The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baalasubramanian, S.
Right arrow Articles by Morgan, B. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baalasubramanian, S.
Right arrow Articles by Morgan, B. P.
The Journal of Immunology, 2004, 173: 3684-3692.
Copyright © 2004 by The American Association of Immunologists

CD59a Is the Primary Regulator of Membrane Attack Complex Assembly in the Mouse1

Sivasankar Baalasubramanian*, Claire L. Harris*, Rossen M. Donev*, Masashi Mizuno*, Nader Omidvar*, Wen-Chao Song{dagger} and B. Paul Morgan2,*

* Complement Biology Group, Department of Medical Biochemistry and Immunology, University of Wales College of Medicine, Cardiff, United Kingdom; and {dagger} Center for Experimental Therapeutics and Department of Pharmacology, University of Pennsylvania School of Medicine, Philadelphia, PA 19104


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Gene-deleted mice have provided a potent tool in efforts to understand the roles of complement and complement-regulating proteins in vivo. In particular, mice deficient in the membrane regulators complement receptor 1-related gene/protein y, decay-accelerating factor, or CD59 have demonstrated homeostatic relevance and backcrossing between the strains has revealed cooperativity in regulation. In mouse, genes encoding decay-accelerating factor and CD59 have been duplicated and show differential expression in tissues, complicating interpretation and extrapolation of findings to man. The first described form of CD59, CD59a, is broadly distributed and deletion of the cd59a gene causes a mild hemolytic phenotype with increased susceptibility in complement-mediated disease models. The distribution of the second form, CD59b, was originally described as testis specific, but later by some as widespread. Deletion of the cd59b gene caused a severe hemolytic and thrombotic phenotype. To apply data from these mouse models to man it is essential to know the relative distribution and functional roles of these two forms of CD59. We have generated new specific reagents and used them in sensitive quantitative analyses to comprehensively characterize expression of mRNA and protein and functional roles of CD59a and CD59b in wild-type (wt) and CD59a-negative mice. cd59b mRNA was detected only in testis and, at very low levels, in bone marrow. CD59b protein was present on mature spermatozoa and precursors and, in trace amounts, erythrocytes. Erythrocyte CD59b did not inhibit complement lysis except when CD59a was absent or blocked. These data confirm that CD59a is the primary regulator of complement membrane attack in mouse.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Aubiquitously expressed GPI-anchored glycoprotein, CD59 is the sole membrane regulator of the membrane attack complex (MAC)3 of C (1, 2, 3, 4). The critical role of CD59 in homeostasis is revealed in the acquired hematological disorder, paroxysmal nocturnal hemoglobinuria (PNH). Due to an acquired somatic mutation of the PIG-A gene in bone marrow hemopoietic precursor cells, a variable proportion of blood cells in PNH patients lack GPI-anchored proteins, including the membrane C regulators CD59 and decay-accelerating factor (DAF). As a consequence, erythrocytes and platelets from these patients are highly sensitive to autologous C-mediated lysis and activation, resulting in hemolytic anemia and thrombosis (5). The key role of CD59 is emphasized in studies of isolated deficiencies of the two regulators. Whereas isolated deficiency of DAF in several families was not associated with PNH-like symptoms, the single described case of isolated deficiency of CD59 presented with hemolysis and thrombosis (6, 7, 8, 9, 10, 11). In PNH, other cell types express normal levels of CD59 and are not compromised. However, it has been suggested that glycation-induced inactivation of human CD59 on endothelium may contribute to diabetic vascular damage (12).

Analyses of CD59 analogues from other species have not only helped our understanding of the evolution and structure-function relationships of CD59, but also have enabled the use of appropriate animal models to study the physiological relevance of CD59. Toward this latter goal we earlier identified and characterized mouse CD59, which has a wide expression pattern, very similar to that of human CD59 (13, 14), and went on to engineer a mouse lacking the cd59 gene (15). Although erythrocytes from these mice were C sensitive in vitro, analyses in vivo revealed only a low degree of intravascular hemolysis and increased reticulocyte count, a mild phenotype in comparison with that seen in PNH. This observation in our CD59–/– mouse was supported by the phenotype observed in a mouse model of PNH in which a proportion of the hemopoietic cells are mutated in the PIG-A gene and lack GPI-anchored proteins (16, 17). Here too, the mice displayed only mildly elevated reticulocyte counts and were not anemic. Murine erythrocytes differ from human erythrocytes in that they express the powerful transmembrane C regulator complement receptor 1-related gene/protein y (18). Further, mouse erythrocytes play no role in immune complex clearance (19). Together, these differences likely explain the mild hemolytic phenotype both in the CD59–/– and PNH model mice.

An additional level of complexity was introduced to the saga of mouse erythrocyte C resistance by the demonstration that, in contrast with all other species studied so far, the cd59 gene in mouse is duplicated (20). This second gene, termed cd59b, encoded a putative protein product CD59b that was 63% identical with the originally described form, now termed CD59a. Analysis of mRNA expression indicated that, in contrast to the wide distribution of cd59a, expression of cd59b was restricted to testis (20). CD59 is not alone among C proteins in being genetically duplicated in the mouse. The genes encoding DAF, C1r, and C1s are also duplicated, with expression of one form being confined to the reproductive organs (21, 22). Our early studies examining the expression at the protein level of CD59b in wt and CD59a–/– mice were in accord with the mRNA findings and confirmed that CD59b expression was restricted to the testis (23). However, later studies from Qin, et al. (24) described a widespread distribution of CD59b both at the mRNA level and, using isoform-specific polyclonal antisera, at the protein level. These authors stated that CD59b was widely and abundantly expressed in mouse tissues in a distribution pattern that mirrored that of CD59a. Critically, they went on to delete the cd59b gene and reported that CD59b–/– mice displayed a severe PNH-like phenotype with spontaneous hemolytic anemia with a marked reticulocytosis and abnormal erythrocyte morphology, together with platelet activation (25). Male CD59b–/– mice, though fertile immediately after puberty, then developed a progressive decline into early infertility.

There are compelling reasons to investigate further the relative roles of CD59a and CD59b in the protection of tissues from C attack. Crucially, the phenotype described in the CD59b–/– mice does not fit with data from other sources that have indirectly addressed the roles of CD59a and CD59b. Affected erythrocytes from the PIG-A-mutated PNH mice described above would lack all GPI-anchored molecules, including both CD59a and CD59b, yet the in vitro and in vivo properties of these cells resembles closely those described for the CD59a–/– erythrocytes; indeed, the calculated erythrocyte half-life for affected cells in the PNH mice is almost identical with that in the CD59a–/– mice (7.3 days vs 8.7 days) (15, 16). The CD59a–/– mouse has been used to test the role of C activation and MAC formation in a large and diverse group of model diseases, including experimental nephritis, experimental demyelination, and experimental arthritis (26, 27, 28, 29). In each of these models, deficiency of CD59a, either alone or combined with deficiency of DAF, markedly enhances disease and pathology, demonstrating that in the absence of CD59a there is a failure to regulate MAC in diverse organs and tissues.

All of our data to date indicate that CD59a is the sole regulator of MAC assembly in the large majority of tissues and that deletion of CD59a, while causing only a mild spontaneous phenotype, markedly enhances susceptibility to MAC-mediated injury in numerous models. The work of others flatly contradicts these clear findings. In an effort to bring this controversy to a conclusion, we have generated new reagents and applied highly sensitive and quantitative methods to ascertain the relative functional activities and distribution patterns at mRNA and protein level of CD59a and CD59b.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Generation of novel mAbs against mouse CD59b

CD59a–/– mice were immunized with a fusion protein, comprising murine (m)CD59b attached to the Fc portion of human IgG4, following a standard procedure (23). CD59a–/– mice were chosen for immunization because of the known high homology between CD59a and CD59b (63% identity at the amino acid level) that would in wt mice have restricted the immune response to CD59b (20). The spleen was removed from an immunized mouse, and cells were harvested and fused with SP2/0-Ag14 myeloma cells. The hybrid clones were cultured and the supernatants screened for anti-CD59b Abs in an ELISA as described previously (23). Briefly, alternate rows of 96-well plates were coated with 100 µl of either CD59b-Fc, or a human MCP-Fc as a control for the IgG4 Fc portion. After blocking, culture supernatant from the hybridoma well was added to one of each coated well type and incubated. Plates were washed and incubated with HRP-conjugated goat anti-mouse Ig (Bio-Rad, Hertfordshire, U.K.). Subsequently, the plates were washed and developed with substrate (orthophenylenediamine and H2O2). The absorbance was read in a Bio-Rad plate reader at 490 nm. Wells positive for anti-CD59b mAbs (mAb) were subcloned by limiting dilution to monoclonality. The mAb were isotyped using the IsoStrip mouse mAb isotyping kit (Boehringer Mannheim, Sussex, U.K.). The specificity of mAb to CD59b was confirmed by flow cytometry and Western blotting of EL4, a murine lymphoma cell line because it does not express CD59a or CD59b, transfected with CD59a, CD59b, or with empty vector. The function-blocking ability of anti-CD59b mAb was assessed by testing their capacity to enhance C lysis of Ab-sensitized CD59b-expressing EL4 cells essentially as described (23).

Immunofluorescent localization of CD59a and CD59b

Tissue sections of brain, lungs, heart, liver, spleen, kidney, and testis from wt and CD59a–/– C57/BL6 mouse were prepared as described previously (23). Briefly, 7-µm sections were cut from snap-frozen tissues, placed onto Snowcoat X-tra glass slides (Surgipath, Peterborough, U.K.), and fixed with acetone for 5 min. Fixed tissue sections were probed with mAb against mouse CD59b directly labeled with N-hydroxysuccinimido-FITC as instructed by the manufacturer (Pierce, Cheshire, U.K.). To examine the distribution of CD59a, tissue sections were pretreated with Avidin-Biotin blocking kit (Vector Laboratories, Peterborough, U.K.), then probed with a biotinylated mAb against CD59a (mCD59.1(23)), followed by washing and incubating with FITC-labeled streptavidin (Sigma-Aldrich, Dorset, U.K.). After further washing, the tissue sections were placed in mounting medium (Vector Laboratories) and examined using a fluorescence microscope (Leica Microsystems, Knowlhill, U.K.) with image analysis system (Openlab, Coventry U.K.).

To isolate motile spermatozoa, two cauda epididymii from an adult wt C57/BL6 mouse were minced in 1 ml of DMEM and incubated at room temperature for 15 min to allow sedimentation of large cellular aggregates. The supernatant was transferred to a fresh tube and cells washed twice with 500 µl of DMEM by centrifugation (300 x g) for 5 min at room temperature. Cell pellets were resuspended in 100 µl of DMEM, smeared on glass slides, and immediately air dried. The smeared slides were fixed in acetone at room temperature for 2 min. The expression of CD59a and CD59b on sperm cells was examined using mAb to CD59a and CD59b as described for immunohistochemistry above.

Real-time PCR analysis for expression of cd59aand cd59b mRNA

Total RNA was isolated from different mouse tissues (brain, heart, kidney, liver, spleen, lungs, testis, and bone marrow) obtained from both wt and CD59a–/– C57/BL6 mice using the RNeasy kit (Qiagen, Sussex, U.K.). Aliquots of these RNAs, 1 µg each, were reverse-transcribed using random hexamers and multiscribe reverse transcriptase according to the manufacturer’s instructions (Applied Biosystems, Warrington, U.K.). A common primer pair for cd59a (GenBank accession number, NM_007652) and cd59b (GenBank accession number, NM_181858) (GCCGGAATGCAAGTGTATCA, forward; and GTCCCCAGCAATGGTGTCTT, reverse) was designed using Primer Express software (Applied Biosystems) within regions of identity in the two sequences. This primer pair surrounds DNA sequences that differ between cd59a and cd59b. Within this region, we designed TaqMan probes specific for each of the mRNAs to be examined (cd59a, 5'-FAM-CATGGTGAGATCATTATGGACCAATTAGAAGAGACAA-TAMRA-3', and CD59b, 5'-FAM-TAATTCCAACTATATTATGAGCCGATTAGACGTGGCA-TAMRA-3'). Primers and probe were designed to {beta}-actin as an internal control for normalization of starting cDNA levels (ACGGCCAGGTCATCACTATTG, forward; AGTTTCATGGATGCCACAGGAT, reverse; TaqMan probe, 5'-VICTCCGATGCCCTGAGGCTCTTTTCC-TAMRA-3'). Quantitative PCR was performed using TaqMan Universal PCR Master Mix according to the manufacturer’s instructions (Applied Biosystems), with the exception that 25-µl reaction volumes were used, with 45 cycles of amplification. The concentrations of each of the primer pairs and the TaqMan probes were optimized to ensure amplification of the specific product and the absence of primer/probe dimers. PCR was performed on the ABI PRISM 7000 (Applied Biosystems) using the following primer concentrations: 900(forward)/300(reverse) nM for the cd59a and cd59b primer pair; 300(forward)/300(reverse) nM for the {beta}-actin primers. Each of the TaqMan probes was used at 200 nM. The real-time PCR results were analyzed using the sequence detection system software version 1.9 (Applied Biosystems). RNA expression levels were calculated using the comparative Ct method ({Delta}{Delta}Ct) (30). {Delta}{Delta}Ct validation experiments showed similar amplification efficiency for all templates used (difference between line slopes for all templates <0.1). Expression levels of the mRNAs were normalized to those in testis. At least two independent experiments were performed for each mRNA.

Flow cytometric quantitation of CD59a and CD59b expression on mouse erythrocytes

mAb against mouse CD59a (mCD59.4) (23) and CD59b were labeled with PE molecules at a molar ratio of 1:1 using the Phycolink PE conjugation kit (Prozyme, Cambridge, U.K.) as instructed by the manufacturer. Erythrocytes from wt and CD59a–/– mice were stained for CD59a and CD59b with the PE-labeled Abs at a dilution determined by titration. QuantiBRITE Beads (BD Biosciences, Oxford, U.K.) were used to determine the number of PE molecules bound per cell (31, 32). These beads, conjugated with four different levels of PE molecules (863, 8612, 31,779, or 66,408 PE molecules per bead; lot no. 68094), were used to calibrate the FL-2 axis in terms of number of PE molecules. The beads were acquired in the flow cytometer (FACSCalibur; BD Biosciences) with setting adjusted for mouse erythrocytes under the quantitation acquisition document within the CellQuest folder. The CellQuest software (BD Biosciences) was used to perform the regression analysis and to display the slope (m), intercept (c), and correlation coefficient (r2) for the equation y = mx + c, where y equals log10 fluorescence and x is equal to PE molecules per bead. Optimally stained erythrocytes were acquired using the same machine settings. The number of molecules of CD59a and CD59b, expressed as Ab bound per cell, was determined by substituting the log FL2 geometric means in the above equation and solving for x.

Analysis of expression of CD59a and CD59b on mouse erythrocytes and testis lysates by Western blotting and immunoprecipitation

Lysates of mouse erythrocyte ghosts and EL4 cells, either untransfected or transfected with CD59a or CD59b were prepared as described earlier (23). Lysates were resolved on 12.5% SDS-PAGE under nonreducing conditions, and then transferred onto nitrocellulose. The membrane was blocked with 5% skimmed milk powder in PBS, probed with either anti-CD59a (mCD59.4) (23), or anti-CD59b mAb at an appropriate dilution, washed, then incubated with HRP-conjugated rabbit anti-mouse IgG (Bio-Rad) at an appropriate dilution. The membrane was washed and immunoreactive proteins were visualized by ECL (Pierce). For analysis by immunoprecipitation, mouse erythrocytes ghosts were generated from 2 ml of packed erythrocytes, washed by centrifugation, and then solubilized in lysis buffer (50 mM Tris-HCl, pH8. 0, 150 mM NaCl, 25 mM NaF, 1 mM Na3VO4, 0.5% Nonidet P-40) containing protease inhibitor mixture (10 µl/ml) (Sigma-Aldrich). The lysate was precleared by incubation with 30 µl of protein A-Sepharose beads (Amersham Pharmacia, Bucks, U.K.) for 1 h at 4°C with mixing. Immunoprecipitation was performed by mixing lysate with 10 µg of mouse mAbs against CD59b and 50 µl of protein A-Sepharose beads for 2 h at 4°C. The immunoprecipitates were washed twice in lysis buffer, then boiled for 5 min in 50 µl of nonreducing SDS-PAGE sample buffer. Beads were removed by centrifugation and the supernatants resolved on SDS-PAGE and blotted as described above. Lysates obtained from whole mouse testis and CD59b-transfected EL4 cells were also immunoprecipitated and analyzed as positive controls.

To examine the extent of N-glycosylation of CD59a and CD59b, aliquots of testis lysate (10 µl) were incubated with or without N-glycosidase (0.5 U; Roche, Basel, Switzerland) at 37°C overnight. Samples were then separated on SDS-PAGE, Western blotted, and probed with mAb mCD59b.2 or mCD59.4.

Functional assay for CD59a and CD59b on mouse erythrocytes

wt and CD59a–/– mice were exsanguinated by cardiac puncture and blood collected into EDTA (10 mM). Erythrocytes were separated by centrifugation (1300 x g) for 5 min at room temperature and washed twice with PBS. A 1% suspension of erythrocytes was made from packed, washed cells in PBS, and 100-µl aliquots were placed in the wells of a 96-well plate. Cells were then incubated with or without function-blocking mAb (10 µg/ml) against CD59a (mCD59. 3) (23) and/or CD59b on ice for 10 min. Cells were washed into C fixation diluent (CFD; Oxoid, Basingstoke, U.K.) and incubated with rat or mouse serum at an appropriate dilution (0.1 ml in CFD) and cobra venom factor (CVF; 1.5 µg/ml final) for 30 min at 37°C. Zero and 100% lysis controls were included in all assays. Plates were centrifuged, and the absorbance of hemoglobin at 412 nm of the supernatant was measured as an index of lysis. Percentage of lysis was calculated as described earlier (15).

To examine specifically the effects of the mAb on MAC activity, mouse erythrocytes bearing C5b-7 sites were first generated. Erythrocytes were Ab sensitized by incubating a 1% suspension in PBS with a specific rabbit anti-mouse erythrocyte antiserum generated in-house, and depleted of anti-CD59a and anti-CD59b reactivity by adsorption with the relevant fusion proteins. Efficiency of adsorption was confirmed by ELISA on immobilized fusion proteins. Ab-sensitized erythrocytes were washed into CFD and incubated with C8-depleted human serum (1:20 final dilution) for 20 min at 37°C. The EAC5b-7 cells were washed into PBS/10 mM EDTA, and incubated with or without function-blocking mAb (10 µg/ml) against CD59a and/or CD59b on ice for 10 min. To complete the lytic pathway, rat or mouse serum, at an appropriate dilution in PBS/10 mM EDTA, was added to the cells and incubated at 37°C for 30 min. Zero and 100% lysis controls were included in all assays and percentage lysis was calculated as described earlier (15).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Generation and characterization of mAb against mouse CD59b

To generate new mAb against mouse CD59b, CD59a–/– mice were immunized with CD59b-Fc and hybridomas screened first, for binding to CD59b, second, for lack of binding to CD59a, and third, for function-blocking capacity for CD59b. A strong immune response against the CD59b component of the fusion protein was obtained in all immunized mice. A single mAb of the IgG1 isotype, designated mCD59b.2, was selected based upon these parameters for further analysis. Flow cytometric analysis on EL4 cells transfected with CD59a or CD59b or the empty vector showed the mAb to be specific for CD59b (Fig. 1A). In Western blot analysis, the mAb specifically detected a broad band of molecular mass 17–19 kDa in lysates of cells transfected with CD59b alone but was negative in lysates of vector control or CD59a-transfected EL4 (Fig. 1B). Preincubation of Ab-sensitized CD59b-transfected EL4 cells with the mAb increased lysis by rat and mouse C by 25–50%, demonstrating that the mAb had function-blocking activity (data not shown).



View larger version (37K):
[in this window]
[in a new window]
  		FIGURE 1. Characterization of anti-CD59b mAb. A, Flow cytometric analysis of EL4 cells transfected with CD59a (gray line), CD59b (black line), or with empty vector (dashed line), and stained with mAb mCD59b.2. B, Western blots of EL4 cells transfected with CD59a (lane i), CD59b (lane ii), or empty vector (lane iii). Cell lysates were separated by SDS-PAGE, blotted to nitrocellulose, and probed with the mAb mCD59b.2.

 
Tissue expression of CD59b protein is restricted to mouse testis

Acetone-fixed frozen sections of the principle organs were stained as described in Materials and Methods. Directly FITC-labeled mAb mCD59b.2 was used to detect CD59b. The mAb (mCD59.1) (23) against CD59a was biotinylated to permit double staining for the two proteins where appropriate. Staining of testis sections revealed strong staining for both CD59a and CD59b in wt mice, although the distribution patterns of the two proteins were markedly different (Fig. 2, A and E). In CD59a–/– mice, testis staining for CD59b was identical with that in wt mice, whereas CD59a staining was absent (Fig. 2, A, B, and F). All the other tissues examined were strongly positive for CD59a in wt mice and negative in CD59a–/– mice, as previously reported (23), but were negative for CD59b in both wt and CD59a–/– mice (Fig. 2, C and D; data shown for kidney, other negative tissues not shown). In the testis, CD59a showed a strong staining for Leydig cells between the seminiferous tubules and a weak diffuse staining at the center of the tubules (Fig. 2E). In contrast, CD59b strongly stained spermatids, the late precursors of germ cells, and maturing spermatozoa in the center of seminiferous tubules (Fig. 2, A and B). Staining of isolated spermatozoa showed that CD59a was expressed predominantly on neck and tail, with essentially no staining on head, whereas CD59b was diffusely expressed in the neck and tail, and showed a remarkable concentration of staining in a granular membranous pattern in the head region (Fig. 2, G and H).



View larger version (87K):
[in this window]
[in a new window]
  		FIGURE 2. Immunofluorescence analysis of CD59a and CD59b expression in wt and CD59a–/– mice. Tissue sections of testis (A and B) and kidney (C and D) from wt mice (A and C) and CD59a–/– mice (B and D) stained for CD59b. In the testis, CD59b was expressed close to the lumen of the seminiferous tubules in both wt and CD59a–/– mice. In the kidney, shown as an example of peripheral organs, listed in text, CD59b was not expressed in either wt or CD59a–/– mice. E, In testis from wt mouse, CD59a staining was more diffuse throughout the seminiferous tubule and strong on support cells between the seminiferous tubules. F, No staining for CD59a was observed in CD59a–/– testis. Smears of acetone-fixed spermatozoa from wt mouse were stained for CD59b (G) and CD59a (H). CD59a and CD59b were diffusely expressed on all regions of the spermatozoa, but strong granular staining for CD59b was restricted to the head region. Magnification, A–F; x400, G and H; x1000.

 
Quantitative analysis confirms restricted expression of mRNA for cd59b

Quantitative PCR was performed to determine precisely the levels of mRNA for cd59a and cd59b in the various tissues. The results are summarized in Table I. Consistent with immunofluorescence analyses, cd59a was expressed in all the tissues studied. Expression, normalized to that in testis, was highest in liver (8-fold that in testis) and lowest in brain (17% of that in testis). Other tissues expressed intermediate amounts of mRNA. In contrast, cd59b mRNA was detected only in testis and bone marrow, with similar expression levels in wt and CD59a–/– mice. Testis showed the highest level of expression for cd59b, while expression in bone marrow was low (9% compared with testis). Because identical primers to fully conserved regions in cd59a and cd59b were used in the PCR, it was possible to directly compare expression levels of the two mRNA species. In testis, expression of cd59b was 23% that of cd59a, and in bone marrow, cd59b expression was just 1.7% that of cd59a.


View this table:
[in this window]
[in a new window]
  		Table I. mRNA levels of cd59aand cd59bby quantitative RT-PCR

 
Quantitative analysis of expression of CD59a and CD59b on mouse erythrocytes

The above data implied that CD59b might be expressed on bone marrow-derived cells. Preliminary flow cytometric analyses using conventionally labeled mAb detected no staining on leukocytes or platelets. However, a small but consistent shift was observed on erythrocytes (data not shown). This prompted us to examine quantitatively the expression of CD59a and CD59b on erythrocytes using mAb labeled with PE at a defined molar ratio and QuantiBRITE PE beads. Representative histograms from wt and CD59a–/– erythrocytes are shown in Fig. 3. Table II lists the calculated numbers of molecules of CD59a and CD59b on erythrocytes from wt and CD59a–/– mice. Male and female wt mice expressed similar numbers of CD59a molecules per erythrocyte (2286 ± 127 and 2467 ± 135, respectively), while CD59a–/– erythrocytes were completely negative. wt mice expressed low numbers of CD59b molecules on erythrocytes (177 ± 10 male, and 184 ± 11 female), and similar numbers were expressed on CD59a–/– erythrocytes (171 ± 8 male, and 180 ± 7 female).



View larger version (27K):
[in this window]
[in a new window]
  		FIGURE 3. Representative histograms for the quantitation of CD59a and CD59b. Erythrocytes from wt (A) and CD59a–/– mice (B) were analyzed as described in Materials and Methods. Mouse erythrocyte staining with directly PE-conjugated mAb to CD59a (solid black line), CD59b (dashed line), and isotype-matched control Ab (gray line). QuantiBRITE beads with four different levels of PE molecules, detailed in text, are shown in filled profiles.

 

View this table:
[in this window]
[in a new window]
  		Table II. Number of molecules of CD59a and CD59b on mouse erythrocytes

 
Enrichment by immunoprecipitation detects CD59b on mouse erythrocytes

To confirm the low level expression of CD59b detected on mouse erythrocytes by quantitative flow cytometry, we undertook Western blot analyses. Under standard conditions, CD59a and CD59b were strongly stained in lysates of EL4 cells transfected with the corresponding vector and CD59a was readily detected in mouse erythrocyte ghosts (Fig. 4A). However, CD59b was not detected in erythrocyte ghosts under standard conditions (Fig. 4B). Therefore, we enriched for CD59b by immunoprecipitation from a large quantity of erythrocyte ghosts (from 2 ml of packed erythrocytes) and analyzed the lysate in Western blots. Using this enrichment strategy, we identified a band of ~16 kDa in mouse erythrocyte ghost. Testis lysate was run as a positive control and gave a strong band of molecular mass, ~18 kDa (Fig. 4C). N-deglycosylation of testis lysate was performed to examine molecular mass changes in CD59a and CD59b (Fig. 4D). N-deglycosylation reduced the apparent molecular mass of CD59a by 4–5 kDa and that of CD59b by 2 kDa, suggesting that the latter molecule contained substantially less N-linked carbohydrate.



View larger version (60K):
[in this window]
[in a new window]
  		FIGURE 4. Detection of erythrocyte and testis CD59b by immunoprecipitation and Western blotting. A, Lysates from cell-expressing CD59a (lane i) and mouse erythrocyte ghosts (lane ii) were separated by SDS-PAGE, blotted to nitrocellulose, and probed with the mAb mCD59.4. B, Lysates from mouse erythrocyte ghost (lane i) and cell-expressing CD59b (lane ii) were separated by SDS-PAGE, blotted to nitrocellulose, and probed with the mAb mCD59b.2. C, Lysates from cells expressing CD59a (lane i), CD59b (lane ii), mouse erythrocyte ghost (lane iii), and mouse testis (lane iv) were immunoprecipitated with anti-CD59b Ab. Immunoblots were then probed with anti-CD59b Ab, specifically detecting a band within the range of 16–20 kDa. D, Lysates from mouse testis were incubated with (lanes ii and iv) or without N- glycosidase overnight at 37°C, separated on SDS-PAGE, blotted and probed with mAb mCD59b.2 (lanes i and ii) or mCD59.4 (lanes iii and iv). Molecular mass markers are indicated to the right of each frame.

 
CD59b is irrelevant to complement resistance in mouse erythrocytes

To examine the relative roles of CD59a and CD59b in protecting mouse erythrocytes from complement-mediated lysis, two different hemolytic assays were used in association with functional blockade of CD59a and/or CD59b using specific mAb. The first assay used CVF to trigger fluid-phase C activation causing bystander lysis of surrounding erythrocytes (CVF reactive lysis). In this assay, both mouse serum (Fig. 5A) and rat serum (Fig. 5B) caused lysis of mouse erythrocytes that was significantly greater for CD59a–/– erythrocytes compared with wt. Blocking CD59a on wt erythrocytes significantly increased lysis to levels approaching those on CD59a–/– cells without mAb. Anti-CD59a had no effect on the lytic susceptibility of CD59a–/– erythrocytes. Blocking CD59b on wt erythrocytes did not significantly increase lysis, but when CD59b was blocked on CD59a–/– erythrocytes there was a small increase in lysis that was significant. When both CD59a and CD59b were blocked on wt erythrocytes, lysis was significantly increased compared with blockade of CD59a alone.



View larger version (32K):
[in this window]
[in a new window]
  		FIGURE 5. Roles of CD59a and CD59b in protecting mouse erythrocytes against C lysis. Mouse erythrocytes from wt ({square}) and CD59a–/– ({blacksquare}) were either blocked with Abs against CD59a or CD59b, or left untreated. The cells were then subjected to alternative pathway-mediated lysis with CVF in either mouse serum (A) or rat serum (B). Mouse erythrocytes from wt ({square}) and CD59a–/– ({blacksquare}) were Ab sensitized and coated with c5b-8 sites as detailed in Materials and Methods. Cells were then either blocked with Abs against CD59a or CD59b, or left untreated. The cells were subjected to terminal pathway-mediated lysis in EDTA-containing either mouse serum (C) or rat serum (D). Data shown are mean ± SD. *, p < 0.001 vs unblocked; **, p < 0.002 vs CD59a blocked; ***, p < 0.03 vs CD59a blocked.

 
The second assay used preformed C5b-7 sites to interrogate specifically the terminal pathway, using EDTA mouse serum (Fig. 5C) or EDTA rat serum (Fig. 5D) to complete MAC formation. The results from this assay were supportive of those obtained in the CVF-triggered assay described above. Blocking CD59a on wt erythrocytes increased lysis significantly, while blocking CD59b did not. Blocking CD59b on CD59a–/– erythrocytes increased lysis only by rat C8/C9 but mAb against CD59a were without effect. Blocking both CD59a and CD59b caused the greatest increase in lysis of wt erythrocytes.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
C regulators play important roles in tissue homeostasis in health and disease (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12). The recent availability of mice in which individual C regulators have been deleted by homologous recombination has provided a powerful tool for examining the roles of the C regulators in various organs and contexts, but the analysis has been complicated by differences in C regulation between mouse and man. Mice possess additional regulators absent in man, modified regulators with distinct functions and duplicated regulators with differential tissue expression (18, 21, 22). CD59 falls into this last category with gene duplication giving rise to two CD59 proteins, both of which have the capacity to regulate C when expressed either on cells or as soluble molecules (20, 23). Our original data describing the phenotype associated with deletion of the first described form of mouse CD59 (CD59a–/–) strongly implicate CD59a as a key homeostatic molecule in the mouse (15). This implication is supported by more recent studies of C-mediated disease models in the CD59–/– mouse, which suggest that CD59a regulates MAC injury in many tissues (26, 27, 28). Early analyses of the second form of mouse CD59, CD59b, reported expression only in testis, ruling out a more global homeostatic role for this molecule (20, 23). However, Qin, et al. (24, 25) have recently reported that CD59b is broadly expressed, contradicting their first reports, and have gone on to generate a CD59b gene-deleted mouse. The remarkable phenotype in this mouse, with severe spontaneous hemolysis and platelet activation in vivo and progressive deterioration of male fertility, implies a much wider role and indeed has led these authors to conclude that CD59b is the major regulator of the MAC in vivo. This conclusion is impossible to reconcile with our analyses in wt and CD59a–/– mice and those of others in murine models of PNH. It is also difficult to square with our demonstration, in this study and previously, that CD59a–/– mice (and, in our unpublished observations, wt mice) mount strong immune responses when immunized with CD59b, from which specific mAb can be derived.

In this study, we have used quantitative analytical methods to comprehensively characterize the expression patterns and functional roles of CD59a and CD59b in wt and CD59a–/– mice. We first generated new highly specific mAb against CD59b, selected to exclude any cross-reactivity with CD59a, for function-blocking activity and for IgG1 isotype. These reagents were then used to confirm our previous observation, from analyses using a single IgM mAb and polyclonal anti-peptide Ab that, of all the solid tissues examined, CD59b protein was expressed at detectable level only in testis (23). In testis, expression was restricted to mature spermatozoa and their late precursors, spermatids. Qin, et al. (24), using an anti-peptide Ab targeting a different region in CD59b reported a broad expression closely mirroring that of CD59a in the tissues tested. We have not attempted to duplicate these studies with the precise reagent used by Qin, et al. (24, 25), and have no explanation for their findings with this polyclonal antiserum. The patterns of expression of CD59a and CD59b on spermatozoa are of particular interest. Both CD59a and CD59b were broadly and diffusely expressed on all regions of the sperm cell, but CD59a was essentially absent from the head, whereas CD59b was densely expressed on this region in a markedly granular pattern that appeared to be membrane associated. Spermatozoa were permeabilized by fixation in acetone before staining with mAb; it is thus possible that the granular staining observed represents intercellular rather than membranous elements. Further analyses using unfixed and acrosome-reacted spermatozoa are needed to further characterize this intriguing distribution pattern.

Despite numerous attempts using multiple primer pairs we have consistently failed to PCR amplify mRNA encoding cd59b from any mouse tissue with the sole exception of testis, positive in all attempts (our unpublished data). Qin, et al. (24, 25) originally described similar results but later reported the presence of cd59b mRNA in a wide range of tissues using PCR and Northern blot analysis. However, our analysis of primers for cd59b these authors have applied in their assay showed 75% and 100% homology with cd59a for the forward primer in the two studies. In this study, we designed a primer pair complementary to sequences conserved in the two mRNA species that, with specific labeled TaqMan probes, could be used in real-time PCR to measure the relative expression levels of cd59a and cd59b in mouse tissues. Expression of cd59a was abundant in all tissues tested, the highest expression being found in liver and lowest in brain. In contrast, cd59b transcript was detected only in testis and, at very low level, bone marrow. The expression levels in wt and CD59a–/– mice were identical. Because the primers used in the PCR were identical, it was possible directly to compare expression levels of cd59a and cd59b in tissues. The ratio of transcript expression in testis was 4:1 and in bone marrow 60:1 (cd59a:cd59b).

The mCD59b.2 mAb consistently showed a small shift of fluorescence on mouse erythrocytes, not seen with the previously described IgM mAb mCD59b.1 (23). Comparison of staining of CD59b-expressing EL4 demonstrated that mCD59b.2 gave fluorescence intensities almost 10-fold greater than mCD59.1, reflecting differences in isotype (IgM vs IgG1) and affinity. We further explored this weak but consistent signal using quantitative flow cytometry and were able to show that mouse erythrocytes did indeed express CD59b, albeit at very low copy number; fewer than 200 molecules per cell. In contrast, CD59a was present at around 2500 copies per cell. Erythrocyte expression of CD59b was the same in CD59a–/– and wt mice and did not differ between males and females. Expression was confirmed by Western blotting, but to obtain a positive result for erythrocyte CD59b, enrichment by immunoprecipitation was essential. CD59b ran on SDS-PAGE with an apparent molecular mass of 16 kDa, some 4 kDa smaller than the apparent molecular mass of CD59a. Although CD59b is larger by 11 aa than CD59a, one of the two potential N-glycosylation sites in the CD59a sequence (at N71) is lost in CD59b, perhaps explaining the lower apparent molecular mass. Enzymatic N-deglycosylation of CD59a and CD59b in testis extracts supported this interpretation. Testis CD59a had a molecular mass of 19 kDa, reduced to 15 kDa by N-deglycosylation, whereas CD59b had a molecular mass of 18 kDa, reduced to 16 kDa by N-deglycosylation. Finally, we analyzed the functional relevance of the low level of CD59b expressed on erythrocytes. Qin, et al. (24) reported that CD59b was ~6-fold more active than CD59a in protecting against lysis by human C but did not test activity against rodent C. Our own published analyses indicate that CD59a and CD59b are approximately equipotent as inhibitors, regardless of the source of C (23). In the current study, two different hemolytic assays and two sources of C were used, and in each case, while mAb blockade of CD59a markedly enhanced lytic susceptibility in wt erythrocytes, blockade of CD59b had no effect. However, when CD59b was blocked in CD59a–/– erythrocytes, lysis was significantly enhanced. These data, supported by results of double blockade with mAb in wt cells, demonstrate clearly that the small numbers of CD59b molecules expressed on erythrocytes play no significant role in the protection of these cells from C lysis in the presence of CD59a. Only when the numerically dominant MAC regulator is eliminated by gene deletion or by mAb neutralization is a protective role for CD59b revealed.

The overall conclusion from this work and our previous studies is that CD59a is the physiologically relevant regulator of the MAC in the majority of tissues, while expression of CD59b is restricted and likely only of relevance in the male reproductive system. This conclusion fits with our own observations of spontaneous phenotype and disease enhancement in the CD59a–/– mouse, and with the findings of others in murine models of PNH (15, 16, 17, 26, 27, 28). However, they are at odds with the published description of the phenotype in the CD59b–/– mouse (25). One possible explanation is that expression of CD59a is also compromised in these mice; the combined deficiency of CD59a and CD59b would be predicted from our data to cause a hemolytic phenotype more severe than that seen in the CD59a–/– mice. The two genes are closely linked on chromosome 2, region E3, separated by 11.6 kb of genomic DNA. There are numerous examples in the literature where targeting by homologous recombination of a specific gene has led to deletion or down-regulation of a closely linked gene. In the C field, targeted disruption of the factor B gene caused marked down-regulation of expression of the two flanking genes in the murine MHC encoding C2 and D7H6S45 (33). Down-regulation of C2 was essentially complete and the resultant mice were effectively double knockouts, lacking activity in classical (C2 deficiency) and alternative (factor B deficiency) C pathways. Qin, et al. (25) compared CD59a expression in wt and CD59b–/– mice by flow cytometry using an undefined polyclonal antiserum and found no difference. It is now essential that expression be further tested using the available well-characterized mAb against CD59a to eliminate the possibility that CD59a has been substantially down-regulated. In light of our demonstration that CD59b plays a minor role in C regulation on erythrocytes, it is unlikely that even a complete absence of CD59a would fully explain the observed phenotype in the CD59b–/– mice. Nevertheless, resolution of the current confusion should enable the available mice and reagents to be used logically to address the roles of CD59a and CD59b in tissue homeostasis, pathology, and reproduction.


   Acknowledgments
 
We thank Dr. Tim R. Hughes and Ruth Davies for the help provided in this study, and Prof. Marino Botto (Royal Postgraduate Medical School, London, U.K.) for collaboration to generate the CD59a knockout mice.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by the Wellcome Trust, through the award of International Travelling Research Fellowship 068280 to S.B., and Programme Grant 068590 funding to B.P.M. Back

2 Address correspondence and reprint requests to Dr. B. Paul Morgan, Department of Medical Biochemistry and Immunology, University of Wales College of Medicine, Cardiff CF14 4XN, U.K. E-mail address: morganbp{at}cf.ac.uk Back

3 Abbreviations used in this paper: MAC, membrane attack complex; CFD, complement fixation diluent; CVF, cobra venom factor; DAF, decay-accelerating factor; m, murine; PNH, paroxysmal nocturnal hemoglobinuria; wt, wild type. Back

Received for publication April 6, 2004. Accepted for publication June 2, 2004.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Meri, S., B. P. Morgan, A. Davies, R. H. Daniels, M. G. Olavesen, H. Waldmann, P. J. Lachmann. 1990. Human protectin (CD59), an 18,000–20,000 MW complement lysis restricting factor, inhibits C5b-8 catalysed insertion of C9 into lipid bilayers. Immunology 71:1.[Medline]
  2. Meri, S., H. Waldmann, P. J. Lachmann. 1991. Distribution of protectin (CD59), a complement membrane attack inhibitor, in normal human tissues. Lab. Invest. 65:5.
  3. Davies, A., P. J. Lachmann. 1993. Membrane defence against complement lysis: the structure and biological properties of CD59. Immunol. Res. 12:258.[Medline]
  4. Morgan, B. P., C. L. Harris. 1999. Complement Regulatory Proteins Academic Press, London.
  5. Rosse, W. F.. 1992. Paroxysmal nocturnal hemoglobinuria. Curr. Top. Microbiol. Immunol. 178:163.[Medline]
  6. Telen, M. J., A. M. Green. 1989. The Inab phenotype: characterization of the membrane protein and complement regulatory defect. Blood 74:437.[Abstract/Free Full Text]
  7. Merry, A. H., V. I. Rawlinson, M. Uchikawa, M. R. Daha, R. B. Sim. 1989. Studies on the sensitivity to complement-mediated lysis of erythrocytes (Inab phenotype) with a deficiency of DAF (decay accelerating factor). Br. J. Haematol. 73:248.[Medline]
  8. Reid, M. E., G. Mallinson, R. B. Sim, J. Poole, V. Pausch, A. H. Merry, Y. W. Liew, M. J. Tanner. 1991. Biochemical studies on red blood cells from a patient with the Inab phenotype (decay-accelerating factor deficiency). Blood 78:3291.[Abstract/Free Full Text]
  9. Lublin, D. M., G. Mallinson, J. Poole, M. E. Reid, E. S. Thompson, B. R. Ferdman, M. J. Telen, D. J. Anstee, M. J. Tanner. 1994. Molecular basis of reduced or absent expression of decay-accelerating factor in Cromer blood group phenotypes. Blood 84:1276.[Abstract/Free Full Text]
  10. Okada, N., R. Harada, R. Taguchi, H. Okada. 1989. Complete deficiency of 20 KDa homologous restriction factor (HRF20) and restoration with purified HRF20. Biochem. Biophys. Res. Commun. 164:468.[Medline]
  11. Yamashina, M., E. Ueda, T. Kinoshita, T. Takami, A. Ojima, H. Ono, H. Tanaka, N. Kondo, T. Orii, N. Okada, et al 1990. Inherited complete deficiency of 20-kilodalton homologous restriction factor (CD59) as a cause of paroxysmal nocturnal hemoglobinuria. N. Engl. J. Med. 323:1184.[Medline]
  12. Acosta, J., J. Hettinga, R. Fluckiger, N. Krumrei, A. Goldfine, L. Angarita, J. Halperin. 2000. Molecular basis for a link between complement and the vascular complications of diabetes. Proc. Natl. Acad. Sci. USA 97:5450.[Abstract/Free Full Text]
  13. Powell, M. B., K. J. Marchbank, N. K. Rushmere, C. W. van den Berg, B. P. Morgan. 1997. Molecular cloning, chromosomal localization, expression, and functional characterization of the mouse analogue of human CD59. J. Immunol. 159:1692.
  14. Rushmere, N. K., C. W. Van Den Berg, B. P. Morgan. 2000. Production and functional characterization of a soluble recombinant form of mouse CD59. Immunology 99:326.[Medline]
  15. Holt, D. S., M. Botto, A. E. Bygrave, S. M. Hanna, M. J. Walport, B. P. Morgan. 2001. Targeted deletion of the CD59 gene causes spontaneous intravascular hemolysis and hemoglobinuria. Blood 98:442.[Abstract/Free Full Text]
  16. Tremml, G., C. Dominguez, V. Rosti, Z. Zhang, P. P. Pandolfi, P. Keller, M. Bessler. 1999. Increased sensitivity to complement and a decreased red blood cell life span in mice mosaic for a nonfunctional Piga gene. Blood 94:2945.[Abstract/Free Full Text]
  17. Murakami, Y., T. Kinoshita, Y. Maeda, T. Nakano, H. Kosaka, J. Takeda. 1999. Different roles of glycosylphosphatidylinositol in various hematopoietic cells as revealed by a mouse model of paroxysmal nocturnal hemoglobinuria. Blood 94:2963.[Abstract/Free Full Text]
  18. Kim, Y. U., T. Kinoshita, H. Molina, D. Hourcade, T. Seya, L. M. Wagner, V. M. Holers. 1995. Mouse complement regulatory protein Crry/p65 uses the specific mechanisms of both human decay-accelerating factor and membrane cofactor protein. J. Exp. Med. 181:151.[Abstract/Free Full Text]
  19. Cochrane, C. G., D. Koffler. 1973. Immune complex disease in experimental animals and man. Adv. Immunol. 16:185.[Medline]
  20. Qian, Y. M., X. Qin, T. Miwa, X. Sun, J. A. Halperin, W. C. Song. 2000. Identification and functional characterization of a new gene encoding the mouse terminal complement inhibitor CD59. J. Immunol. 165:2528.[Abstract/Free Full Text]
  21. Song, W. C., C. Deng, K. Raszmann, R. Moore, R. Newbold, J. A. McLachlan, M. Negishi. 1996. Mouse decay-accelerating factor: selective and tissue-specific induction by estrogen of the gene encoding the glycosylphosphatidylinositol-anchored form. J. Immunol. 157:4166.[Abstract]
  22. Garnier, G., A. Circolo, X. U. Yuanyuan, J. E. Volanakis. 2003. Complement C1r and C1s genes are duplicated in the mouse: differential expression generates alternative isomorphs in the liver and in the male reproductive system. Biochem. J. 371:631.[Medline]
  23. Harris, C. L., S. M. Hanna, M. Mizuno, D. S. Holt, K. J. Marchbank, B. P. Morgan. 2003. Characterization of the mouse analogues of CD59 using novel monoclonal antibodies: tissue distribution and functional comparison. Immunology 109:11.
  24. Qin, X., T. Miwa, H. Aktas, M. Gao, C. Lee, Y. M. Qian, C. C. Morton, A. Shahsafaei, W. C. Song, J. A. Halperin. 2001. Genomic structure, functional comparison, and tissue distribution of mouse Cd59a and Cd59b. Mamm. Genome 12:582.[Medline]
  25. Qin, X., N. Krumrei, L. Grubissich, M. Dobarro, H. Aktas, G. Perez, J. A. Halperin. 2003. Deficiency of the mouse complement regulatory protein mCd59b results in spontaneous hemolytic anemia with platelet activation and progressive male infertility. Immunity 18:217.[Medline]
  26. Turnberg, D., M. Botto, J. Warren, B. P. Morgan, M. J. Walport, H. T. Cook. 2003. CD59a deficiency exacerbates accelerated nephrotoxic nephritis in mice. J. Am. Soc. Nephrol. 14:2271.[Abstract/Free Full Text]
  27. Mead, R. J., J. W. Neal, M. R. Griffiths, C. Linington, M. Botto, H. Lassmann, B. P. Morgan. 2004. Deficiency of the complement regulator CD59a enhances disease severity, demyelination and axonal injury in murine acute experimental allergic encephalomyelitis. Lab. Invest. 84:21.[Medline]
  28. Yamada, K., T. Miwa, J. Liu, M. Nangaku, W. C. Song. Critical protection from renal ischemia reperfusion injury by CD55 and CD59. J. Immunol. 172:3869.
  29. Williams, A. S., M. Mizuno, P. J. Richards, D. S. Holt, and B. P. Morgan. Deletion of the gene encoding CD59a in mice increases disease severity in a murine model of rheumatoid arthritis. Arthritis Rheum. In press.
  30. 1997. Relative quantification of gene expression. In ABI Prism 7700 Sequence Detection System Livak Applied Biosystems User Bulletin #2 (part number 4303859).
  31. Iyer, S. B., J. E. Bishop, B. Abrams, V. C. Maino, A. J. Ward, T. P. Christian, K. A. Davis. 1997. QuantiBRITE: A New Standard for Fluorescence Quantitation Becton Dickinson Immunocytometry Systems, San Jose, CA.
  32. Davies, K. A., and J. E. Bishop. Determination of the number of fluorescent molecules on calibration beads for flow cytometry. U.S. Patent 5,620,842. April 15, 1997.
  33. Taylor, P. R., J. T. Nash, E. Theodoridis, A. E. Bygrave, M. J. Walport, M. Botto. 1998. A targeted disruption of the murine complement factor B gene resulting in loss of expression of three genes in close proximity, factor B, C2, and D17H6S45. J. Biol. Chem. 273:1699.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
B. Sivasankar, M. P. Longhi, K. M. E. Gallagher, G. J. Betts, B. P. Morgan, A. J. Godkin, and A. M. Gallimore
CD59 Blockade Enhances Antigen-Specific CD4+ T Cell Responses in Humans: A New Target for Cancer Immunotherapy?
J. Immunol., May 1, 2009; 182(9): 5203 - 5207.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
G. Wu, W. Hu, A. Shahsafaei, W. Song, M. Dobarro, G. K. Sukhova, R. R. Bronson, G.-p. Shi, R. P. Rother, J. A. Halperin, et al.
Complement Regulator CD59 Protects Against Atherosclerosis by Restricting the Formation of Complement Membrane Attack Complex
Circ. Res., February 27, 2009; 104(4): 550 - 558.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
D. D. Kim, T. Miwa, Y. Kimura, R. A. Schwendener, M. van Lookeren Campagne, and W.-C. Song
Deficiency of decay-accelerating factor and complement receptor 1-related gene/protein y on murine platelets leads to complement-dependent clearance by the macrophage phagocytic receptor CRIg
Blood, August 15, 2008; 112(4): 1109 - 1119.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
R. M. Donev, L. C. Gray, B. Sivasankar, T. R. Hughes, C. W. van den Berg, and B. P. Morgan
Modulation of CD59 Expression by Restrictive Silencer Factor-Derived Peptides in Cancer Immunotherapy for Neuroblastoma
Cancer Res., July 15, 2008; 68(14): 5979 - 5987.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
N. S. Bora, S. Kaliappan, P. Jha, Q. Xu, B. Sivasankar, C. L. Harris, B. P. Morgan, and P. S. Bora
CD59, a Complement Regulatory Protein, Controls Choroidal Neovascularization in a Mouse Model of Wet-Type Age-Related Macular Degeneration
J. Immunol., February 1, 2007; 178(3): 1783 - 1790.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. P. Longhi, B. Sivasankar, N. Omidvar, B. P. Morgan, and A. Gallimore
Cutting Edge: Murine CD59a Modulates Antiviral CD4+ T Cell Activity in a Complement-Independent Manner
J. Immunol., December 1, 2005; 175(11): 7098 - 7102.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baalasubramanian, S.
Right arrow Articles by Morgan, B. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baalasubramanian, S.
Right arrow Articles by Morgan, B. P.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS