The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sasso, E. H.
Right arrow Articles by Cacoub, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sasso, E. H.
Right arrow Articles by Cacoub, P.
The Journal of Immunology, 2004, 173: 3549-3556.
Copyright © 2004 by The American Association of Immunologists

Frequent Joining of Bcl-2 to a JH6 Gene in Hepatitis C Virus-Associated t(14;18)1

Eric H. Sasso2,*, Marina Martinez*, Stuart L. Yarfitz{dagger}, Pascale Ghillani{ddagger}, Lucile Musset{ddagger}, Jean-Charles Piette{ddagger} and Patrice Cacoub{ddagger}

* Department of Medicine and {dagger} Division of Bioinformatics, University of Washington, Seattle, WA 98105; and {ddagger} Department of Internal Medicine, Centre Hospitalier Universitaire La Pitié-Salpêtrière, Paris, France


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The t(14;18) chromosomal translocation, which joins the Bcl-2 proto-oncogene to an Ig JH gene, has increased prevalence in patients chronically infected with hepatitis C virus (HCV). We now establish a link between the molecular structure and clinical occurrence of HCV-associated t(14;18). A t(14;18) was detected by PCR in leukocytes from 22 of 46 HCV-infected patients (48%) and 11 of 54 healthy controls (20%) (p = 0.0053). Nucleotide sequence analysis of the Bcl-2/JH joins found a JH6 gene in 18 of 22 (82%) t(14;18) from HCV+ patients, and 3 of 8 (38%) from controls (p = 0.031). The t(14;18) rarely contained JH gene mutations, or an intervening region sequence suggestive of D gene rearrangement or templated nucleotide insertion. Analysis of published t(14;18) nucleotide sequences established that the JH6 prevalence in t(14;18) from normal/nonneoplastic controls (48%) was significantly lower than in t(14;18) from our HCV+ patients (p = 0.004) or from non-Hodgkin’s lymphomas (66%, p = 0.003). We conclude that the increased prevalence of t(14;18) in HCV+ patients occurs with a strong bias for Bcl-2/JH6 joins. In this regard, HCV-associated t(14;18) more closely resemble t(14;18) in lymphomas than t(14;18) from normal subjects.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Patients who are chronically infected with the hepatitis C virus (HCV)3 often have clonal expansions of B lymphocytes and frequently produce mixed cryoglobulins (MC) containing IgM rheumatoid factors (RF), polyclonal IgG, and HCV RNA (1, 2, 3). The IgM RF are polyclonal in type III MC and monoclonal in type II MC (MCII). In some patients with MCII, an immune complex disease occurs with arthritis, vasculitis, and other manifestations, and is known as the mixed cryoglobulinemia syndrome (MCS) (1, 2, 4). Occasionally, HCV-infected patients develop a B cell non-Hodgkin’s lymphoma (NHL), although the strength of this association has been disputed (5).

It is uncertain how often the clonal B cell expansions detected in HCV+ patients are actually a source of cryoglobulin (cryo) IgM RF or are precursors for NHL (2). MCS is strongly associated with clonal B cell expansions, which reflect a dynamic multifactorial process of cell selection and proliferation (1, 6, 7). MCS appears to require immune stimulation by HCV, as MCII and B cell clonal expansions subside when HCV viremia is eliminated by IFN treatment (6). B cell clonal expansion may be promoted by several HCV-related effects, including interactions of HCV proteins with B cell membrane receptors or intracellular regulatory molecules (8, 9, 10, 11, 12), binding of HCV-containing immune complexes to RF B cells (13), and overexpression of B cell proto-oncogenes, such as Bcl-2 (14, 15). A strong bias in the Ig V genes used for HCV-associated monoclonal cryo IgM RF has been reported (3, 7, 16), and may be related to the ability of the HCV E2 protein to bind to Ig encoded by 51p1-related Ig VH genes (9).

The t(14;18) chromosomal translocation has been implicated in the etiology of MCS (14). In t(14;18), a Bcl-2 gene (18q21) is inserted next to an Ig JH gene (14q32), disrupting the IgH locus while markedly increasing transcription of functional Bcl-2. The joined Bcl-2 and JH genes are typically separated by up to ~50 intervening, or N nucleotides, which sometimes contain an incomplete Ig diversity (D) segment. The normal role of the Bcl-2 protein is to act at the mitochondrial membrane to impair apoptosis. Mice transgenic for Bcl-2 have extended B cell survival, marked follicular B cell expansion, increased Ab response to Ags, and increased risk for autoimmunity and lymphoma (17, 18, 19). In humans, t(14;18) is not itself a transforming agent, but is considered an important step in the pathogenesis of certain NHL, being present in 80–90% of follicular lymphomas and some diffuse lymphomas (20). In approximately two-thirds of t(14;18) in NHL, the Bcl-2 breakpoint is in a 150-nt region of Bcl-2 exon 3, called the major breakpoint region (MBR). Almost all other Bcl-2 breakpoints in t(14;18) occur either in a region some 30 kb downstream of the MBR, called the minor breakpoint cluster region (mcr), or in sites between the MBR and mcr (21, 22, 23). In most NHL-associated t(14;18), the Bcl-2/JH segment is followed by an Ig{gamma} C region gene, indicating that the chromosomes 14 in these t(14;18) have undergone IgH class switch, presumably in a peripheral lymphoid organ (21).

Assays using the PCR routinely detect t(14;18) at low frequency in PBMC of many or most normal subjects, indicating that t(14;18) is usually not pathogenic (22, 23, 24, 25, 26, 27, 28, 29, 30). In t(14;18) of NHL, the translocated Bcl-2 gene is most often inserted next to the most 3' of the six JH genes, JH6 (21, 22, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46). In contrast, JH4 genes predominate in normal Ig VH-D-JH rearrangements (47). Bcl-2 translocations are thought to result from errors committed by the RAG enzymes during IgH rearrangement events in developing bone marrow B cells (31, 44). The JH gene frequencies in t(14;18) from normals or patients with diseases other than NHL have not been established, so it is not known whether the propensity to use JH6 genes in t(14;18) varies according to the clinical context.

Two PCR studies found an increased prevalence of t(14;18) in PBMC of patients chronically infected with HCV, detecting t(14;18) in 71 and 39% of HCV+ patients with MCS, 26 and 12% of those without MCS, and 3.5 and 0% of HCV-negative controls (14, 48). The t(14;18) in HCV+ patients usually became undetectable following successful antiviral treatment (49). Fluorescence in situ hybridization detected putative t(14;18) in blood lymphocytes of 86 and 16% of HCV+ subjects with and without MCS, respectively (50). The nucleotide sequences and JH gene usage of t(14;18) were not described in these studies. Consequently, although the prevalence of t(14;18)+ B cells appears to be increased in HCV+ patients, it is not known whether their JH gene usage differs from that of t(14;18) in normal or NHL B cells, and it remains unclear what role t(14;18) plays in HCV-induced B cell clonal expansion, MCII production, and MCS.

To address these questions, we have studied t(14;18) in blood leukocytes from patients chronically infected with HCV and normal controls. We found that t(14;18) were common in normals, but were more prevalent in HCV+ patients, most significantly in patients with MCII or MCS. Nucleotide sequences of Bcl-2/JH joins demonstrated a much greater JH6 bias in t(14;18) of HCV+ patients than normals. These results indicate that chronic HCV infection increases the frequency of t(14;18)+ B lymphocytes by a process that is strongly biased to favor JH6 genes, and as such, more closely resembles that prevailing in NHL than in normals.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Study subjects and sample collection

Forty-six patients with chronic HCV infection were from the Internal Medicine Service of the Hôpital La Pitié-Salpetrière (Paris, France). This group was identical with 47 patients previously described in detail (16), excluding 1 female MCII+, MCS patient whose DNA was no longer available. In the present study, HCV+ patients were 18–83 years old (mean 57.3 years); 23 had an IgM {kappa} MCII (13 female; mean age 62.3 years), and 23 had no MC (11 female; mean age 52.3 years). One MCII+ patient had a history of a treated NHL that was in remission at the time of this study. The MCS cohort comprised 29 patients (14 female; mean age 53.4 years). Control subjects were 54 healthy unpaid volunteers from Seattle, Washington, with no known history of autoimmune disease, whose ages ranged from 24 to 73 years (34 female; mean age 41.4 years). An institutional review board-approved informed consent was signed by all subjects.

Preparation of peripheral blood leukocyte DNA

Peripheral blood was obtained, and a buffy coat leukocyte pellet was prepared from each study subject, using the same methods in Paris for HCV+ patients and Seattle for controls. Paris leukocytes were frozen and mailed to Seattle, where genomic DNA was prepared from all leukocyte pellets (16). The concentrations of leukocytes, mononuclear cells, or B lymphocytes in these specimens were not determined.

PCR amplification of t(14;18) translocations

DNA aliquots of 0.5, 1.0, and 5.0 µg were amplified by 40 cycles of PCR. In 5 HCV+ patients and 1 normal subject, screening assays with 0.5 µg of DNA were positive for t(14;18) by subsequent hybridization analysis (see below), and no other aliquots were tested. For 7 HCV+ patients and 10 normals, no 0.5-µg aliquot was tested. The upstream primer (10 pmol per reaction) was the deoxyoligonucleotide S28, (5'-TTTGACCTTTAGAGAGTTGCTTTACG-3'), corresponding to Bcl-2 positions 2984–3009, in the 5' MBR (51). For downstream priming, 10 pmol of a 15:15:70 mixture of three deoxyoligonucleotides, complementary to the 3' ends, respectively, of the JH2 gene, the JH3 gene, and a site common to the JH1, JH4, JH5, and JH6 genes was used (52). JH primers were a generous gift of E. Milner (Seattle, WA). Each PCR cycle consisted of 1 min at 94°C, 1 min at 58°C, and 3 min at 72°C. The last cycle ended with 10 min at 72°C and cooling to 15°C. PCR used Taq Gold polymerase and reagents from the AmpliTaq kit (PerkinElmer, Wellesley, MA). Each set of PCR included negative controls, and positive controls using genomic DNA from the t(14;18)+ lymphoma B cell line, RL7 (33), which was a generous gift from D. Sabath (Seattle, WA), and/or from a t(14:18)+ HCV+ patient.

Detection of t(14;18) by oligonucleotide hybridization

A 10-µl aliquot of each PCR product was run on a 2% agarose gel. The gel was then dried down or its DNA was transfer blotted to a nylon membrane (Nytran N; Schleicher & Schuell Microscience, Keene, NH), and the gel or membrane was hybridized with the 32P end-labeled deoxyoligonucleotide probe S29 (5'-CACAGACCCACCCAGAGCCC-3'), which corresponds to Bcl-2 positions 3023–3042 (51). Hybridization used an established protocol, with the high stringency wash in tetramethylammonium chloride performed at 58°C (53). The washed gel or membrane was then exposed to film for 2–6 days. Patients were considered t(14:18)+ if a S29+ hybridization band was seen at an appropriate molecular size (~100–300 bp), and negative if no such band was seen or if subsequent nucleotide sequence analysis indicated that false priming or DNA contamination had most likely occurred. DNA samples from three HCV+ patients were retested for t(14;18) by the PCR assay of the Clinical Pathology Service of the University of Washington Medical Center to resolve a concern raised by their t(14;18) nucleotide sequences (see below).

Sequence analysis of t(14;18)+ PCR products

For each patient found to be S29+ by gel hybridization, 5 µl of PCR product underwent 25 cycles of PCR amplification, using S29 and the mixture of JH oligonucleotides as primers. A 5-µl aliquot of this secondary PCR product was run on a 2% agarose gel containing ethidium bromide and viewed under UV light. PCR product (45 µl) was then purified on a MicroSpin S-400 HR column (Amersham Biosciences, Piscataway, NJ), unless more than one band was seen in a gel, in which case individual bands were sliced from the gel and their DNA purified with a QIAquick gel extraction kit (Qiagenetic, Santa Clarita, CA). Purified DNA then underwent sequencing reactions in both directions, using S29 and the JH mixture as primers (BigDye kit with AmpliTaq; Applied Biosystems, Foster City, CA). Reaction products were purified on an AutoSeq G-50 column (Amersham Biosciences) and sequenced on an ABI 377. The length, breakpoints, and mutational status of Bcl-2 MBR and JH genes in the obtained sequences were identified by comparison with published sequences (51, 54, 55). A BLAST search identified D genes (56) and other gene sequences within the t(14;18) intervening regions. Only matches of at least 10 nt were considered.

Search for templated nucleotides

The SIM algorithm (http://genome.cs.mtu.edu/align/align.html; Michigan Technological University, Houghton, MI) was used to identify regions of sequence homology in the t(14;18) intervening sequences (direct and reverse complement) when compared with: 1) the unmutated sequences of the JH1, JH2, JH3, JH4b, JH5b, JH6b, JH6c germline genes; 2) the MBR of the Bcl-2 gene; and 3) two randomly generated 60-mers, 60.1 (ggactgagtacaatgcgcacctcacttgatgggtgcctctgctttacgggtggatttata) and 60.2 (aggtggcgtatcgcaactctacggggtctcggacctgcctagaacatcgcagcagcggga). The similarity score of a sequence match was calculated by assigning +10 for each nucleotide match, –15 for each nucleotide mismatch, –30 for a gap, and –3 for each nucleotide in the gap. Only matches with a similarity score ≥55 were considered. Thus, the shortest acceptable homologies were perfectly matched 6-mers. Next-to-terminal nucleotide mismatches were not allowed. When a t(14;18) intervening region contained an acceptable MBR or JH homology, it was considered biologically plausible for it to have arisen by templated insertion when the following criteria were met: 1) the homologous segment is reasonably close in proximity to the putative MBR or JH template (defined as a maximal separation of 40 nt); 2) the intervening region belongs to a real Bcl-2/JH translocation, i.e., it is not a PCR artifact; and 3) in the case of a JH match, the same JH gene is represented in the t(14;18) as in the homologous intervening region sequence, and the JH gene joined in the t(14;18) contains all the nucleotides found in the homologous intervening region sequence. Evidence for templated D regions was not sought because D gene usage in the reciprocal t(14;18) was not known.

Stastistical analysis

Significance of the frequency of t(14;18) positives and of JH gene usage was determined by a two-sided Fisher’s exact test using Prism software. Significance levels were interpreted according to the Bonferroni correction for multiple comparisons.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of t(14;18) translocations

PCR amplification was performed on DNA from blood leukocytes using primers to the Bcl-2 MBR and the Ig JH genes, followed by hybridization of PCR products with an MBR-specific oligonucleotide probe, S29. Tests using DNA from the t(14;18)+ RL7 NHL line showed the assay to be sensitive to ≤10 pg of DNA, i.e., one to two genomes (Fig. 1). A S29+ hybridization band was obtained with amplified DNA from 25 of 46 HCV+ patients and 12 of 54 controls (Fig. 1). Two distinct hybridization bands were obtained with DNA from 4 of the HCV+ patients and 1 control subject. Three S29+ HCV+ patients and 1 S29+ control subject were classified as t(14:18) based on results of subsequent nucleotide sequence analysis of their PCR products (see below). Thus, t(14;18) was detected in 22 of 46 HCV+ patients (48%) and in 11 of 54 healthy controls (20%) (p = 0.0053) (Table I).



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 1. Detection of t(14;18). PCR products were separated on a 2% agarose gel that was then dried down, hybridized with the Bcl-2 MBR-specific 32P-labeled oligonucleotide probe M29, washed, and exposed to film. PCR amplification was performed with genomic DNA from the RL7 lymphoma line (lanes 1–5, 500 ng, 10 ng, 1 ng, 100 pg, and 10 pg) and from blood leukocytes of five HCV+ patients (lanes 6–10, each 500 ng). At left are m.w. markers in base pairs.

 

View this table:
[in this window]
[in a new window]
 
Table I. Detection of t(14;18) in HCV+ patients and normal controls

 
Among the HCV+ patients, t(14;18) was detected in 13 of 23 (57%) who were MCII+ vs 9 of 23 (39%) who were MC, and in 11 of 17 (65%) with the MCS vs 11 of 29 (38%) who were MCS (Table I). No t(14;18) was detected in the MCS+ patient with a history of treated NHL. A t(14;18) was detected in 2 of the 6 MCII+, MCS patients. These results indicate that the frequency of t(14;18) detection was most significantly increased in the MCII+ (p = 0.0029) and MCS+ (p = 0.0017) subgroups (Table I).

Effect of age on detection of t(14;18)

The prevalence of detectable t(14;18) was similar in all age groups of HCV+ patients (Table II). In normals, it was similar in all age groups and lower than in same-aged HCV+ patients, except for the 60- to 69-year bracket, which contained only two normals, both t(14;18)+ (Table II). Although a positive correlation between age and the percentage of t(14;18)+ cells in normal blood has been reported (23), the four largest published studies found no significant correlation between age among adult subjects and the prevalence of detectable t(14;18) (24, 26, 28, 30). It is thus unlikely that the younger mean age of our controls explains their lower prevalence of t(14;18).


View this table:
[in this window]
[in a new window]
 
Table II. Age distribution of t(14;18) in HCV+ patients and normal controls

 
Relation of Ig VH genes in cryo IgM RF to t(14;18)

A previous study of the MCII+ patients of this study characterized the H chain V regions of their monoclonal cryo IgM RF (16). In the present study, a t(14;18) was detected in 5 of the 11 patients (45%) whose cryo IgM RF were encoded by a 51p1-related gene (VH1 family), in 6 of the 8 (75%) with a VH3-encoded cryo IgM RF, and 2 of the 4 (50%) with a cryo IgM RF encoded by some other Ig VH gene. The more frequent detection of t(14;18) in the VH3 MCII+ patients (75 vs 47%, p = 0.38) and the less frequent detection of t(14;18) in the 51p1 MCII+ patients (45 vs 67%, p = 0.41) are not statistically significant.

Sequence analysis of t(14;18)

A nucleotide sequence was obtainable from the PCR products from all 25 S29+ HCV+ patients, 9 of the 12 S29+ controls, and the RL7 lymphoma cell line (Fig. 2). Only one sequence each was obtainable from the 4 HCV+ patients and 1 control who had two S29+ bands. With three exceptions, all sequences (5' to 3') consisted of the Bcl-2 primer, up to 125 nt of contiguous Bcl-2 MBR sequence, 1–50 intervening region nt, an identifiable JH sequence of 12–45 nt, and the JH1/4/5/6 primer. In one of the three exceptions, P21, the JH region stopped short of completion, but was identifiable as JH6. In another sequence, P29, a nonprimer Bcl-2 sequence and a possible intervening region were identified, but no JH sequence was seen. A third sequence, C30, consisted only of the Bcl-2 and JH1/4/5/6 primers plus 60 intervening nt that were identical with nt 2836–2777 of the minus strand of carcinoembryonic gene family member 9. Subjects P29 and C30 were designated t(14;18) on the basis of the sequencing results. The nucleotide sequences from 3 other S29+ patients, P01, P14, and P38, were nearly identical, but because only P38 was positive for t(14;18) on retesting, the other 2 were classified t(14;18) and their sequences excluded from further consideration (Fig. 2). Thus, a t(14;18) nucleotide sequence was obtained from all 22 t(14;18)+ patients and 8 of 11 t(14;18)+ normal controls. In addition, 1 t(14;18)+ patient, P02 (MCII+, MCS+), provided a blood sample 11 mo after the first, from which two unique t(14;18) sequences were obtained, P02a and P02b (Fig. 2).



View larger version (58K):
[in this window]
[in a new window]
 
FIGURE 2. Sequence analysis of t(14;18). Following the ID number of each t(14;18) nucleotide sequence is the location of the most 3' Bcl-2 MBR nucleotide (Bcl-2 breakpoint; numbering according to Ref.51 ), the sequence and number (N) of intervening nucleotides seen between the Bcl-2 and JH genes, the number of JH nucleotides absent from the 5' end of the JH gene preceded by a minus sign (according to Ref.54 ), the first 10 JH nt, and the type of JH gene (55 ). P and C designate patient and control samples, respectively. RL7 is a follicular lymphoma cell line (33 ). Underlined nucleotides in P02, P57, and C39 are identical with portions of the JH5b, D3-3, and JH5b genes, respectively. The intervening region of C30 is identical with nt 2836–2777 of the minus strand of carcinoembryonic gene family member 9.

 
Bcl-2 breakpoints and intervening region sequences in t(14;18)

The distribution of Bcl-2 breakpoints was similar in the HCV+ patients and control subjects. Most Bcl-2 breakpoints were unique, although MBR locations 3042, 3079, and 3112 each appeared in t(14;18) from two different subjects, and MBR location 3057 appeared in t(14;18) from three different subjects (Fig. 2). All t(14;18) sequences have unique intervening regions, indicating that none was due to contamination. Toward the 3' end, the intervening region of the P57 sequence contained an unmutated 22-nt portion of the D gene D3-3 (Fig. 2). No other intervening region contained a D gene sequence of ≥10 nt.

JH gene usage in t(14;18)

Of the 22 t(14;18) sequences obtained from HCV+ patients, Bcl-2 was joined with a JH1–3 gene in none, a JH4 gene in 1 (4.5%), an indeterminate JH4/5 gene in 1 (4.5%), a JH5 gene in 2 (9.1%), and a JH6 gene in 18 (81.8%) (Table III). The t(14;18) obtained from P02 at a later date, P02a and P02b, were both JH6+ and are not included in the above percentages. Of the 8 t(14;18) sequences obtained from controls, Bcl-2 was joined with a JH1–3 gene in none, a JH4 gene in 4 (50%), a JH4/5 gene in 1 (12.5%), a JH5 gene in none, and a JH6 gene in 3 (37.5%) (Table III). The RL7 lymphoma B cell line used a JH6 gene (Table III). The JH6 gene frequencies in t(14;18) of our HCV+ patients and normals are significantly different (81.8 vs 37.5%, p = 0.031). The 4 HCV+ patients who had a non-JH6 t(14;18), subjects P02, P04, P08, and P30, were 42, 75, 55, and 47 years old, respectively (mean = 55 years), and thus were not skewed to younger ages, compared with the total HCV+ cohort (mean = 57 years). The three controls who had a JH6+ t(14;18), subjects C16, C50, and C61, were 27, 30, and 64 years old, respectively (mean = 40 years), and thus were not skewed to older ages compared with the total normal cohort (mean = 41 years).


View this table:
[in this window]
[in a new window]
 
Table III. JH gene usage in sequenced t(14;18)

 
Somatic mutations in t(14;18)

A search for somatic mutations in the t(14;18) described in Fig. 2 was directed at all Bcl-2 nucleotides between the 5' sequencing primer and the Bcl-2 MBR, and all JH nucleotides between the JH breakpoint and the 3' sequencing primer. Sequences from subjects P29 and C30 were excluded from this analysis (see above). Means of 54 MBR nt (range 0–125) and of 33 JH nt (range 12–44) per t(14;18) were examined. Only 2 nt substitutions were found, both in the JH6 gene of the t(14;18) of one HCV+ patient. Thus, mutations were found in none of the Bcl-2 MBR, and at most one of the JH gene segments.

Templated nucleotide insertions in t(14;18) intervening regions

It has been reported that intervening regions in some t(14;18) contain nucleotides that appear to have been templated from the adjacent Bcl-2 MBR or JH genes (46). To determine whether our t(14;18) intervening regions might contain templated nucleotides, a two-step analysis was conducted. First, to identify regions of homology, all intervening region sequences and their reverse complements were compared with Bcl-2 MBR and JH1-JH6 germline gene sequences. As a control, the intervening regions were also compared with two random 60-mer sequences. Second, for each homology, a similarity score was calculated and biological plausibility was determined. A total of 58 homologies was found in the t(14;18) intervening regions, of which 10 met criteria for biological plausibility. Only 1 of these 10 homologies, the 11-nt JH5b sequence in the intervening region of P02, stands out as a possible case of templated insertion (Fig. 2). An exact 12-nt JH5b sequence was found in the intervening region of C39, but it probably resulted from a mechanism other than templated insertion because the Bcl-2 gene in the C39 t(14;18) is joined to a JH4b gene that requires at least six substitutions to match the intervening JH5b sequence (Fig. 2). The similarity scores of the P02 and C39 homologies, 110 and 120, respectively, greatly exceeded all others. In contrast, the similarity scores of the 9 other biologically plausible homologies (80 in 2, 70 in 2, and ≤65 in 5) had a distribution resembling that of the 49 homologies deemed biologically implausible. Thus, our intervening regions contain one clear case of a possible templated JH insertion, in P02. Some of the other Bcl-2 or JH homologies in our intervening regions might represent templated insertions, but it appears more likely that they are random matches unrelated to the biology of t(14;18).

Comparison of t(14;18) JH gene usage in different clinical contexts

In a report of 99 VH-D-JH rearrangements in B cells from 6 normal subjects, a JH1–3 gene was used in 10.1%, a JH4 in 52.5%, a JH5 in 15.2%, and a JH6 in 22.2% (47). In 105 normal t(14;18), from our 8 controls (Fig. 2) plus 97 normal subjects or patients with nonneoplastic or nonlymphoproliferative disease reported in the literature (22, 23, 24, 25, 26, 27, 28, 29, 30), a JH1–3 gene was used in 10.5%, a JH4 in 31.4%, a JH4/5 in 1.0%, a JH5 in 9.5%, and a JH6 in 47.6% (Table IV). In 232 NHL-associated t(14;18), from the RL7 lymphoma line (Fig. 2) plus 231 NHL in the literature (21, 22, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 51, 57, 58), a JH1–3 gene was used in 2.2%, a JH4 in 22.0%, a JH4/5 in 0.9%, a JH5 in 9.5%, and a JH6 in 65.5% (Table V). These JH gene frequencies demonstrate a progressive shift in bias away from 5' JH gene usage and toward 3' JH gene usage when proceeding from VH-D-JH rearrangements in normal blood B cells, to t(14;18) in normals, to t(14;18) in NHL, and to t(14;18) in HCV+ patients. The shift is most apparent in the usage of JH4 and JH6 genes, for which most intergroup comparisons are significant, including those of HCV t(14;18) vs normal t(14;18) (JH4, p = 0.0078; JH6, p = 0.0043) (Fig. 3, Table VI).


View this table:
[in this window]
[in a new window]
 
Table IV. Prevalence of t(14;18) and JH gene frequencies in studies of normals and patients with nonneoplastic diseases

 

View this table:
[in this window]
[in a new window]
 
Table V. JH gene frequency in t(14;18) in studies of NHL

 


View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 3. JH gene usage in Ig VH-D-JH rearrangements and t(14;18). Frequencies of JH4 and JH6 gene usage are for normal Ig VH-D-JH rearrangements (VDJ) (47 ), t(14;18) from normals/patients with nonneoplastic diseases (NL) (22 23 24 25 26 27 28 29 30 ) (eight subjects from this study), t(14;18) from NHL (21 22 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 51 57 58 ) (RL7 from this study), and t(14;18) from patients chronically infected with HCV (all subjects from this study). The JH4 data do not include t(14;18) classified as indeterminate JH4/JH5 (two NHL and one HCV). Values of p are given in Table VI.

 

View this table:
[in this window]
[in a new window]
 
Table VI. Comparisons of JH4 and JH6 gene frequencies in VH-D-JH rearrangements, and in t(14;18) from normals, NHL, and HCV+ patients

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have found translocations of the Bcl-2 MBR to the Ig JH locus in blood leukocytes of 48% of HCV+ patients vs 20% of normal controls. The most significant increases in prevalence were seen in patients who were MCII+ or MCS+, although the occurrence of t(14;18) may be elevated in the MCII or MCS subgroups as well (Table I). These results are probably conservative estimates because we studied DNA from leukocytes rather than PBMC. Other studies also have found t(14;18) to be prevalent in HCV+ patients. Our results differ somewhat in that we detected t(14;18) in a substantial proportion of normal subjects, and we found the increase in t(14;18) prevalence in the MCII+ and MCS+ subgroups to be less pronounced than seen elsewhere (14, 48, 49). These disparities may relate to differences in the subjects studied and/or the methods of t(14;18) detection.

In studies of normal adults, t(14;18) has been detected in 25–88% of subjects, usually independent of age, when testing up to 0.1% of circulating PBMC (22, 23, 24, 25, 26, 27, 28, 29, 30) (Table IV). The frequency of t(14;18) in PBMC is <1 per 105 in most normal subjects (27, 30). It is presumably higher in HCV+ patients, but quantitative confirmation is needed. Neither previously published t(14;18) frequencies nor our own data were normalized for the exact numbers of B cells tested. Nevertheless, the increased prevalence of t(14;18) in HCV+ patients probably reflects a true increase in incidence, rather than a nonspecific increase in the number of B cells assayed, because the proportion of B cells in PBMC has been reported to be the same in HCV+ patients and HCV normals (59), and to be equal and normal in HCV+ patients with chronic persistent or chronic active hepatitis (60). Ni et al. (61) found that the mean percentage of B cells in PBMC was only 1.22-fold greater in HCV+ patients vs normals, and was lower (and normal) in HCV+ RF+MC+ patients vs HCV+ RFMC patients. The prevalence of t(14;18) was not increased in a study of lymph nodes from HIV+ patients with follicular lymphoid hyperplasia (62), and was decreased in blood lymphocytes of patients with Sjögren’s syndrome and anti-SSA/SSB Abs (29), showing that not all chronic infectious or inflammatory states lead to enhanced detection of t(14;18) in PBMC. An increased frequency of t(14;18) in PBMC has been reported in subjects with a long history of heavy cigarette use (63) or following increased exposure to sunlight (64), but not in healthy males exposed to low-level radiation (65). It is unknown whether these factors affect t(14;18) in HCV+ patients, or whether infections other than HCV can promote t(14;18).

A novel finding in our study is that the translocated Bcl-2 gene was joined with a JH6 gene in 82% of t(14;18) from HCV+ patients, whereas in our normal controls, JH4 genes were most frequent and JH6 appeared in only 38% of the sequenced t(14;18) (p = 0.031). JH6 predominance has been previously noted in t(14;18) of follicular NHL (21, 35, 36, 42, 46), which are germinal center neoplasias, and contrasts with the lower JH6 frequency (37%) in t(11;14) in mantle cell lymphomas (66, 67), which are NHL of pregerminal center B cells. Our data, combined with those from the literature, indicate that the JH6 gene frequency is significantly greater in t(14;18) from HCV+ patients (82%) and NHL (66%) than t(14;18) from normals (48%) (Fig. 3). These frequencies of JH6 gene usage in t(14;18) are all higher than in normal VH-D-JH rearrangements, which Yamada et al. (47) found used a JH4 gene in 53% and a JH6 gene in 22%. The JH6 bias in t(14;18) is probably not a general feature of RAG in NHL precursors because studies of VH-D-JH rearrangements in follicular NHL found that JH3, JH4, and JH5 genes predominated, and JH6 genes were absent (68) or rare (69). Thus, biased usage of the JH6 gene is a common feature of t(14;18). However, the magnitude of this bias depends on the clinical context and is particularly high in HCV+ patients.

The formation of t(14;18) requires RAG enzymes, to introduce IgH breaks on chromosome 14 and to join the free ends to the Bcl-2 gene on chromosome 18, where a break was introduced by an incompletely understood mechanism. RAG is expressed in developing B cells to mediate normal Ig rearrangements, at which time it can also mediate formation of t(14;18), in effect, as a rare accidental byproduct. If a t(14;18) forms with IgH breaks created during an attempted D-to-JH rearrangement, then it will have a Bcl-2/JH join and the reciprocal translocation will have a D/Bcl-2 join, as seen in most t(14;18) in NHL (46). Alternatively, if a t(14;18) forms with IgH breaks created during an attempted VH-to-DJH rearrangement, then the t(14;18) will have a Bcl-2/DJH join and the reciprocal translocation a VH/Bcl-2 join. Only one t(14;18) contained a D gene sequence 5' of the JH gene (P57; Fig. 2), so it appears that all but one of our t(14;18) were created during attempted D-to-JH rearrangements.

In t(14;18) created during attempted primary D-to-JH rearrangements, JH gene usage should resemble that of successful primary D-to-JH rearrangements unless Bcl-2 and D genes differ in their predilections for JH genes, or the survival or proliferation of t(14;18)+ B cells is influenced by the type of JH gene joined in the translocation. To our knowledge, these phenomena have not been reported. Thus, the high frequency of JH6 gene usage in t(14;18) of HCV+ patients, 82%, suggests that HCV-associated t(14;18) arise predominantly when upstream JH genes have been previously deleted, such as during attempted secondary D-to-JH rearrangements, or perhaps VDJ recombinations involving chromosomes with existing VH-D-JH rearrangements. In this regard, HCV-associated t(14;18) resemble t(14;18) in follicular NHL, in which about two-thirds of t(14;18) use a JH6 gene. In contrast, the finding that the JH6 frequency in t(14;18) of normal PBMC (48%) is between those observed in HCV-associated t(14;18) and normal VH-D-JH rearrangements (Fig. 3) suggests that t(14;18) in normals arise predominantly in the context of primary D-to-JH rearrangements, with the portion formed during attempted secondary rearrangements being smaller than in HCV+ patients or NHL.

The site or sites of t(14;18) formation in disease states is uncertain. To explain the JH6 bias in t(14;18) of NHL, it has been proposed that the translocations arise in the context of secondary IgH rearrangements occurring in the periphery (46). This interpretation implies peripheral reactivation of RAG enzymes, which is controversial (70, 71). It has been reported, however, that RAG is expressed by activated B cells in normal tonsils (72) and in rheumatoid synovium (73), and that a propensity for downstream JH gene usage occurs in the setting of B cell autoimmunity, secondary D-to-JH rearrangements, and receptor editing (74, 75). Our findings suggest that similar mechanisms may bear on t(14;18) formation during chronic HCV infection, and that hepatic lymphoid follicles may be a site for this activity (76, 77).

The pathogenic significance of t(14;18)+ B cells in HCV+ patients is of great interest. It is likely that such cells express functional Ig from the nontranslocated IgH allele, as occurs in t(14;18)+ NHL, and it is possible they have prolonged survival when stimulated by Ag (18). B cells containing t(14;18) have not yet been isolated from PBMC of HCV+ patients without lymphoma, so it is not known whether the Ig they express use V genes or have specificities that are characteristic of Ig in MCII. Bcl-2 expression is elevated in PBMC of t(14;18)+ HCV+ patients (78), but it is not known what portion derives from t(14;18)+ B cells. In fact, some t(14;18)+ NHL do not express Bcl-2 (79). Also, it is not clear how often HCV-associated monoclonal B cell expansions are t(14;18)+ or are predecessors of lymphoma. The HCV+ patient in our study with a history of NHL lacked t(14;18), and in a study of HCV-associated NHL, only a minority contained t(14;18) (80). Further study is needed to elucidate the role of t(14;18) as a factor in HCV-related pathology and as a marker of HCV-induced chronic immune stimulation, and to reconcile each with the observed bias for JH6 genes.

In conclusion, we have found that the Bcl-2 MBR is joined with a JH6 gene significantly more often in HCV-associated t(14;18) than in t(14;18) from normal subjects. Therefore, the increased prevalence of t(14;18) in HCV+ patients, as in NHL, is not fully explained by a simple, unbiased enhancement of the processes governing the creation and proliferation of t(14;18)+ B cells in normal subjects. This finding suggests that in the B cell compartment of HCV+ patients, secondary D-to-JH rearrangements have increased frequency and provide the molecular context for the genesis of most t(14;18) seen in these patients. A clearer understanding of the role that t(14;18) plays in the immune responses and pathology of HCV+ patients should emerge as the properties of t(14;18)+ B cells are examined in greater detail.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by Grant 65-3059 from the Royalty Research Foundation to E.H.S., and a grant from the Délégation à la Recherche Clinique, Assistance Publique-Hôpitaux de Paris, to P.G., L.M., J.-C.P., and P.C. Back

2 Address correspondence and reprint requests to Dr. Eric H. Sasso at the current address: Abbott Immunology, Building AP30-2, 200 Abbott Park Road, Abbott Park, IL 60064-6419. E-mail address: eric.sasso{at}abbott.com Back

3 Abbreviations used in this paper: HCV, hepatitis C virus; cryo, cryoglobulin; MBR, major breakpoint region; MC, mixed cryoglobulin; mcr, minor breakpoint cluster region; MCS, mixed cryoglobulinemia syndrome; NHL, non-Hodgkin’s lymphoma; RF, rheumatoid factor. Back

Received for publication January 13, 2004. Accepted for publication June 17, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Franzin, F., D. G. Efremov, G. Pozzato, P. Tulissi, F. Batista, O. R. Burrone. 1995. Clonal B-cell expansions in peripheral blood of HCV-infected patients. Br. J. Haematol. 90:548.[Medline]
  2. De Vita, S., V. De Re, D. Gasparotto, M. Ballaré, B. Pivetta, G. Ferraccioli, S. Pileri, M. Boiocchi, A. Monteverde. 2000. Oligoclonal non-neoplastic B cell expansion is the key feature of type II mixed cryoglobulinemia. Arthritis Rheum. 43:94.[Medline]
  3. Agnello, V., R. T. Chung, L. M. Kaplan. 1992. A role for hepatitis C virus infection in type II cryoglobulinemia. N. Engl. J. Med. 327:1490.[Abstract]
  4. Cacoub, P., F. Lunel-Fabiani, L. Musset, M. Perrin, L. Frangeul, J. M. Leger, J.-M. Huraux, J.-C. Piette, P. Godeau. 1994. Mixed cryoglobulinemia and hepatitis C virus. Am. J. Med. 96:124.[Medline]
  5. Rabkin, C. S., B. H. Tess, R. E. Christianson, W. E. Wright, D. J. Waters, H. J. Alter, B. J. van den Berg. 2002. Prospective study of hepatitis C viral infection as a risk factor for subsequent B-cell neoplasia. Blood 99:4240.[Abstract/Free Full Text]
  6. Mazzarro, C., F. Franzin, P. Tulissi, E. Pussini, M. Crovatto, G. S. Carniello, D. G. Efremov, O. Burrone, O. Santini, G. Pozzato. 1996. Regression of monoclonal B-cell expansion in patients affected by mixed cryoglobulinemia responsive to {alpha}-interferon therapy. Cancer 77:2604.[Medline]
  7. Sasso, E. H.. 2000. The rheumatoid factor response in the etiology of mixed cryoglobulins associated with hepatitis C virus infection. Ann. Med. Interne 151:30.[Medline]
  8. Pileri, P., Y. Uematsu, S. Campagnoli, G. Gali, F. Falugi, R. Petracca, A. J. Weiner, M. Houghton, D. Rosa, G. Grandi, S. Abrignani. 1998. Binding of hepatitis C virus to CD81. Science 282:938.[Abstract/Free Full Text]
  9. Chan, H. C., K. G. Hadlock, S. K. H. Foung, S. Levy. 2001. VH1–69 gene is preferentially used by hepatitis C virus-associated B cell lymphomas and by normal B cells responding to the E2 viral antigen. Blood 97:1023.[Abstract/Free Full Text]
  10. Sakamuto, D., T. Furukawa, T. Takegami. 1995. Hepatitis C virus nonstructural protein NS3 transforms NIH 3T3 cells. J. Virol. 69:3893.[Abstract]
  11. Kato, N., K.-H. Lan, S. K. Ono-Nita, Y. Shiratori, M. Omata. 1997. Hepatitis C virus nonstructural region 5A protein is a potent transcriptional activator. J. Virol. 71:8856.[Abstract]
  12. Ray, R. B., K. Meyer, R. Steele, A. Shrivastava, B. B. Aggarwal, R. Ray. 1998. Inhibition of tumor necrosis factor (TNF-{alpha})-mediated apoptosis by hepatitis C virus core protein. J. Biol. Chem. 273:2256.[Abstract/Free Full Text]
  13. Coulie, P. G., J. Van Snick. 1985. Rheumatoid factor (RF) production during anamnestic immune response in mouse. III. Activation of RF precursor cells is induced by their interaction with immune complexes and carrier-specific helper T cells. J. Exp. Med. 161:88.[Abstract/Free Full Text]
  14. Zignego, A. L., F. Giannelli, M. E. Marrochi, A. Mazzocca, C. Ferri, C. Giannini, M. Monti, P. Caini, G. La Villa, G. Laffi, P. Gentilini. 2000. T(14;18) translocation in chronic hepatitis C virus infection. Hepatology 31:474.[Medline]
  15. Murakami, J., Y. Shimizu, Y. Kashii, T. Kato, M. Minemura, K. Okada, S. Nambu, T. Takahara, K. Higuchi, Y. Maeda, et al 1999. Functional B-cell response in intrahepatic lymphoid follicles in chronic hepatitis C. Hepatology 30:143.[Medline]
  16. Sasso, E. H., P. Ghillani, L. Musset, J. C. Piette, P. Cacoub. 2001. Effect of 51p1-related gene copy number (V1–69 locus) on production of hepatitis C-associated cryoglobulins. Clin. Exp. Immunol. 123:88.[Medline]
  17. McDonnell, T. J., N. Deane, F. M. Platt, G. Nunex, U. Jaeger, J. P. McKearn, S. J. Korsmeyer. 1989. bcl-2-immunoglobulin transgenic mice demonstrate extended B cell survival and follicular lymphoproliferation. Cell 57:79.[Medline]
  18. Strasser, A., S. Whittingham, D. L. Vaux, M. L. Bath, J. M. Adams, S. Cory, A. W. Harris. 1991. Enforced BCL2 expression in B-lymphoid cells prolongs antibody responses and elicits autoimmune disease. Proc. Natl. Acad. Sci. USA 88:8661.[Abstract/Free Full Text]
  19. McDonnell, T. J., S. J. Korsmeyer. 1991. Progression from lymphoid hyperplasia to high-grade malignant lymphoma in mice transgenic for the t(14;18). Nature 349:254.[Medline]
  20. Weiss, L. M., R. A. Warnke, J. Sklar, M. L. Cleary. 1987. Molecular analysis of the t(14;18) chromosomal translocations in malignant lymphomas. N. Engl. J. Med. 317:1185.[Abstract]
  21. Akasaska, T., H. Akasaka, N. Yonetani, H. Ohno, H. Yamabe, S. Fukuhara, M. Okuma. 1998. Refinement of the BCL2/immunoglobulin heavy chain fusion gene t(14;18)(q32;q21) by polymerase chain reaction amplification for long targets. Genes Chromosomes Cancer 21:17.[Medline]
  22. Aster, J. C., Y. Kobayashi, M. Shiota, S. Mori, J. Sklar. 1992. Detection of the t(14;18) at similar frequencies in hyperplastic lymphoid tissues from American and Japanese patients. Am. J. Pathol. 141:291.[Abstract]
  23. Liu, Y., A. M. Hernandez, D. Shibata, G. A. Cortopassi. 1994. BCL2 translocation frequency rises with age in humans. Proc. Natl. Acad. Sci. USA 91:8910.[Abstract/Free Full Text]
  24. Ji, W., G. Qu, P. Ye, X.-Y. Zhang, S. Halabi, M. Ehrlich. 1995. Frequent detection of bcl-2/JH translocation in human blood and organ samples by a quantitative polymerase chain reaction assay. Cancer Res. 55:2876.[Abstract/Free Full Text]
  25. Limpens, J., R. Stad, C. Vos, C. de Vlaam, D. de Jong, G.-J.B. van Ommen, E. Schuuring, P. M. Kluin. 1995. Lymphoma-associated translocation t(14;18) in blood B cells of normal individuals. Blood 85:2528.[Abstract/Free Full Text]
  26. Dölken, G., G. Illerhaus, C. Hirt, R. Mertelsmann. 1996. BCL-2/JH rearrangements in circulating B cells of healthy blood donors and patients with nonmalignant diseases. J. Clin. Oncol. 14:1333.[Abstract/Free Full Text]
  27. Fuscoe, J. C., R. W. Setzer, D. D. Collard, M. M. Moore. 1996. Quantification of t(14;18) in the lymphocytes of healthy adult humans as a possible biomarker for environmental exposures to carcinogens. Carcinogenesis 17:1013.[Abstract/Free Full Text]
  28. Rauzy, O., S. Galoin, J.-J. Chale, D. Adoue, J.-L. Albarede, G. Delsol, T. Al Saati. 1998. Detection of t(14;18) carrying cells in bone marrow and peripheral blood from patients affected by non-lymphoid diseases. J. Clin. Pathol.: Mol. Pathol. 51:333.[Abstract]
  29. Henriksson, G., M. Brant, Z. Sandor, R. Manthorpe, A. Bredberg. 1999. Sjögren’s syndrome: lymphoma predisposition coupled with a reduced frequency of t(14;18) translocations in blood lymphocytes. Mol. Carcinog. 24:226.[Medline]
  30. Summers, K. E., L. K. Goff, G. Wilson, R. K. Gupta, T. A. Lister, J. Fitzgibbon. 2001. Frequency of the Bcl-2/IgH rearrangement in normal individuals: implications for the monitoring of disease in patients with follicular lymphoma. J. Clin. Oncol. 19:420.[Abstract/Free Full Text]
  31. Tsujimoto, Y., J. Gorham, J. Cossman, E. Jaffe, C. Croce. 1985. The t(14;18) chromosome translocations involved in B-cell neoplasms result from mistakes in VDJ joining. Science 229:1390.[Abstract/Free Full Text]
  32. Tsujimoto, Y., M. Bashir, I. Givol, J. Cossman, E. Jaffe, C. M. Croce. 1987. DNA rearrangements in human follicular lymphoma can involve the 5' or the 3' region of the bcl-2 gene. Proc. Natl. Acad. Sci. USA 84:1329.[Abstract/Free Full Text]
  33. Seto, M., U. Jaeger, R. D. Hockett, W. Graininger, S. Bennett, P. Goldman, S. J. Korsmeyer. 1988. Alternative promoters and exons, somatic mutation and deregulation of the Bcl-2-Ig fusion gene in lymphoma. EMBO J. 7:123.[Medline]
  34. Ngan, B.-Y., J. Nourse, M. L. Cleary. 1989. Detection of chromosomal translocation t(14;18) within the minor cluster region of bcl-2 by polymerase chain reaction and direct genomic sequencing of the enzymatically amplified DNA in follicular lymphomas. Blood 73:1759.[Abstract/Free Full Text]
  35. Cotter, F., C. Price, E. Zucca, B. D. Young. 1990. Direct sequence analysis of the 14q+ and 18q chromosome junctions in follicular lymphoma. Blood 76:131.[Abstract/Free Full Text]
  36. Kneba, M., S. Eick, H. Herbst, S. Willigeroth, C. Pott, I. Bolz, M. Bergholz, C. Neumann, H. Stein, G. Kreiger. 1991. Frequency and structure of t(14;18) major breakpoint regions in non-Hodgkin’s lymphomas typed according to the Keil classification: analysis by direct DNA sequencing. Cancer Res. 51:3243.[Abstract/Free Full Text]
  37. Kluin-Nelemans, H. C., J. Limpens, J. Meerabux, G. C. Beverstock, J. H. Jansen, D. de Jong, P. M. Kluin. 1991. A new non-Hodgkin’s B-cell line (DoHH2) with a chromosomal translocation t(14;18) (q32;q21). Leukemia 5:221.[Medline]
  38. Johnson, P. W. M., C. G. A. Price, T. Smith, F. E. Cotter, J. Meerabux, A. Z. S. Rohatiner, B. D. Young, T. A. Lister. 1994. Detection of cells bearing the t(14;18) translocation following myeloablative treatment and autologous bone marrow transplantation for follicular lymphoma. J. Clin. Oncol. 12:798.[Abstract]
  39. Lambrechts, A. C., L. C. J. Dorssers, P. E. Hupkes, R. van Gurp, R. Baumgarten, A. Hagemeijer, M. B. van’t Veer, I. P. Touw. 1994. Genomic organization of the translocation (8;14) and (14:18) in a new lymphoma cell line. Leukemia 8:1164.[Medline]
  40. Farrugia, M. M., L. J. Duan, M. D. Reis, B. Y. Ngan, C. A. Sawka, N. L. Berinstein. 1995. Sequence preservation of the third exon of the bcl-2 gene in non-Hodgkin’s lymphoma: absence of somatic mutation. Leukemia 9:643.[Medline]
  41. Meijerink, J. P. P., J. M. M. Raemaekers, E. J. B. M. Mensink. 1995. New type of t(14;18) in a non-Hodgkin’s lymphoma provides insight in molecular events in early B-cell differentiation. Br. J. Haematol. 91:630.[Medline]
  42. Galoin, S., T. Al Saati, D. Schlaifer, A. Huynh, M. Attal, G. Delsol. 1996. Oligonucleotide clonospecific probes directed against the junctional sequence t(14;18): a new tool for the assessment of minimal residual disease in follicular lymphomas. Br. J. Haematol. 94:676.[Medline]
  43. Matolcsy, A., P. Casali, R. A. Warnke, D. M. Knowles. 1996. Morphologic transformation of follicular lymphoma is associated with somatic mutation of the translocated Bcl-2 gene. Blood 88:3937.[Abstract/Free Full Text]
  44. Stamatopoulos, K., C. Kosmas, C. Belessi, T. Papadaki, S. Afendaki, D. Anagnostou, D. Loukopoulos. 1997. t(14;18) chromosomal translocation in follicular lymphoma: an event occurring with almost equal frequency both at the D to JH and at later stages in the rearrangement process of the immunoglobulin heavy chain locus. Br. J. Haematol. 99:866.[Medline]
  45. Buchonnet, G., P. Lenain, P. Ruminy, S. Lepretre, A. Stamatoullas, F. Parmentier, F. Jardin, C. Duval, H. Tilly, C. Bastard. 2000. Characterization of BCL2-JH rearrangements in follicular lymphoma: PCR detection of 3' BCL2 breakpoints and evidence of a new cluster. Leukemia 14:1563.[Medline]
  46. Jäger, U., S. Böcskör, T. Le, G. Mitterbauer, I. Bolz, A. Chott, M. Kneba, C. Mannhalter, B. Nadel. 2000. Follicular lymphomas’ BCL-2/IgH junctions contain templated nucleotide insertions: novel insights into the mechanism of t(14;18) translocation. Blood 95:3520.[Abstract/Free Full Text]
  47. Yamada, M., R. Wasserman, B. A. Reichard, S. Shane, A. J. Caton, G. Rovera. 1991. Preferential utilization of specific immunoglobulin heavy chain diversity and joining segments in adult human peripheral blood lymphocytes. J. Exp. Med. 173:395.[Abstract/Free Full Text]
  48. Zuckerman, E., T. Zuckerman, D. Sahar, S. Streichman, D. Arrias, E. Sabo, D. Yeshurun, J. M. Rowe. 2001. bcl-2 and immunoglobulin gene rearrangement in patients with hepatitis C virus infection. Br. J. Haematol. 112:364.[Medline]
  49. Zuckerman, E., T. Zuckerman, D. Sahar, S. Streichman, D. Arrias, E. Sabo, D. Yeshurun, J. M. Rowe. 2001. The effect of antiviral therapy on t(14;18) translocation and immunoglobulin gene rearrangement in patients with chronic hepatitis C virus infection. Blood 97:1555.[Abstract/Free Full Text]
  50. Kitray-Cohen, Y., A. Amiel, N. Hilzenrat, D. Buskila, Y. Ashur, M. Fejgin, E. Gaber, R. Safadi, R. Tur-kaspa, M. Lishner. 2000. Bcl-2 rearrangement in patients with chronic hepatitis C associated with essential mixed cryoglobulinemia type II. Blood 96:2910.[Abstract/Free Full Text]
  51. Cleary, M. L., S. D. Smith, J. Sklar. 1986. Cloning and structural analysis of cDNAs for bcl-2 and a hybrid bcl-2/immunoglobulin transcript resulting from the t(14;18) translocation. Cell 47:19.[Medline]
  52. Glas, A. M., E. H. N. van Montfort, J. Storek, E. N. Green, R. P. Drissen, V. J. Bechtold, Z. J. Reilly, M. Dawson, E. C. B. Milner. 2000. B cell autologous somatic mutation deficit following bone marrow transplant. Blood 96:1064.[Abstract/Free Full Text]
  53. Sasso, E. H., K. Willems van Dijk, A. Bull, E. C. B. Milner. 1993. A fetally expressed immunoglobulin VH1 gene belongs to a complex set of alleles. J. Clin. Invest. 91:2358.
  54. Ravetch, J. V., U. Siebenlist, S. Korsmeyer, T. Waldmann, P. Leder. 1981. Structure of the human immunoglobulin µ locus: characterization of embrionic and rearranged J and D genes. Cell 27:583.[Medline]
  55. Mattila, P. S., J. Schugk, H. Wu, O. Makela. 1995. Extensive allelic sequence variation in the J region of the human immunoglobulin heavy chain gene locus. Eu. J. Immunol. 25:2578.[Medline]
  56. Ichihara, Y., H. Matsuoka, Y. Kurodawa. 1988. Organization of human immunoglobulin heavy chain diversity gene loci. EMBO J. 7:4141.[Medline]
  57. Cleary, M. L., J. Sklar. 1985. Nucleotide sequence of a t(14;18) chromosomal breakpoint in follicular lymphoma and demonstration of a breakpoint-cluster region near a transcriptionally active locus on chromosome 18. Proc. Natl. Acad. Sci. USA 82:7439.[Abstract/Free Full Text]
  58. Kneba, M., S. Eick, H. Herbst, C. Pott, I. Bolz, F. Dallenbach, W. Hiddemann, H. Stein. 1995. Low incidence of MBR bcl-2/JH fusion genes in Hodgkin’s disease. J. Pathol. 175:381.[Medline]
  59. Prince, H. E., C. T. Fang. 1992. Unaltered lymphocyte subsets in hepatitis C virus-seropositive blood donors. Transfusion 32:166.[Medline]
  60. Wejstål, R., G. Norkrans, R. Lenkei, O. Weiland, R. Schvarcz, A. Frydén. 1992. Peripheral blood lymphocyte subsets in patients with chronic hepatitis C: effects of interferon treatment. Liver 12:161.[Medline]
  61. Ni, J., E. Hembrador, A. M. Di Bisceglie, I. M. Jacobson, A. H. Talal, D. Butera, C. M. Rice, T. J. Chambers, L. B. Dustin. 2003. Accumulation of lymphocytes with a naive, resting phenotype in a subset of hepatitis C patients. J. Immunol. 170:3429.[Abstract/Free Full Text]
  62. Molina, T. J., F. Devez, C. Bigorgne, A. Le Tourneau, V. Joulin, J. Audouin, J. Diebold. 1996. Detection of bcl-2 rearrangement in HIV-related follicular lymphoid hyperplasia. Br. J. Haematol. 94:705.[Medline]
  63. Bell, D. A., T. Liu, G. A. Cortopassi. 1995. Occurrence of bcl-2 oncogene translocation with increased frequency in the peripheral blood of heavy smokers. J. Natl. Cancer Inst. 87:222.
  64. Benthan, G., A. M. Wolfreys, Y. Liu, G. Cortopassi, M. H. L. Green, C. F. Arlett, J. I. Cole. 1999. Frequencies of hprt mutations and bcl-2 translocations in circulating human lymphocytes are correlated with United Kingdom sunlight records. Mutagenesis 14:527.[Abstract/Free Full Text]
  65. Dölken, L., F. Schüler, G. Dölken. 2002. Frequency of BCL-2/JH translocation in healthy males exposed to low-level radiation in comparison to age-matched healthy controls. Blood 100:1513.[Free Full Text]
  66. Welzel, N., T. Le, R. Marculescu, G. Mitterbauer, A. Chott, C. Pott, M. Kneba, M.-Q. Du, R. Kusec, J. Drach, et al 2001. Templated nucleotide addition and immunoglobulin JH-gene utilization in t(11;14) junctions: implications for the mechanism of translocation and the origin of mantle cell lymphoma. Cancer Res. 61:1629.[Abstract/Free Full Text]
  67. Stamatopoulos, K., C. Kosmas, C. Belessi, P. Kyriazopoulos, T. Papadaki, D. Anagnostou, D. Loukopoulos. 1999. Molecular analysis of bcl-1/IgH junctional sequences in mantle cell lymphoma: potential mechanism of the t(11;14) chromosomal translocation. Br. J. Haematol. 105:190.[Medline]
  68. Bahler, D. W., M. J. Campbell, S. Hart, R. A. Miller, S. Levy, R. Levy. 1991. Ig VH gene expression among human follicular lymphomas. Blood 78:1561.[Abstract/Free Full Text]
  69. Stamatopoulos, K., C. Kosmas, T. Papadaki, C. Belessi, A. Afendaki, D. Anagnostou. 1997. Follicular lymphoma immunoglobulin light chains are affected by the antigen selection process, but to a lesser degree than their partner heavy chains. Br. J. Haematol. 96:132.[Medline]
  70. Yu, W., H. Nagaoka, M. Jankovic, Z. Misulovin, H. Suh, A. Rolink, F. Melchers, E. Meffre, M. C. Nussenzweig. 1999. Continued RAG expression in late stages of B cell development and no apparent re-induction after immunization. Nature 400:614.[Medline]
  71. Gartner, F., F. W. Alt, R. J. Monroe, K. J. Skeidl. 2000. Antigen-independent appearance of recombination activating gene (RAG)-positive bone marrow B cells in the spleens of immunized mice. J. Exp. Med. 192:1745.[Abstract/Free Full Text]
  72. Girschick, H. J., A. C. Grammer, T. Nanki, T. Mayo, P. E. Lipsky. 2001. RAG1 and RAG2 expression by B cell subsets from human tonsil and peripheral blood. J. Immunol. 166:377.[Abstract/Free Full Text]
  73. Itoh, K., E. Meffre, E. Ablesiano, A. Farber, D. Dines, P. Stein, S. E. Asnis, R. A. Furie, R. I. Jain, N. Chiorazzi. 2000. Immunoglobulin heavy chain variable region replacement as a mechanism for receptor revision in rheumatoid arthritis synovial B lymphocytes. J. Exp. Med. 192:1151.[Abstract/Free Full Text]
  74. Klonowski, K. D., L. L. Primiano, M. Monestier. 1999. Atypical VH-D-JH rearrangements in newborn autoimmune MRL mice. J. Immunol. 162:1566.[Abstract/Free Full Text]
  75. Meffre, E., A. Schaefer, H. Wardemann, P. Wilson, E. Davis, M. C. Nussenzweig. 2004. Surrogate light chain expressing human peripheral B cells produce self-reactive antibodies. J. Exp. Med. 199:145.[Abstract/Free Full Text]
  76. Monteverde, A., M. Ballare, S. Pileri. 1997. Hepatic lymphoid aggregates in chronic hepatitis C and mixed cryoglobulinemia. Springer Semin. Immunopathol. 19:99.[Medline]
  77. Sansonno, D., S. De Vita, A. R. Iacobelli, V. Cornacchiulo, M. Boiocchi, F. Dammacco. 1998. Clonal analysis of intrahepatic B cells from HCV-infected patients with and without mixed cryoglobulinemia. J. Immunol. 160:3594.[Abstract/Free Full Text]
  78. Zignego, A. L., C. Ferri, F. Giannelli, C. Giannini, C. Caini, P. Caini, M. Monti, M. E. Marrocchi, E. Di Pietro, G. La Villa, et al 2002. Prevalence of bcl-2 rearrangement in patients with hepatitis C virus-related mixed cryoglobulinemia with or without B-cell lymphomas. Ann. Intern. Med. 137:571.[Abstract/Free Full Text]
  79. Huang, J. Z., W. G. Sanger, T. C. Greiner, L. M. Staudt, D. D. Weisenburger, D. L. Pickering, J. C. Lynch, J. O. Armitage, R. A. Warnke, A. A. Alizadeh, et al 2002. The t(14;18) defines a unique subset of diffuse large B-cell lymphoma with a germinal center B-cell gene expression profile. Blood 99:2285.[Abstract/Free Full Text]
  80. Libra, M., V. De Re, S. De Vita, D. Gasparotto, A. Gloghini, M. Rupolo, M. Degan, A. Marzotto, F. Stivala, A. Carbone, M. Boiocchi. 2003. Low frequency of bcl-2 rearrangement in HCV-associated non-Hodgkin’s lymphoma tissue. Leukemia 17:1433.[Medline]



This article has been cited by other articles:


Home page
Nephrol Dial TransplantHome page
Y. Cao, Y. Zhang, S. Wang, and W. Zou
Detection of the hepatitis C virus antigen in kidney tissue from infected patients with various glomerulonephritis
Nephrol. Dial. Transplant., April 17, 2009; (2009) gfp167v1.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
D-A Landau, M Rosenzwajg, D Saadoun, D Klatzmann, and P Cacoub
The B lymphocyte stimulator receptor-ligand system in hepatitis C virus-induced B cell clonal disorders
Ann Rheum Dis, March 1, 2009; 68(3): 337 - 344.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
D S Viswanatha and A Dogan
Hepatitis C virus and lymphoma
J. Clin. Pathol., December 1, 2007; 60(12): 1378 - 1383.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
D. Sene, N. Limal, P. Ghillani-Dalbin, D. Saadoun, J.-C. Piette, and P. Cacoub
Hepatitis C virus-associated B-cell proliferation--the role of serum B lymphocyte stimulator (BLyS/BAFF)
Rheumatology, January 1, 2007; 46(1): 65 - 69.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
A. Baccarelli, C. Hirt, A. C. Pesatori, D. Consonni, D. G. Patterson Jr, P. A. Bertazzi, G. Dolken, and M. T. Landi
t(14;18) translocations in lymphocytes of healthy dioxin-exposed individuals from Seveso, Italy
Carcinogenesis, October 1, 2006; 27(10): 2001 - 2007.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Libra, A. Gloghini, P. M. Navolanic, A. L. Zignego, V. De Re, A. Carbone, and E. H. Sasso
JH6 Gene Usage among HCV-Associated MALT Lymphomas Harboring t(14;18) Translocation
J. Immunol., April 1, 2005; 174(7): 3839 - 3839.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sasso, E. H.
Right arrow Articles by Cacoub, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sasso, E. H.
Right arrow Articles by Cacoub, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS