The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Markel, G.
Right arrow Articles by Mandelboim, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Markel, G.
Right arrow Articles by Mandelboim, O.
The Journal of Immunology, 2004, 173: 3732-3739.
Copyright © 2004 by The American Association of Immunologists

The Critical Role of Residues 43R and 44Q of Carcinoembryonic Antigen Cell Adhesion Molecules-1 in the Protection from Killing by Human NK Cells1

Gal Markel*, Raizy Gruda*, Hagit Achdout*, Gil Katz*, Morris Nechama*, Richard S. Blumberg{dagger}, Robert Kammerer{ddagger},§, Wolfgang Zimmermann{ddagger} and Ofer Mandelboim2,*

* Lautenberg Center for General and Tumor Immunology, Hebrew University Hadassah Medical School, Jerusalem, Israel; {dagger} Gastroenterology Division, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115; {ddagger} Department of Urology, Ludwig Maximilians University, Munich, Germany; and § Institute for Molecular Immunology, GSF National Research Center for the Environment and Health, Munich, Germany


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The multifunctional carcinoembryonic Ag cell adhesion molecule (CEACAM)1 protein has recently become the focus of intense immunological research. We have previously shown that the CEACAM1 homophilic interactions inhibit the killing activity of NK cells. This novel inhibitory mechanism plays a key role in melanoma immune evasion, inhibition of decidual immune response, and controlling NK autoreactivity in TAP2-deficient patients. These roles are mediated mainly by homophilic interactions, which are mediated through the N-domain of the CEACAM1. The N-domain of the various members of the CEACAM family shares a high degree of similarity. However, it is still unclear which of the CEACAM family members is able to interact with CEACAM1 and what are the amino acid residues that control this interaction. In this study we demonstrate that CEACAM1 interacts with CEACAM5, but not with CEACAM6. Importantly, we provide the molecular basis for CEACAM1 recognition of various CEACAM family members. Sequence alignment reveals a dichotomy among the CEACAM family members: both CEACAM1 and CEACAM5 contain the R and Q residues in positions 43 and 44, respectively, whereas CEACAM3 and CEACAM6 contain the S and L residues, respectively. Mutational analysis revealed that both 43R and 44Q residues are necessary for CEACAM1 interactions. Implications for differential expression of CEACAM family members in tumors are discussed.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The human carcinoembryonic Ag (CEA)3 protein family encompasses several forms of proteins with different biochemical features. These proteins are encoded by 29 genes tandemly arranged on chromosome 19q13.2 (1). All CEA family genes have been classified into two major subfamilies, the CEA cell adhesion molecule (CEACAM) and the pregnancy-specific glycoprotein subgroups (1). The CEACAM proteins, which are part of the larger Ig superfamily, include CEACAM1, -3, -4, -5, -6, -7, and -8. They share a common basic structure of sequentially ordered different Ig-like domain(s) and are able to interact with each other. For example, it was reported that various CEACAM proteins, such as CEACAM1 or CEACAM5, exhibit both homophilic and heterophilic interactions (2).

The various CEACAM proteins have different biochemical features, such as anchorage to cell surface (GPI-linked, transmembrane or secreted forms), length of cytoplasmic tail (long or short), and the presence or absence of various signal transduction motifs. It is not surprising, therefore, that these proteins are actively involved in numerous physiological and pathological processes.

CEACAM1 is a transmembrane protein that can be detected on some immune cells as well as on epithelial cells (1). Many different functions were attributed to the CEACAM1 protein. It was shown that the CEACAM1 protein exhibits antiproliferative properties in carcinomas of colon (3), prostate (4), as well as other types of cancer. Additional data support the central involvement of CEACAM1 in angiogenesis (5) and metastasis (6). CEACAM1 also has a role in the modulation of innate and adaptive immune responses. We have recently provided substantial evidence that CEACAM1 homophilic interactions inhibit NK-mediated killing activity independently of MHC class I recognition (7). This novel mechanism plays a pivotal role in the inhibition of activated decidual lymphocytes in vitro (8) and most likely also in vivo after CMV infections (8). The CEACAM1 homophilic interactions are probably important in some cases of metastatic melanoma, as increased CEACAM1 expression was observed on NK cells derived from some patients compared with healthy donors (7). Indeed, it was recently reported that there is a clear association of CEACAM1 expression on primary cutaneous melanoma lesions with the development of metastatic disease and poor survival (6). In addition, we have recently demonstrated the cardinal role of CEACAM1-mediated inhibition in maintaining NK self-tolerance in TAP2-deficient patients (9). Additional reports indicate that CEACAM1 engagement either by TCR cross-linking with mAb or by Neisseria gonorrhoeae Opa proteins inhibits T cell activation and proliferation (10, 11).

The CEACAM1 protein interacts with other CEACAM protein family members, such as CEACAM1 itself and CEACAM5 (12). It was suggested that the binding site of human CEACAM1 is located at the N-terminal Ig-V-type domain of the CEACAM1 protein, and in particular, amino acids 39V and 40D and the salt bridge between 64R and 82D were predicted to play an important role in this binding (13). Most amino acid sequences of the N-terminal domain of CEACAM1, -3, -5, and -6 are identical, and all of the predicted binding residues are conserved among the four proteins. Thus, it is expected that all these proteins would interact with each other. However, there is still no conclusive evidence for heterophilic interaction between CEACAM1 and CEACAM6, for example. This is of particular importance, because in certain tumors the CEACAM1 protein is down-regulated, followed by up-regulation of CEACAM6 protein expression (14, 15).

In this work, we demonstrate the inability of CEACAM1 to bind CEACAM6. We also directly show that the presence of both residues 43R and 44Q in the CEACAM1 is crucial for the homophilic CEACAM1 interaction and that substitution of these residues with the 43S and 44L residues that are present in CEACAM6 abolishes the inhibitory effect. Importantly, the reciprocal substitution of 43S and 44L of CEACAM6 to the 43R and 44Q residues, respectively, results in the gain of inhibitory heterophilic interactions with the CEACAM1 protein. Thus, the dichotomy of CEACAM family members by recognition of CEACAM1 is determined by the presence of R and Q at positions 43 and 44.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cells

The cell lines used in this work were the MHC class I-negative 721.221 human cell line, the murine thymoma BW cell line that lacks expression of {alpha}- and {beta}-chains of the TCR, and the NK tumor line YTS. Primary NK cells were isolated from PBL using the human NK isolation kit and the autoMACS instrument (Miltenyi Biotec, Auburn, CA). For the enrichment of CEACAM1-positive NK cells, isolated NK cells were further purified by depletion of CD16-positive NK cells, using the anti-CD16 mAb B73.1.1 and the autoMACS instrument. NK cells were grown in culture as previously described (16). CEACAM1-positive NK clones were identified by flow cytometry using the anti-CEACAM1 mAb 5F4 and were tested for inhibition in killing assays against .221/CEACAM1 cells.

Antibodies

The Abs used in this work were mAb Kat4c (DakoCytomation, Carpenteria, CA), directed against CEACAM1, -5, - 6, and -8; the anti-CD99 mAb 12E7; the rabbit polyclonal anti-CEACAM (DakoCytomation); and the specific anti-CEACAM1 mAb 5F4 (10). Rabbit polyclonal Abs against purified ubiquitin were used as the control.

Generation of CEACAM1-Ig fusion protein

The extracellular portion of the CEACAM1 protein was amplified by PCR using the following primers: the 5' primer CCCAAGCTTGGGGCCGCCACCATGGGGCACCTCTCAGCC (including the HindIII restriction site) and the 3' primer GCGGATCCCCAGGTGAGAGGC (including the BamHI restriction site). A silent mutation, adenine885guanidine (no change in glycine281) was performed by site-directed mutagenesis to cancel the BamHI site in the amplified sequence. The production of the CEACAM1-Ig and CD99-Ig fusion proteins by COS-7 cells and purification on a protein G column were previously described (8, 17). The fusion proteins were periodically analyzed for degradation by SDS-PAGE.

Generation of transfectants

The 721.221 cells expressing CEACAM1 and CEACAM6 proteins were generated as previously described (7). The CEACAM5 cDNA was subcloned into pcDNA3 vector. This construct was permanently transfected to 721.221 cells. For the generation of 721.221 cells expressing the CEACAM6 protein fused to the tail of CEACAM1, we first amplified the extracellular portion of the CEACAM6 without the GPI-anchoring sequence using the 5' primer CCCAAGCTTGCCGCCACCATGGGACCCCCCTCAGCC (including the HindIII restriction site) and the 3' primer AATGGCCCCTCCAGAGACTGTGATCATCGT (including the first nine nucleotides of the CEACAM1 transmembrane portion). The transmembrane and tail of the CEACAM1 protein were amplified with the 5' primer GTCTCTGGAGGGGCCATTGCTGGCATTG (including the last nine nucleotides of the CEACAM6 extracellular portion before the GPI anchor motif) and the 3' primer GGAATTCCTTACTGCTTTTTTACTTCTGAATA (including the EcoRI restriction site). Amplified fragments were mixed and fused by an additional PCR that was performed with the 5'-HindIII primer and the 3'-EcoRI primer. The construct was cloned into pcDNA3 vector (Invitrogen Life Technologies, Carlsbad, CA) and permanently transfected to 721.221 cells.

For the generation of BW cells expressing the chimeric CEACAM1-{zeta} protein, we used the same technique. The extracellular portion of the human CEACAM1 protein was amplified by PCR using the 5' primer CCCAAGCTTGGGGCCGCCACCATGGGGCACCTCTCAGCC (including HindIII restriction site) and the 3' primer GTAGCAGAGAGGTGAGAGGCCATTTTCTTG (including the first nine nucleotides of the mouse {zeta}-chain transmembrane portion). The mouse {zeta}-chain was amplified by PCR using the 5' primer CTCTCACCTCTCTGCTACTTGCTAGATGGA (including last nine nucleotides of human CEACAM1 extracellular portion) and the 3' primer GGAATTCCTTAGCGAGGGGCCAGGGTCTG (including EcoRI restriction site). The two amplified fragments were mixed, and PCR was performed with the 5' HindIII primer and the 3' EcoRI primer for generation of the CEACAM1-{zeta} construct. The CEACAM1-{zeta} construct was cloned into pcDNA3 expression vector (Invitrogen Life Technologies) and was stably transfected into BW cells. All transfectants were periodically monitored for expression by staining with the appropriate mAb.

Generation of 721.221 cells expressing mutated CEACAM1 or CEACAM6 proteins

For generation of the mutated CEACAM proteins, we amplified by PCR two overlapping fragments of the gene. The upstream fragment was amplified by using a gene-specific 5'-edge primer (including the HindIII restriction site) and an internal 3' primer bearing the mutation. The downstream fragment was amplified using an internal 5' primer bearing the mutation and a gene-specific 3'-edge primer (including EcoRI restriction site). Next, both purified fragments were mixed together with the 5'-edge primer and the 3'-edge primer to generate the mutated full-gene cDNA. All different mutants of the same CEACAM gene were generated using the same appropriate edge primers and different internal primers. The various cDNAs were then cloned into the pcDNA3 mammalian expression vector and stably transfected into the .221 cell line. All transfectants were periodically monitored for expression by staining with the appropriate mAb. For CEACAM1-RQ43,44SL, the 5'-CEACAM1 edge primer was CCCAAGCTTGGGGCCGCCACCATGGGGCACCTCTCAGCC, the 3'-CEACAM1 edge primer was GGAATTCCTTACTGCTTTTTTACTTCTGAATA, the 5' internal primer was GCCAACAGTCTAATTGTAGGA, and the 3' internal primer was TCCTACAATTAGACTGTTGCC. For CEACAM1-R43A, the 5' internal primer was GATGGCAACGCTCAAATTGTA, and the 3' internal primer was TACAATTTGAGCGTTGCCATC. For CEACAM1-Q44L, the 5' internal primer was ATGGCAACCGTCTAATTGTAG, and the 3' internal primer was CTACAATTAGACGGTTGCCAT. For CEACAM6-SL43,44RQ, the 5'-CEACAM6 edge primer was CCCAAGCTTGCCGCCACCATGGGACCCCCCTCAGCC, the 3'-CEACAM6 edge primer was GGAATTCCCTATATCAGAGCCACCCTGG, the 5' internal primer was GGCAACCGTCAAATTGTAGGA, and the 3' internal primer was TCCTACAATTTGACGGTTGCC. For CEACAM6-S43R, the 5' internal primer was GATGGCAACCGTCTAATTGTA, and the 3' internal primer was TACAATTAGACGGTTGCCATC. For CEACAM6-L44Q, the 5' internal primer was GATGGCAACAGTCAAATTGTA, and the 3' internal primer was TACAATTTGACTGTTGCCATC.

Cytotoxicity assays

The cytotoxic activity of YTS and NK cells against various targets was assayed in 5-h [35S]Met release assays, as described previously (16). In experiments in which rabbit polyclonal Abs were included, the final concentration was 20 µg/ml. In all cytotoxicity assays performed, spontaneous release did not exceed 20% of maximal labeling.

Cross-linking of BW/CEACAM1 cells

BW/CEACAM1 cells (0.5 x 105/well) were incubated with various amounts of Kat4c mAb on ice for 1 h in 96-well, round-bottom microplates (Nalge Nunc, Rochester, NY). Treated BW/CEACAM1-{zeta} cells, present in 200 µl of RPMI 1640 complete medium, were then cultured in 96-well, flat-bottom microplates (Nalge Nunc) precoated with 1 µg/well sheep anti-mouse IgG Abs (ICN Biomedicals, Costa Mesa, CA) for 24 h at 37°C. Supernatant was harvested, and the amount of murine IL-2 (mIL-2) was determined by ELISA.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CEACAM1 protein does not recognize CEACAM6

Recent clinical studies demonstrated that surface expression of the CEACAM1 protein on tumors is associated with poor prognosis in melanoma and lung adenocarcinoma patients (6, 18). We have shown that CEACAM1 homophilic interactions confer protection from human NK-mediated cytotoxicity (7). We have also demonstrated that in some melanoma patients bearing CEACAM1-positive tumors, a dramatic increase in the proportion of CEACAM1-positive NK cells was observed (7). Because heterophilic interactions of the CEACAM1 protein with the CEACAM6 protein were reported previously (12), and because some CEACAM1-positive tumors down-regulate the CEACAM1 protein expression and instead replace it with CEACAM6 (14, 15), it was important to investigate whether CEACAM1 can interact with CEACAM6.

721.221 (.221) cells were transfected with the CEACAM1 cDNA (.221/CEACAM1) and with the CEACAM6 cDNA (.221/CEACAM6) as described in Materials and Methods. The expression level was monitored with the Kat4c mAb (Fig. 1). For measuring direct binding of CEACAM1 to the transfected cells, the extracellular portion of the CEACAM1 fused to the Fc portion of human IgG1 (CEACAM1-Ig) was used in flow cytometry binding assays. The production and purification of the CEACAM1-Ig fusion protein were performed as described in Materials and Methods. Homophilic binding of the CEACAM1-Ig fusion protein was observed only to the .221/CEACAM1 cells (Fig. 1). In contrast, despite a slightly higher expression level of the CEACAM6 protein (detected by Kat4c mAb, Fig. 1), CEACAM1-Ig did not bind to .221/CEACAM6 cells (Fig. 1). The control CD99-Ig fusion protein did not stain any of the transfectants (data not shown).



View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 1. CEACAM1-Ig do not recognize the CEACAM6 protein. Stable .221/CEACAM1 and .221/CEACAM6 were generated as described. The expression level was monitored with the Kat4c mAb (empty histograms). Binding of CEACAM1 was assessed with the CEACAM1-Ig fusion protein (empty histograms). The reagents used are indicated in each histogram. The background (shaded histograms) is the corresponding staining of .221 parental cells. This figure shows one representative experiment of 20 performed.

 
The potential heterophilic interactions between the CEACAM1 and CEACAM6 proteins were further investigated using the BW cell system. BW cells were stably transfected with the extracellular portion of the CEACAM1 fused to mouse {zeta}-chain (BW/CEACAM1-{zeta}) as described in Materials and Methods. The specific functionality of BW/CEACAM1-{zeta} was assessed by cross-linking the CEACAM1 receptor using different amounts of immobilized Kat4c mAb as described in Materials and Methods. Engagement of the CEACAM1 protein elicited the synthesis and secretion of mIL-2 in a dose-dependent manner (Fig. 2A). Treatment with the control anti-CD99 12E7 gave no response (Fig. 2A). Next, BW parental cells and BW/CEACAM1-{zeta} were cocultured with irradiated .221, .221/CEACAM1, or .221/CEACAM6 cells for 48 h. Significant amounts of mIL-2 were detected in the supernatant of BW/CEACAM1-{zeta} cells coincubated with .221/CEACAM1 cells (Fig. 2B). In contrast, no mIL-2 was detected when BW/CEACAM1-{zeta} cells were coincubated with .221 or .221/CEACAM6 cells (Fig. 2B). No secretion of mIL-2 was observed when parental BW cells were used (Fig. 2B). These combined results clearly indicate that the CEACAM1 and CEACAM6 proteins do not bind or functionally interact.



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 2. CEACAM1 and the CEACAM6 proteins do not functionally interact. A, The amount of mIL-2 in culture supernatant of Kat4c-treated and control 12E7 BW/CEACAM1-{zeta} cells as measured by ELISA. The x-axis is the amount of immobilized mAb per reaction, and the y-axis is the optic density at a wavelength of 650 nm. This figure shows the mean of three independent experiments. B, mIL-2 secretion by BW parental cells or by BW/CEACAM1-{zeta} cells coincubated for 48 h with irradiated .221, .221/CEACAM1, or with .221/CEACAM6 cells. The y-axis is the optic density at a wavelength of 650 nm. The average of four independent experiments is shown.

 
GPI anchorage of CEACAM6 is not responsible for the lack of heterophilic interactions with the CEACAM1

Several explanations may account for the lack of heterophilic interactions between CEACAM1 and CEACAM6 proteins. CEACAM1 is a transmembrane protein, whereas CEACAM6 is GPI-anchored to the cell membrane. It is possible that the GPI anchor of CEACAM6 and the absence of transmembrane and cytosolic portions weaken the interaction. Furthermore, it is possible that other transmembrane elements play a key role in the interactions. For example, a cysteine residue located in the transmembrane domain of HLA-C was reported to be crucial for the inhibition mediated by an unknown inhibitory NK receptor (19). To test whether the GPI anchor of CEACAM6 protein is responsible for the lack of CEACAM1 binding, we generated a chimeric construct comprised of the entire extracellular portion of CEACAM6 fused to the transmembrane and tail portions of CEACAM1 (CCM6-TailCCM1). The .221 cells were stably transfected with the CCM6-TailCCM1 construct (.221/CCM6-TailCCM1). The expression level of the CCM6-TailCCM1 chimeric protein, detected by Kat4c mAb, was similar to that of the other .221/CEACAM stable transfectants (Figs. 1 and 3A). Importantly, no binding of CEACAM1-Ig was observed to .221/CCM6-TailCCM1cells (Fig. 3A). In agreement with the binding results, the presence of mIL-2 was not detected in the supernatant of BW/CEACAM1 cells coincubated with .221/CCM6-TailCCM1cells (Fig. 3B). These results indicate that the lack of heterophilic interactions of CEACAM1 and CEACAM6 is not due to the transmembrane and cytosolic tail portions of the proteins.



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 3. Substitution of the GPI link of CEACAM6 with the transmembrane and tail of CEACAM1 does not induce heterophilic binding. A, Staining of .221/CCM6-TailCCM1 cells with Kat4c (empty histogram) mAb or CEACAM1-Ig (empty histogram). The reagents used are indicated in each histogram. The background is the staining of .221 parental cells (shaded histogram). This figure shows one representative experiment of 10 performed. B, mIL-2 secretion by BW/CEACAM1-{zeta} cells coincubated for 48 h with irradiated .221 or with .221 transfectants. The y-axis indicates the optic density at a wavelength of 650 nm. The average of four independent experiments is shown.

 
Residues 43R and 44Q are critical for CEACAM1 binding

CEACAM-related proteins share a common basic structure of several sequential Ig-like domains. The Ig-like domains serve as fundamental building blocks of the various CEACAM-related proteins, and they differ only slightly from one protein to another. Importantly, the binding site of the CEACAM1 is located in the N-domain (13). Sequence alignment of the N-domains of CEACAM-related proteins, including CEACAM1, CEACAM3, CEACAM5, and CEACAM6, revealed exceptional homology (Fig. 4). Within the CEACAM1 N-domain, several amino acid residues were suggested to be crucial for binding. These include amino acids 39V and 40D (13) and the salt bridge between 64R and 82D (13). All of the above-reported amino acid residues are present in the N-domain of CEACAM6 (Fig. 4), implying that they may not account for the lack of heterophilic interactions with the CEACAM1 protein.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 4. Sequence alignment of CEACAM family members. Letters in bold indicate amino acid residue 1. Identical residues of the known motifs crucial for binding are underlined. Different residues in the binding motifs are highlighted with black (for RQ residues) or gray (for SL residues) backgrounds.

 
Taheri et al. (20) demonstrated that three short sequences located in the N-domain of CEACAM5 are critical for CEACAM5 homophilic interactions. These short sequences include 30GYSWYK, 42NRQII, and 80QNDTG. Importantly, these three short sequences are present in the N-domain of the CEACAM1 protein. However, only the 30GYSWYK and 80QNDTG short sequences are preserved in the N-domain of the CEACAM6 protein, whereas the 43R44Q residues are replaced with 43S44L residues within the 42NRQII sequence (Fig. 4). We have therefore generated a mutated construct of the CEACAM6 gene that includes amino acids R and Q at positions 43 and 44 instead of S and L, respectively (CCM6-SL43,44RQ). In addition, we have generated the reciprocal mutation in CEACAM1 that includes amino acids S and L at positions 43 and 44 instead of R and Q, respectively (CCM1-RQ43,44SL). The .221 cells were stably transfected with the various constructs and tested for expression using Kat4c mAb (Fig. 5A). The expression levels of the mutated proteins were similar to those of CEACAM1 and CEACAM6 (Figs. 1 and 5A).



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 5. Recognition of CEACAM1 is dependent on the presence of 43R44Q. A, Staining of .221/CCM1-RQ43,44SL or .221/CCM6-SL43,44RQ cells with Kat4c mAb or CEACAM1-Ig fusion protein as indicated in each histogram. The corresponding staining of .221 parental cells was used as background (sheded histograms). This figure shows one representative experiment of six performed. B, Staining of .221/CCM1-RQ43,44SL or .221/CCM6-SL43,44RQ cells with the conformation-dependent 5F4 mAb (thick lines). The corresponding staining of .221 parental cells was used as background (thin lines). This figure shows one representative experiment of six performed. C, mIL-2 secretion by BW/CEACAM1-{zeta} cells coincubated for 48 h with irradiated .221 or .221 transfectants. The y-axis indicates the optic density at a wavelength of 650 nm. The average of five independent experiments is shown.

 
Next, we tested .221/CCM6-SL43,44RQ and .221/CCM1-RQ43,44SL in flow cytometry binding assays using CEACAM1-Ig. Remarkably, substitution of 43R44Q with 43S44L in .221/CCM1-RQ43,44SL abolished homophilic binding (Fig. 5A). This abolishment was probably not merely due to a steric disturbance of the CEACAM1 N-domain structure, because the reciprocal mutation, 43S44L with 43R44Q in .221/CCM6-SL43,44RQ, conferred strong binding of the CEACAM1-Ig fusion protein (Fig. 5A). The CD99-Ig fusion protein did not stain any of the transfectants (data not shown). Strikingly, recognition of the mutated CEACAM1 protein by the conformation-dependent anti-CEACAM1 mAb 5F4 (10, 13), was abolished, whereas specific staining of .221/CCM6-SL43,44RQ was observed (Fig. 5B). These results imply that the 43R and 44Q residues are critically involved in conferring the appropriate conformation required for recognition by CEACAM1.

The binding results were also confirmed by functional assays using the BW cell system. Significant amounts of mIL-2 were detected only in supernatants of BW/CEACAM1-{zeta} cells coincubated with irradiated .221/CCM6-SL43,44RQ or .221/CEACAM1 cells (Fig. 5C). The stronger mIL-2 induction after incubation of BW/CEACAM1-{zeta} cells with the .221/CCM6-SL43,44RQ cells compared with .221/CEACAM1 cells might be due to the higher protein expression measured by Kat4c mAb (Figs. 1 and 5A). The presence of mIL-2 could not be detected in the supernatants of BW/CEACAM1-{zeta} cells coincubated with irradiated .221/CEACAM6 cell or .221/CEACAM1-RQ43,44SL (Fig. 5C). Mouse IL-2 was not detected when BW parental cells were used (data not shown). Thus, residues 43R44Q are critical for the functional CEACAM1 interactions.

Residues 43R and 44Q are critical for CEACAM1-mediated inhibition of NK cell cytotoxicity

We have previously reported that CEACAM1 plays a major role in regulation of NK cell cytotoxicity (7), inhibition of decidual immune responses after activation (8), and conferring protection from NK autoreactivity in TAP2-deficient patients (9). To test whether residues 43R44Q would also be important in the inhibition of NK killing, we isolated NK cells from several healthy donors, depleted the CD16-positive NK cells, cultured activated NK clones as described in Materials and Methods, and stained them for CEACAM1 expression.

CEACAM1-positive NK clones were assayed for cytotoxic activity against .221 parental cells and various stable transfectants, including 221/CEACAM1, .221/CEACAM6, .221/CCM6-TailCCM1, .221/CCM1-RQ43,44SL, and .221/CCM6-SL43,44RQ cells. NK cytotoxicity assays were performed with no Ab included, in the presence of anti-CEACAM polyclonal Abs, or with the control anti-ubiquitin polyclonal Abs. All NK clones efficiently killed parental .221 cells regardless of whether Abs were included (representative clone NK23 is presented in Fig. 6). As previously reported (7, 8, 9), inhibition of NK killing was observed when .221/CEACAM1 cells were used. This inhibition was the result of CEACAM1 inhibition, because anti-CEACAM Abs abrogated this effect (Fig. 6). The lack of heterophilic interactions between CEACAM1 and CEACAM6 was evident in the NK killing assays, because .221/CEACAM6 and .221/CCM6-TailCCM1 cells were killed as efficiently as parental .221 cells (Fig. 6). In agreement with the above results (Fig. 5), no inhibition was observed when .221/CCM1-RQ43,44SL cells were used (Fig. 6). Remarkably, a strong inhibition of killing was observed when CCM6-SL43,44RQ cells were used as targets (Fig. 6). The inhibition was even stronger than that observed with the homophilic CEACAM1 interactions, probably due to the higher CCM6-SL43,44RQ expression. This inhibition was the result of heterophilic interactions with CEACAM1 protein on NK cells, because killing was restored when anti-CEACAM Abs were included in the assay (Fig. 6). The control anti-ubiquitin had little or no effect when included in the assays (Fig. 6).



View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 6. NK-mediated cytotoxicity. CEACAM1-positive NK clones were obtained as described in Materials and Methods. NK clones were tested in killing assays against the indicated cells in an E:T cell ratio of 2:1. When rabbit polyclonal Abs were included in the assays, the final concentration was 20 µg/ml. This figure shows the results of a representative NK clone.

 
Specificity of CEACAM1 binding to CEACAM6 is controlled by the presence of both 43R and 44Q residues

To determine whether both residues are required for binding, we mutated the amino acid residues in positions 43 and 44 in CEACAM1 (contains 43R44Q) and CEACAM6 (contains 43S44L). Using site-directed mutagenesis in the CEACAM1, we changed the 43R residue to 43A (CCM1-R43A) and the 44Q residue to 44L (CCM1-Q44L). In CEACAM6, we changed the 43S to 43R (CCM6-S43R) and 44L to 44Q (CCM6-L44Q). All mutants were generated as described in Materials and Methods and stably transfected into .221 cells. The expression level was monitored by Kat4c mAb, and conformation was monitored by 5F4 mAb (Fig. 7A). Importantly, substitution for 44Q in CEACAM1 protein by 44L in .221/CCM1-Q44L completely abrogated 5F4 binding, whereas the Kat4c binding observed was similar to that of wild-type CEACAM1 (Fig. 7A). This suggests that the 44Q residue is essential for maintaining appropriate conformation, which is crucial for binding of 5F4 mAb. Indeed, this mutation also resulted in lack of recognition by the CEACAM1-Ig (Fig. 7B). Similar results were obtained when both 44Q and 43R residues in CEACAM1 were mutated (Fig. 5). Surprisingly, however, the reciprocal mutant .221/CCM6-L44Q was not recognized by 5F4 mAb, indicating that it is not the only factor crucial for conferring the appropriate conformation for 5F4 (Fig. 7A). Compatible with the latter observation, no binding of CEACAM1-Ig to .221/CCM6-L44Q could be detected (Fig. 7B). Point mutation in the 43R residue of CEACAM1 did not affect 5F4 mAb binding (Fig. 7A), suggesting that by itself the 43R residue had no significant effect on conformation of 5F4-recognized epitope. Despite that, the CEACAM1-Ig fusion protein did not recognize .221/CEACAM1-R43A cells (Fig. 7B). Thus, elements of CEACAM1 other than the presence of the 5F4 epitope and the presence of the 44Q residue play a crucial role in CEACAM1 binding. In this regard, it should be noted that the expression level of .221/CCM1-R43A obtained was lower than the expression levels of the other transfectants (Fig. 7A), which might account for the lack of efficient binding of CEACAM1-Ig. Therefore, to test whether the 43R residue by itself can confer CEACAM1 binding, we replaced the 43S of CEACAM6 with 43R. .221/CCM6-S43R cells were not stained by either the 5F4 mAb (Fig. 7A) or the CEACAM1-Ig fusion protein (Fig. 7B). Gain-of-binding of CEACAM1-Ig to CEACAM6 was evident only when both 43S and 44L residues when replaced with 43R and 44Q, respectively (Fig. 5A). Thus, both 43R and 44Q residues are critical for interaction with CEACAM1.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 7. Both the 43 and 44 residues of CEACAM1 are crucial for the interaction. A, Staining of .221 and various .221 stable transfectants with 5F4 mAb ({cjs2108}) or with Kat4c ({blacksquare}). The staining of the secondary reagent FITC-conjugated goat anti-mouse F(ab')2 of each cell type was used as background ({square}). The y-axis indicates the median fluorescence intensity (MFI). This figure shows one representative experiment of four performed. B, Staining of .221 and various .221 stable transfectants with CEACAM1-Ig fusion protein. The y-axis indicates the median fluorescence intensity (MFI). This figure shows one representative experiment of four performed. C, YTS cells expressing the CEACAM1 protein (YTS/CCM1) or mock-transfected (YTS/control) were tested in killing assays against .221 and .221 transfectants. The E:T cell ratio was 2:1. This figure shows the average of three independent experiments. D, Staining of .221/CEACAM5 cells with 5F4, Kat4c, or CEACAM1-Ig was performed as indicated in each histogram. The corresponding staining of .221 parental cells was used as background (thin lines). This figure shows one representative experiment of six performed.

 
The binding results were also confirmed in functional killing assays. To optimize the isolation of the experimental variables, we used the YTS NK tumor line. The NK tumor line YTS was either mock-transfected (YTS/control) or transfected with CEACAM1 protein (YTS/CCM1) as previously described (7) and tested in killing assays against the various .221 transfectants. The function of CEACAM1 protein in YTS/CCM1 cells was confirmed, because killing of .221/CEACAM1 cells was inhibited compared with killing by YTS/control cells, whereas .221/CEACAM6 and .221/CCM6-TailCCM1 cells were killed with similar efficiency (Fig. 7C). In agreement with the CEACAM1-Ig binding results, the inhibition of YTS/CCM1 cells was abolished when the .221/CCM1-RQ43,44SL and .221/CCM1-Q44L transfectants were used as targets (Fig. 7C), demonstrating the critical role of residue 44Q. However, in agreement with our above observation, the presence of 44Q only is not enough to confer inhibition, and only a mild inhibitory effect was observed when the .221/CCM1-R43A cells were used (Fig. 7C). This result was also supported by the observation that inhibition of YTS/CCM1 cells by heterophilic interactions with CEACAM6 was observed only with the .221/CCM6-SL43,44RQ double mutation, whereas no inhibition was observed when .221/CCM6-S43R or .221/CCM6-L44Q cells were used (Fig. 7C). Similar results were obtained with primary NK clones (data not shown). In conclusion, both R and Q residues in positions 43 and 44, respectively, are required for functional interaction with CEACAM1.

Supporting our hypothesis, it was previously reported that CEACAM1 can heterophilically interact with the CEACAM5 protein (12). Indeed, the CEACAM5 protein is the only CEACAM family member other than CEACAM1 that contains 43R44Q residues (Fig. 4). We therefore next investigated the interactions between CEACAM1 and CEACAM5. The expression level of .221/CEACAM5 transfectant was monitored with Kat4c and was similar to that of the other CEACAM transfectants (Fig. 7D). The .221/CEACAM5 cells were not stained by the anti-CEACAM1-specific 5F4 mAb (Fig. 7D). As expected, efficient heterophilic binding of the CEACAM1-Ig fusion protein to .221/CEACAM5 was observed (Fig. 7D).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
During the past decade many different functions were implicated for the CEACAM1 protein. These include immune regulation (7, 8, 9, 10, 11), inhibition of cancer proliferation (3, 4), insulin clearance (21), differentiation and arrangement of tissue three-dimensional structure (22), intercellular adhesion (23), and bacterial protein binding (24). We have recently demonstrated that the homophilic CEACAM1 interactions are strong enough to deliver inhibitory signals and thereby decrease human NK-mediated cytotoxicity and decidual lymphocyte functions (7, 8, 9). Most of the above activities are mediated via homophilic and heterophilic interactions of the CEACAM1 protein. The various CEACAM1-mediated activities are regulated by the expression of CEACAM1 protein on different cells, the levels of CEACAM1 expression, and the expression of potential ligands for CEACAM1. Therefore, elucidating the molecular basis of CEACAM1 binding might result in novel treatments for either preventing or augmenting the above functions.

N-domains such as those derived from CD80 (25) and ICAM-3 (26) have, in general, an important role in mediating protein interactions between various molecules that belong to the Ig superfamily. It was postulated previously that some proteins belonging to the CEACAM family, including CEACAM1 and CEACAM6, interact homophilically in head-to-head N-domain interactions (13, 27, 28). In addition, it was reported that the CEACAM5 protein interacts homophilically through head-to-tail interactions between the N-domain of one molecule and the B3-domain of the other (22). Interestingly, the N-domains of all CEACAM-related proteins are exceptionally homologous, with ~90% homology (Fig. 4). Thus, it is expected that the various CEACAM-related proteins would interact with each other. However, in this work we demonstrate that the CEACAM1 protein does not interact with the CEACAM6 protein using both binding and various functional assays. In addition, other reports stated that CEACAM1 protein does not interact with CEACAM3 proteins (27). In view of these observations and the exceptional homology between the N-domains of the various CEACAM-related proteins, it is conceivable to assume that there are probably only a few key amino acid residues that control the interactions of CEACAM1 protein. Indeed, we show in this study that R and Q at positions 43 and 44 determine CEACAM1 interactions.

Watt and colleagues (13) proposed that amino acids 39V and 40D are critical for homophilic CEACAM1 interactions and also demonstrated that intact salt bridge between 64R and 82D enables binding activity through general stabilization of the CEACAM1 protein. However, these findings cannot explain the specificity of CEACAM1 heterophilic interactions, because all these amino acid residues are conserved in the N-domain of all CEACAM-related proteins (Fig. 4).

Taheri and colleagues (20) showed that three short sequences located in the N-domain of the CEACAM5 protein are critical for CEACAM5 homophilic interactions. These short sequences include 30GYSWYK, 42NRQII, and 80QNDTG. We therefore speculated that similar sequences might be important for the CEACAM1 interactions. Alignment of the N-domains of the various CEACAM-related proteins revealed that the main difference in these three sequences among the various CEACAM proteins is located in the 42NRQII sequence (Fig. 4). The CEACAM family can be divided into two main groups in this regard: CEACAM1 and CEACAM5 that contain 43R and 44Q residues, and CEACAM3 and CEACAM6 that contain 43S and 44L residues (Fig. 4). A clear binding of the CEACAM1-Ig fusion protein to .221 cells expressing either CEACAM1 protein or CEACAM5 protein was observed (Figs. 1 and 7), whereas no binding could be detected to .221/CEACAM6 cells (Fig. 1). Furthermore, substitution of 43R44Q residues in CEACAM1 protein with 43S44L residues resulted in complete abrogation of the homophilic interactions, which was also confirmed in various functional assays (Figs. 5–7). Remarkably, the reciprocal substitution of 43S44L residues of CEACAM6 with 43R44Q resulted in efficient recognition by the CEACAM1 protein evident in both binding and functional assays (Figs. 5–7). Moreover, point mutations in positions 43 and 44 in CEACAM1 and CEACAM6 revealed that both 43R and 44Q residues are needed for proper binding and inhibition. This conclusion is also supported by the observation that 5F4 mAb is unable to block the inhibition mediated by CEACAM1 (7, 8), and as shown in this study, 5F4 recognition is largely restricted to the 44Q residue (Fig. 7A).

Proteins of the CEACAM family can be expressed on various tumors (1). CEACAM1 expression might be advantageous to the tumor, for example by preventing NK-mediated killing (7). However, it can also be disadvantageous, because it reduces the proliferation of tumor cells (3, 4). The binding of different CEACAM members by CEACAM1, as shown in this study, is controlled by both residues 43R and 44Q. This enables fine-tuning of the immune response vs tumor proliferation. One notable example of this is the chain of events following colorectal cell transformation. During the early phases of colorectal cancer development, the cancerous cells usually express CEACAM1 protein (14, 15) despite its potential antiproliferative effects (3). This might enable the newly developing tumor to evade NK-mediated attack at the early stages at the expense of tumor growth. Later, when the immune response is no longer dominated by NK cells, CEACAM1 protein expression is down-regulated, and a concomitant up-regulation of CEACAM6 protein occurs (14, 15). The mechanism of CEACAM1 down-regulation in colorectal cancer development is still unknown. However, it has been recently reported that CEACAM1 expression is repressed at the transcriptional level during tumorigenesis of prostate cancer by the transcription repressor Sp2 (29). Because the CEACAM6 protein contains 43S and 44L residues, interactions with CEACAM1 are abolished. At this stage, rapid proliferation of the cancer cells occurs consequent to removal of the inhibitory effect exerted by the homophilic CEACAM1 interactions. At the same time, the CEACAM6 protein provides other adhesive properties (1, 27) that are also essential for further tumor development. Full delineation of the biochemical structural properties determining CEACAM1 binding and specificity might provide better tools for identifying other putative physiological ligands for CEACAM1.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by research grants from the Israel Science Foundation, the Israel Cancer Association (20042031-B), the Israel Cancer Research Foundation, and the Cancer Research Institute. Back

2 Address correspondence and reprint requests to Dr. Ofer Mandelboim, Lautenberg Center for General and Tumor Immunology, Hebrew University Hadassah Medical School, P.O. Box 12272, Jerusalem 91120, Israel. E-mail address: oferman{at}md2.huji.ac.il Back

3 Abbreviations used in this paper: CEA, carcinoembryonic Ag; m, murine. CEACAM, CEA cell adhesion molecule. Back

Received for publication April 23, 2004. Accepted for publication July 1, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Beauchemin, N., P. Draber, G. Dveksler, P. Gold, S. Gray-Owen, F. Grunert, S. Hammarstrom, K. V. Holmes, A. Karlsson, M. Kuroki, et al 1999. Redefined nomenclature for members of the carcinoembryonic antigen family. Exp. Cell Res. 252:243.[Medline]
  2. Benchimol, S., A. Fuks, S. Jothy, N. Beauchemin, K. Shirota, C. P. Stanners. 1989. Carcinoembryonic antigen, a human tumor marker, functions as an intercellular adhesion molecule. Cell 57:327.[Medline]
  3. Beauchemin, N., T. Kunath, J. Robitaille, B. Chow, C. Turbide, E. Daniels, A. Veillette. 1997. Association of biliary glycoprotein with protein tyrosine phosphatase SHP-1 in malignant colon epithelial cells. Oncogene 14:783.[Medline]
  4. Busch, C., T. A. Hanssen, C. Wagener, B. Obrink. 2002. Down-regulation of CEACAM1 in human prostate cancer: correlation with loss of cell polarity, increased proliferation rate, and Gleason grade 3 to 4 transition. Hum. Pathol. 33:290.[Medline]
  5. Volpert, O., W. Luo, T. J. Liu, V. T. Estrera, C. Logothetis, S. H. Lin. 2002. Inhibition of prostate tumor angiogenesis by the tumor suppressor CEACAM1. J. Biol. Chem. 277:35696.[Abstract/Free Full Text]
  6. Thies, A., I. Moll, J. Berger, C. Wagener, J. Brummer, H. J. Schulze, G. Brunner, U. Schumacher. 2002. CEACAM1 expression in cutaneous malignant melanoma predicts the development of metastatic disease. J. Clin. Oncol. 20:2530.[Abstract/Free Full Text]
  7. Markel, G., N. Lieberman, G. Katz, T. I. Arnon, M. Lotem, O. Drize, R. S. Blumberg, E. Bar-Haim, R. Mader, L. Eisenbach, et al 2002. CD66a interactions between human melanoma and NK cells: a novel class I MHC-independent inhibitory mechanism of cytotoxicity. J. Immunol. 168:2803.[Abstract/Free Full Text]
  8. Markel, G., D. Wolf, J. Hanna, R. Gazit, D. Goldman-Wohl, Y. Lavy, S. Yagel, O. Mandelboim. 2002. Pivotal role of CEACAM1 protein in the inhibition of activated decidual lymphocyte functions. J. Clin. Invest. 110:943.[Medline]
  9. Markel, G., H. Mussaffi, K. L. Ling, M. Salio, S. Gadola, G. Steuer, H. Blau, H. Achdout, M. De Miguel, T. Gonen-Gross, et al 2003. The mechanisms controlling NK cell autoreactivity in TAP2-deficient patients. Blood 103:1770.
  10. Morales, V. M., A. Christ, S. M. Watt, H. S. Kim, K. W. Johnson, N. Utku, A. M. Texieira, A. Mizoguchi, E. Mizoguchi, G. J. Russell, et al 1999. Regulation of human intestinal intraepithelial lymphocyte cytolytic function by biliary glycoprotein (CD66a). J. Immunol. 163:1363.[Abstract/Free Full Text]
  11. Boulton, I. C., S. D. Gray-Owen. 2002. Neisserial binding to CEACAM1 arrests the activation and proliferation of CD4+ T lymphocytes. Nat. Immunol. 3:229.[Medline]
  12. Oikawa, S., M. Kuroki, Y. Matsuoka, G. Kosaki, H. Nakazato. 1992. Homotypic and heterotypic Ca++-independent cell adhesion activities of biliary glycoprotein, a member of carcinoembryonic antigen family, expressed on CHO cell surface. Biochem. Biophys. Res. Commun. 186:881.[Medline]
  13. Watt, S. M., A. M. Teixeira, G. Q. Zhou, R. Doyonnas, Y. Zhang, F. Grunert, R. S. Blumberg, M. Kuroki, K. M. Skubitz, P. A. Bates. 2001. Homophilic adhesion of human CEACAM1 involves N-terminal domain interactions: structural analysis of the binding site. Blood 98:1469.[Abstract/Free Full Text]
  14. Thompson, J., M. Seitz, E. Chastre, M. Ditter, C. Aldrian, C. Gespach, W. Zimmermann. 1997. Down-regulation of carcinoembryonic antigen family member 2 expression is an early event in colorectal tumorigenesis. Cancer Res. 57:1776.[Abstract/Free Full Text]
  15. Neumaier, M., S. Paululat, A. Chan, P. Matthaes, C. Wagener. 1993. Biliary glycoprotein, a potential human cell adhesion molecule, is down-regulated in colorectal carcinomas. Proc. Natl. Acad. Sci. USA 90:10744.[Abstract/Free Full Text]
  16. Mandelboim, O., H. T. Reyburn, M. Vales-Gomez, L. Pazmany, M. Colonna, G. Borsellino, J. L. Strominger. 1996. Protection from lysis by natural killer cells of group 1 and 2 specificity is mediated by residue 80 in human histocompatibility leukocyte antigen C alleles and also occurs with empty major histocompatibility complex molecules. J. Exp. Med. 84:913.
  17. Katz, G., G. Markel, S. Mizrahi, T. I. Arnon, O. Mandelboim. 2001. Recognition of human leukocyte antigen (HLA)-Cw4 but not -Cw6 by the natural killer cell receptor KIR2DS4. J. Immunol. 166:7260.[Abstract/Free Full Text]
  18. Laack, E., H. Nikbakht, A. Peters, C. Kugler, Y. Jasiewicz, L. Edler, J. Brummer, U. Schumacher, D. K. Hossfeld. 2002. Expression of CEACAM1 in adenocarcinoma of the lung: a factor of independent prognostic significance. J. Clin. Oncol. 20:4279.[Abstract/Free Full Text]
  19. Davis, D. M., O. Mandelboim, I. Luque, E. Baba, J. Boyson, J. L. Strominger. 1999. The transmembrane sequence of human histocompatibility leukocyte antigen (HLA)-C as a determinant in inhibition of a subset of natural killer cells. J. Exp. Med. 189:1265.[Abstract/Free Full Text]
  20. Taheri, M., U. Saragovi, A. Fuks, J. Makkerh, J. Mort, C. P. Stanners. 2000. Self recognition in the Ig superfamily: identification of precise subdomains in carcinoembryonic antigen required for intercellular adhesion. J. Biol. Chem. 275:26935.[Abstract/Free Full Text]
  21. Poy, M. N., Y. Yang, K. Rezaei, M. A. Fernstrom, A. D. Lee, Y. Kido, S. K. Erickson, S. M. Najjar. 2002. CEACAM1 regulates insulin clearance in liver. Nat. Genet. 3:270.
  22. Huang, J., J. D. Hardy, Y. Sun, J. E. Shively. 1999. Essential role of biliary glycoprotein (CD66a) in morphogenesis of the human mammary epithelial cell line MCF10F. J. Cell Sci. 112:4193.[Abstract]
  23. Rojas, M., A. Fuks, C. P. Stanners. 1990. Biliary glycoprotein, a member of the immunoglobulin supergene family, functions in vitro as a Ca2+-dependent intercellular adhesion molecule. Cell Growth Differ. 1:527.[Abstract]
  24. Virji, M., S. M. Watt, S. Barker, K. Makepeace, R. Doyonnas. 1996. The N-domain of the human CD66a adhesion molecule is a target for Opa proteins of Neisseria meningitidis and Neisseria gonorrhoeae. Mol Microbiol. 22:929.[Medline]
  25. Schwartz, J. C., X. Zhang, A. A. Fedorov, S. G. Nathenson, S. C. Almo. 2001. Structural basis for co-stimulation by the human CTLA-4/B7-2 complex. Nature 410:604.[Medline]
  26. Holness, C. L., P. A. Bates, A. J. Little, C. D. Buckley, A. McDowall, D. Bossy, N. Hogg, D. L. Simmons. 1995. Analysis of the binding site on intercellular adhesion molecule 3 for the leukocyte integrin lymphocyte function-associated antigen 1. J. Biol. Chem. 270:877.[Abstract/Free Full Text]
  27. Kuroki, M., H. Abe, T. Imakiirei, S. Liao, H. Uchida, Y. Yamauchi, S. Oikawa, M. Kuroki. 2001. Identification and comparison of residues critical for cell-adhesion activities of two neutrophil CD66 antigens, CEACAM6 and CEACAM8. J. Leukocyte Biol. 70:543.[Abstract/Free Full Text]
  28. Oikawa, S., C. Inuzuka, M. Kuroki, F. Arakawa, Y. Matsuoka, G. Kosaki, H. Nakazato. 1991. A specific heterotypic cell adhesion activity between members of carcinoembryonic antigen family, W272 and NCA, is mediated by N-domains. J. Biol. Chem. 266:7995.[Abstract/Free Full Text]
  29. Phan, D., C. J. Cheng, M. Galfione, F. Vakar-Lopez, J. Tunstead, N. E. Thompson, R. R. Burgess, S. M. Najjar, L. Y. Yu-Lee, S. H. Lin. 2004. Identification of Sp2 as a transcriptional repressor of carcinoembryonic antigen-related cell adhesion molecule 1 in tumorigenesis. Cancer Res. 64:3072.[Abstract/Free Full Text]

Related articles in The JI:

IN THIS ISSUE

The JI 2004 173: 3579-3580. [Full Text]  



This article has been cited by other articles:


Home page
J. Immunol.Home page
Z. Chen, L. Chen, S.-W. Qiao, T. Nagaishi, and R. S. Blumberg
Carcinoembryonic Antigen-Related Cell Adhesion Molecule 1 Inhibits Proximal TCR Signaling by Targeting ZAP-70
J. Immunol., May 1, 2008; 180(9): 6085 - 6093.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Stern-Ginossar, S. Nedvetzki, G. Markel, R. Gazit, G. Betser-Cohen, H. Achdout, M. Aker, R. S. Blumberg, D. M. Davis, B. Appelmelk, et al.
Intercellular Transfer of Carcinoembryonic Antigen from Tumor Cells to NK Cells
J. Immunol., October 1, 2007; 179(7): 4424 - 4434.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Markel, R. Seidman, N. Stern, T. Cohen-Sinai, O. Izhaki, G. Katz, M. Besser, A. J. Treves, R. S. Blumberg, R. Loewenthal, et al.
Inhibition of Human Tumor-Infiltrating Lymphocyte Effector Functions by the Homophilic Carcinoembryonic Cell Adhesion Molecule 1 Interactions
J. Immunol., November 1, 2006; 177(9): 6062 - 6071.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Korotkova, E. Cota, Y. Lebedin, S. Monpouet, J. Guignot, A. L. Servin, S. Matthews, and S. L. Moseley
A Subfamily of Dr Adhesins of Escherichia coli Bind Independently to Decay-accelerating Factor and the N-domain of Carcinoembryonic Antigen
J. Biol. Chem., September 29, 2006; 281(39): 29120 - 29130.
[Abstract] [Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
T. NAGAISHI, H. IIJIMA, A. NAKAJIMA, D. CHEN, and R. S BLUMBERG
Role of CEACAM1 as a Regulator of T Cells.
Ann. N.Y. Acad. Sci., August 1, 2006; 1072: 155 - 175.
[Abstract] [Full Text] [PDF]


Home page
Mol. Interv.Home page
A. P. Williams, A. R. Bateman, and S. I. Khakoo
HANGING IN THE BALANCE: KIR and Their Role in Disease
Mol. Interv., August 1, 2005; 5(4): 226 - 240.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Stern, G. Markel, T. I. Arnon, R. Gruda, H. Wong, S. D. Gray-Owen, and O. Mandelboim
Carcinoembryonic Antigen (CEA) Inhibits NK Killing via Interaction with CEA-Related Cell Adhesion Molecule 1
J. Immunol., June 1, 2005; 174(11): 6692 - 6701.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Markel, G.
Right arrow Articles by Mandelboim, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Markel, G.
Right arrow Articles by Mandelboim, O.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS