-
construct was cloned into pcDNA3 expression vector (Invitrogen Life Technologies) and was stably transfected into BW cells. All transfectants were periodically monitored for expression by staining with the appropriate mAb.
Generation of 721.221 cells expressing mutated CEACAM1 or CEACAM6 proteins
For generation of the mutated CEACAM proteins, we amplified by PCR two overlapping fragments of the gene. The upstream fragment was amplified by using a gene-specific 5'-edge primer (including the HindIII restriction site) and an internal 3' primer bearing the mutation. The downstream fragment was amplified using an internal 5' primer bearing the mutation and a gene-specific 3'-edge primer (including EcoRI restriction site). Next, both purified fragments were mixed together with the 5'-edge primer and the 3'-edge primer to generate the mutated full-gene cDNA. All different mutants of the same CEACAM gene were generated using the same appropriate edge primers and different internal primers. The various cDNAs were then cloned into the pcDNA3 mammalian expression vector and stably transfected into the .221 cell line. All transfectants were periodically monitored for expression by staining with the appropriate mAb. For CEACAM1-RQ43,44SL, the 5'-CEACAM1 edge primer was CCCAAGCTTGGGGCCGCCACCATGGGGCACCTCTCAGCC, the 3'-CEACAM1 edge primer was GGAATTCCTTACTGCTTTTTTACTTCTGAATA, the 5' internal primer was GCCAACAGTCTAATTGTAGGA, and the 3' internal primer was TCCTACAATTAGACTGTTGCC. For CEACAM1-R43A, the 5' internal primer was GATGGCAACGCTCAAATTGTA, and the 3' internal primer was TACAATTTGAGCGTTGCCATC. For CEACAM1-Q44L, the 5' internal primer was ATGGCAACCGTCTAATTGTAG, and the 3' internal primer was CTACAATTAGACGGTTGCCAT. For CEACAM6-SL43,44RQ, the 5'-CEACAM6 edge primer was CCCAAGCTTGCCGCCACCATGGGACCCCCCTCAGCC, the 3'-CEACAM6 edge primer was GGAATTCCCTATATCAGAGCCACCCTGG, the 5' internal primer was GGCAACCGTCAAATTGTAGGA, and the 3' internal primer was TCCTACAATTTGACGGTTGCC. For CEACAM6-S43R, the 5' internal primer was GATGGCAACCGTCTAATTGTA, and the 3' internal primer was TACAATTAGACGGTTGCCATC. For CEACAM6-L44Q, the 5' internal primer was GATGGCAACAGTCAAATTGTA, and the 3' internal primer was TACAATTTGACTGTTGCCATC.
Cytotoxicity assays
The cytotoxic activity of YTS and NK cells against various targets was assayed in 5-h [35S]Met release assays, as described previously (16). In experiments in which rabbit polyclonal Abs were included, the final concentration was 20 µg/ml. In all cytotoxicity assays performed, spontaneous release did not exceed 20% of maximal labeling.
Cross-linking of BW/CEACAM1 cells
BW/CEACAM1 cells (0.5 x 105/well) were incubated with various amounts of Kat4c mAb on ice for 1 h in 96-well, round-bottom microplates (Nalge Nunc, Rochester, NY). Treated BW/CEACAM1-
cells, present in 200 µl of RPMI 1640 complete medium, were then cultured in 96-well, flat-bottom microplates (Nalge Nunc) precoated with 1 µg/well sheep anti-mouse IgG Abs (ICN Biomedicals, Costa Mesa, CA) for 24 h at 37°C. Supernatant was harvested, and the amount of murine IL-2 (mIL-2) was determined by ELISA.
| Results |
|---|
|
|
|---|
Recent clinical studies demonstrated that surface expression of the CEACAM1 protein on tumors is associated with poor prognosis in melanoma and lung adenocarcinoma patients (6, 18). We have shown that CEACAM1 homophilic interactions confer protection from human NK-mediated cytotoxicity (7). We have also demonstrated that in some melanoma patients bearing CEACAM1-positive tumors, a dramatic increase in the proportion of CEACAM1-positive NK cells was observed (7). Because heterophilic interactions of the CEACAM1 protein with the CEACAM6 protein were reported previously (12), and because some CEACAM1-positive tumors down-regulate the CEACAM1 protein expression and instead replace it with CEACAM6 (14, 15), it was important to investigate whether CEACAM1 can interact with CEACAM6.
721.221 (.221) cells were transfected with the CEACAM1 cDNA (.221/CEACAM1) and with the CEACAM6 cDNA (.221/CEACAM6) as described in Materials and Methods. The expression level was monitored with the Kat4c mAb (Fig. 1). For measuring direct binding of CEACAM1 to the transfected cells, the extracellular portion of the CEACAM1 fused to the Fc portion of human IgG1 (CEACAM1-Ig) was used in flow cytometry binding assays. The production and purification of the CEACAM1-Ig fusion protein were performed as described in Materials and Methods. Homophilic binding of the CEACAM1-Ig fusion protein was observed only to the .221/CEACAM1 cells (Fig. 1). In contrast, despite a slightly higher expression level of the CEACAM6 protein (detected by Kat4c mAb, Fig. 1), CEACAM1-Ig did not bind to .221/CEACAM6 cells (Fig. 1). The control CD99-Ig fusion protein did not stain any of the transfectants (data not shown).
|
-chain (BW/CEACAM1-
) as described in Materials and Methods. The specific functionality of BW/CEACAM1-
was assessed by cross-linking the CEACAM1 receptor using different amounts of immobilized Kat4c mAb as described in Materials and Methods. Engagement of the CEACAM1 protein elicited the synthesis and secretion of mIL-2 in a dose-dependent manner (Fig. 2A). Treatment with the control anti-CD99 12E7 gave no response (Fig. 2A). Next, BW parental cells and BW/CEACAM1-
were cocultured with irradiated .221, .221/CEACAM1, or .221/CEACAM6 cells for 48 h. Significant amounts of mIL-2 were detected in the supernatant of BW/CEACAM1-
cells coincubated with .221/CEACAM1 cells (Fig. 2B). In contrast, no mIL-2 was detected when BW/CEACAM1-
cells were coincubated with .221 or .221/CEACAM6 cells (Fig. 2B). No secretion of mIL-2 was observed when parental BW cells were used (Fig. 2B). These combined results clearly indicate that the CEACAM1 and CEACAM6 proteins do not bind or functionally interact.
|
Several explanations may account for the lack of heterophilic interactions between CEACAM1 and CEACAM6 proteins. CEACAM1 is a transmembrane protein, whereas CEACAM6 is GPI-anchored to the cell membrane. It is possible that the GPI anchor of CEACAM6 and the absence of transmembrane and cytosolic portions weaken the interaction. Furthermore, it is possible that other transmembrane elements play a key role in the interactions. For example, a cysteine residue located in the transmembrane domain of HLA-C was reported to be crucial for the inhibition mediated by an unknown inhibitory NK receptor (19). To test whether the GPI anchor of CEACAM6 protein is responsible for the lack of CEACAM1 binding, we generated a chimeric construct comprised of the entire extracellular portion of CEACAM6 fused to the transmembrane and tail portions of CEACAM1 (CCM6-TailCCM1). The .221 cells were stably transfected with the CCM6-TailCCM1 construct (.221/CCM6-TailCCM1). The expression level of the CCM6-TailCCM1 chimeric protein, detected by Kat4c mAb, was similar to that of the other .221/CEACAM stable transfectants (Figs. 1 and 3A). Importantly, no binding of CEACAM1-Ig was observed to .221/CCM6-TailCCM1cells (Fig. 3A). In agreement with the binding results, the presence of mIL-2 was not detected in the supernatant of BW/CEACAM1 cells coincubated with .221/CCM6-TailCCM1cells (Fig. 3B). These results indicate that the lack of heterophilic interactions of CEACAM1 and CEACAM6 is not due to the transmembrane and cytosolic tail portions of the proteins.
|
CEACAM-related proteins share a common basic structure of several sequential Ig-like domains. The Ig-like domains serve as fundamental building blocks of the various CEACAM-related proteins, and they differ only slightly from one protein to another. Importantly, the binding site of the CEACAM1 is located in the N-domain (13). Sequence alignment of the N-domains of CEACAM-related proteins, including CEACAM1, CEACAM3, CEACAM5, and CEACAM6, revealed exceptional homology (Fig. 4). Within the CEACAM1 N-domain, several amino acid residues were suggested to be crucial for binding. These include amino acids 39V and 40D (13) and the salt bridge between 64R and 82D (13). All of the above-reported amino acid residues are present in the N-domain of CEACAM6 (Fig. 4), implying that they may not account for the lack of heterophilic interactions with the CEACAM1 protein.
|
|
The binding results were also confirmed by functional assays using the BW cell system. Significant amounts of mIL-2 were detected only in supernatants of BW/CEACAM1-
cells coincubated with irradiated .221/CCM6-SL43,44RQ or .221/CEACAM1 cells (Fig. 5C). The stronger mIL-2 induction after incubation of BW/CEACAM1-
cells with the .221/CCM6-SL43,44RQ cells compared with .221/CEACAM1 cells might be due to the higher protein expression measured by Kat4c mAb (Figs. 1 and 5A). The presence of mIL-2 could not be detected in the supernatants of BW/CEACAM1-
cells coincubated with irradiated .221/CEACAM6 cell or .221/CEACAM1-RQ43,44SL (Fig. 5C). Mouse IL-2 was not detected when BW parental cells were used (data not shown). Thus, residues 43R44Q are critical for the functional CEACAM1 interactions.
Residues 43R and 44Q are critical for CEACAM1-mediated inhibition of NK cell cytotoxicity
We have previously reported that CEACAM1 plays a major role in regulation of NK cell cytotoxicity (7), inhibition of decidual immune responses after activation (8), and conferring protection from NK autoreactivity in TAP2-deficient patients (9). To test whether residues 43R44Q would also be important in the inhibition of NK killing, we isolated NK cells from several healthy donors, depleted the CD16-positive NK cells, cultured activated NK clones as described in Materials and Methods, and stained them for CEACAM1 expression.
CEACAM1-positive NK clones were assayed for cytotoxic activity against .221 parental cells and various stable transfectants, including 221/CEACAM1, .221/CEACAM6, .221/CCM6-TailCCM1, .221/CCM1-RQ43,44SL, and .221/CCM6-SL43,44RQ cells. NK cytotoxicity assays were performed with no Ab included, in the presence of anti-CEACAM polyclonal Abs, or with the control anti-ubiquitin polyclonal Abs. All NK clones efficiently killed parental .221 cells regardless of whether Abs were included (representative clone NK23 is presented in Fig. 6). As previously reported (7, 8, 9), inhibition of NK killing was observed when .221/CEACAM1 cells were used. This inhibition was the result of CEACAM1 inhibition, because anti-CEACAM Abs abrogated this effect (Fig. 6). The lack of heterophilic interactions between CEACAM1 and CEACAM6 was evident in the NK killing assays, because .221/CEACAM6 and .221/CCM6-TailCCM1 cells were killed as efficiently as parental .221 cells (Fig. 6). In agreement with the above results (Fig. 5), no inhibition was observed when .221/CCM1-RQ43,44SL cells were used (Fig. 6). Remarkably, a strong inhibition of killing was observed when CCM6-SL43,44RQ cells were used as targets (Fig. 6). The inhibition was even stronger than that observed with the homophilic CEACAM1 interactions, probably due to the higher CCM6-SL43,44RQ expression. This inhibition was the result of heterophilic interactions with CEACAM1 protein on NK cells, because killing was restored when anti-CEACAM Abs were included in the assay (Fig. 6). The control anti-ubiquitin had little or no effect when included in the assays (Fig. 6).
|
To determine whether both residues are required for binding, we mutated the amino acid residues in positions 43 and 44 in CEACAM1 (contains 43R44Q) and CEACAM6 (contains 43S44L). Using site-directed mutagenesis in the CEACAM1, we changed the 43R residue to 43A (CCM1-R43A) and the 44Q residue to 44L (CCM1-Q44L). In CEACAM6, we changed the 43S to 43R (CCM6-S43R) and 44L to 44Q (CCM6-L44Q). All mutants were generated as described in Materials and Methods and stably transfected into .221 cells. The expression level was monitored by Kat4c mAb, and conformation was monitored by 5F4 mAb (Fig. 7A). Importantly, substitution for 44Q in CEACAM1 protein by 44L in .221/CCM1-Q44L completely abrogated 5F4 binding, whereas the Kat4c binding observed was similar to that of wild-type CEACAM1 (Fig. 7A). This suggests that the 44Q residue is essential for maintaining appropriate conformation, which is crucial for binding of 5F4 mAb. Indeed, this mutation also resulted in lack of recognition by the CEACAM1-Ig (Fig. 7B). Similar results were obtained when both 44Q and 43R residues in CEACAM1 were mutated (Fig. 5). Surprisingly, however, the reciprocal mutant .221/CCM6-L44Q was not recognized by 5F4 mAb, indicating that it is not the only factor crucial for conferring the appropriate conformation for 5F4 (Fig. 7A). Compatible with the latter observation, no binding of CEACAM1-Ig to .221/CCM6-L44Q could be detected (Fig. 7B). Point mutation in the 43R residue of CEACAM1 did not affect 5F4 mAb binding (Fig. 7A), suggesting that by itself the 43R residue had no significant effect on conformation of 5F4-recognized epitope. Despite that, the CEACAM1-Ig fusion protein did not recognize .221/CEACAM1-R43A cells (Fig. 7B). Thus, elements of CEACAM1 other than the presence of the 5F4 epitope and the presence of the 44Q residue play a crucial role in CEACAM1 binding. In this regard, it should be noted that the expression level of .221/CCM1-R43A obtained was lower than the expression levels of the other transfectants (Fig. 7A), which might account for the lack of efficient binding of CEACAM1-Ig. Therefore, to test whether the 43R residue by itself can confer CEACAM1 binding, we replaced the 43S of CEACAM6 with 43R. .221/CCM6-S43R cells were not stained by either the 5F4 mAb (Fig. 7A) or the CEACAM1-Ig fusion protein (Fig. 7B). Gain-of-binding of CEACAM1-Ig to CEACAM6 was evident only when both 43S and 44L residues when replaced with 43R and 44Q, respectively (Fig. 5A). Thus, both 43R and 44Q residues are critical for interaction with CEACAM1.
|
Supporting our hypothesis, it was previously reported that CEACAM1 can heterophilically interact with the CEACAM5 protein (12). Indeed, the CEACAM5 protein is the only CEACAM family member other than CEACAM1 that contains 43R44Q residues (Fig. 4). We therefore next investigated the interactions between CEACAM1 and CEACAM5. The expression level of .221/CEACAM5 transfectant was monitored with Kat4c and was similar to that of the other CEACAM transfectants (Fig. 7D). The .221/CEACAM5 cells were not stained by the anti-CEACAM1-specific 5F4 mAb (Fig. 7D). As expected, efficient heterophilic binding of the CEACAM1-Ig fusion protein to .221/CEACAM5 was observed (Fig. 7D).
| Discussion |
|---|
|
|
|---|
N-domains such as those derived from CD80 (25) and ICAM-3 (26) have, in general, an important role in mediating protein interactions between various molecules that belong to the Ig superfamily. It was postulated previously that some proteins belonging to the CEACAM family, including CEACAM1 and CEACAM6, interact homophilically in head-to-head N-domain interactions (13, 27, 28). In addition, it was reported that the CEACAM5 protein interacts homophilically through head-to-tail interactions between the N-domain of one molecule and the B3-domain of the other (22). Interestingly, the N-domains of all CEACAM-related proteins are exceptionally homologous, with
90% homology (Fig. 4). Thus, it is expected that the various CEACAM-related proteins would interact with each other. However, in this work we demonstrate that the CEACAM1 protein does not interact with the CEACAM6 protein using both binding and various functional assays. In addition, other reports stated that CEACAM1 protein does not interact with CEACAM3 proteins (27). In view of these observations and the exceptional homology between the N-domains of the various CEACAM-related proteins, it is conceivable to assume that there are probably only a few key amino acid residues that control the interactions of CEACAM1 protein. Indeed, we show in this study that R and Q at positions 43 and 44 determine CEACAM1 interactions.
Watt and colleagues (13) proposed that amino acids 39V and 40D are critical for homophilic CEACAM1 interactions and also demonstrated that intact salt bridge between 64R and 82D enables binding activity through general stabilization of the CEACAM1 protein. However, these findings cannot explain the specificity of CEACAM1 heterophilic interactions, because all these amino acid residues are conserved in the N-domain of all CEACAM-related proteins (Fig. 4).
Taheri and colleagues (20) showed that three short sequences located in the N-domain of the CEACAM5 protein are critical for CEACAM5 homophilic interactions. These short sequences include 30GYSWYK, 42NRQII, and 80QNDTG. We therefore speculated that similar sequences might be important for the CEACAM1 interactions. Alignment of the N-domains of the various CEACAM-related proteins revealed that the main difference in these three sequences among the various CEACAM proteins is located in the 42NRQII sequence (Fig. 4). The CEACAM family can be divided into two main groups in this regard: CEACAM1 and CEACAM5 that contain 43R and 44Q residues, and CEACAM3 and CEACAM6 that contain 43S and 44L residues (Fig. 4). A clear binding of the CEACAM1-Ig fusion protein to .221 cells expressing either CEACAM1 protein or CEACAM5 protein was observed (Figs. 1 and 7), whereas no binding could be detected to .221/CEACAM6 cells (Fig. 1). Furthermore, substitution of 43R44Q residues in CEACAM1 protein with 43S44L residues resulted in complete abrogation of the homophilic interactions, which was also confirmed in various functional assays (Figs. 57). Remarkably, the reciprocal substitution of 43S44L residues of CEACAM6 with 43R44Q resulted in efficient recognition by the CEACAM1 protein evident in both binding and functional assays (Figs. 57). Moreover, point mutations in positions 43 and 44 in CEACAM1 and CEACAM6 revealed that both 43R and 44Q residues are needed for proper binding and inhibition. This conclusion is also supported by the observation that 5F4 mAb is unable to block the inhibition mediated by CEACAM1 (7, 8), and as shown in this study, 5F4 recognition is largely restricted to the 44Q residue (Fig. 7A).
Proteins of the CEACAM family can be expressed on various tumors (1). CEACAM1 expression might be advantageous to the tumor, for example by preventing NK-mediated killing (7). However, it can also be disadvantageous, because it reduces the proliferation of tumor cells (3, 4). The binding of different CEACAM members by CEACAM1, as shown in this study, is controlled by both residues 43R and 44Q. This enables fine-tuning of the immune response vs tumor proliferation. One notable example of this is the chain of events following colorectal cell transformation. During the early phases of colorectal cancer development, the cancerous cells usually express CEACAM1 protein (14, 15) despite its potential antiproliferative effects (3). This might enable the newly developing tumor to evade NK-mediated attack at the early stages at the expense of tumor growth. Later, when the immune response is no longer dominated by NK cells, CEACAM1 protein expression is down-regulated, and a concomitant up-regulation of CEACAM6 protein occurs (14, 15). The mechanism of CEACAM1 down-regulation in colorectal cancer development is still unknown. However, it has been recently reported that CEACAM1 expression is repressed at the transcriptional level during tumorigenesis of prostate cancer by the transcription repressor Sp2 (29). Because the CEACAM6 protein contains 43S and 44L residues, interactions with CEACAM1 are abolished. At this stage, rapid proliferation of the cancer cells occurs consequent to removal of the inhibitory effect exerted by the homophilic CEACAM1 interactions. At the same time, the CEACAM6 protein provides other adhesive properties (1, 27) that are also essential for further tumor development. Full delineation of the biochemical structural properties determining CEACAM1 binding and specificity might provide better tools for identifying other putative physiological ligands for CEACAM1.
| Footnotes |
|---|
1 This work was supported by research grants from the Israel Science Foundation, the Israel Cancer Association (20042031-B), the Israel Cancer Research Foundation, and the Cancer Research Institute. ![]()
2 Address correspondence and reprint requests to Dr. Ofer Mandelboim, Lautenberg Center for General and Tumor Immunology, Hebrew University Hadassah Medical School, P.O. Box 12272, Jerusalem 91120, Israel. E-mail address: oferman{at}md2.huji.ac.il ![]()
3 Abbreviations used in this paper: CEA, carcinoembryonic Ag; m, murine. CEACAM, CEA cell adhesion molecule. ![]()
Received for publication April 23, 2004. Accepted for publication July 1, 2004.
| References |
|---|
|
|
|---|
Related articles in The JI:
This article has been cited by other articles:
![]() |
T. Gambichler, S. Grothe, S. Rotterdam, P. Altmeyer, and A. Kreuter Protein Expression of Carcinoembryonic Antigen Cell Adhesion Molecules in Benign and Malignant Melanocytic Skin Lesions Am J Clin Pathol, June 1, 2009; 131(6): 782 - 787. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Chen, L. Chen, S.-W. Qiao, T. Nagaishi, and R. S. Blumberg Carcinoembryonic Antigen-Related Cell Adhesion Molecule 1 Inhibits Proximal TCR Signaling by Targeting ZAP-70 J. Immunol., May 1, 2008; 180(9): 6085 - 6093. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Stern-Ginossar, S. Nedvetzki, G. Markel, R. Gazit, G. Betser-Cohen, H. Achdout, M. Aker, R. S. Blumberg, D. M. Davis, B. Appelmelk, et al. Intercellular Transfer of Carcinoembryonic Antigen from Tumor Cells to NK Cells J. Immunol., October 1, 2007; 179(7): 4424 - 4434. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Markel, R. Seidman, N. Stern, T. Cohen-Sinai, O. Izhaki, G. Katz, M. Besser, A. J. Treves, R. S. Blumberg, R. Loewenthal, et al. Inhibition of Human Tumor-Infiltrating Lymphocyte Effector Functions by the Homophilic Carcinoembryonic Cell Adhesion Molecule 1 Interactions J. Immunol., November 1, 2006; 177(9): 6062 - 6071. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Korotkova, E. Cota, Y. Lebedin, S. Monpouet, J. Guignot, A. L. Servin, S. Matthews, and S. L. Moseley A Subfamily of Dr Adhesins of Escherichia coli Bind Independently to Decay-accelerating Factor and the N-domain of Carcinoembryonic Antigen J. Biol. Chem., September 29, 2006; 281(39): 29120 - 29130. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Williams, A. R. Bateman, and S. I. Khakoo HANGING IN THE BALANCE: KIR and Their Role in Disease Mol. Interv., August 1, 2005; 5(4): 226 - 240. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Stern, G. Markel, T. I. Arnon, R. Gruda, H. Wong, S. D. Gray-Owen, and O. Mandelboim Carcinoembryonic Antigen (CEA) Inhibits NK Killing via Interaction with CEA-Related Cell Adhesion Molecule 1 J. Immunol., June 1, 2005; 174(11): 6692 - 6701. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |