The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kao, C.-Y.
Right arrow Articles by Wu, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kao, C.-Y.
Right arrow Articles by Wu, R.
The Journal of Immunology, 2004, 173: 3482-3491.
Copyright © 2004 by The American Association of Immunologists

IL-17 Markedly Up-Regulates {beta}-Defensin-2 Expression in Human Airway Epithelium via JAK and NF-{kappa}B Signaling Pathways1

Cheng-Yuan Kao, Yin Chen, Philip Thai, Shinichiro Wachi, Fei Huang, Christy Kim, Richart W. Harper and Reen Wu2

Center for Comparative Respiratory Biology and Medicine, University of California, Davis, CA 95616


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Using microarray gene expression analysis, we first observed a profound elevation of human {beta}-defensin-2 (hBD-2) message in IL-17-treated primary human airway epithelial cells. Further comparison of this stimulation with a panel of cytokines (IL-1{alpha}, 1{beta}, 2–13, and 15–18; IFN-{gamma}; GM-CSF; and TNF-{alpha}) demonstrated that IL-17 was the most potent cytokine to induce hBD-2 message (>75-fold). IL-17-induced stimulation of hBD-2 was time and dose dependent, and this stimulation also occurred at the protein level. Further studies demonstrated that hBD-2 stimulation was attenuated by IL-17R-specific Ab, but not by IL-1R antagonist or the neutralizing anti-IL-6 Ab. This suggests an IL-17R-mediated signaling pathway rather than an IL-17-induced IL-1{alpha}{beta} and/or IL-6 autocrine/paracrine loop. hBD-2 stimulation was sensitive to the inhibition of the JAK pathway, and to the inhibitors that affect NF-{kappa}B translocation and the DNA-binding activity of its p65 NF-{kappa}B subunit. Transient transfection of airway epithelial cells with an hBD-2 promoter-luciferase reporter gene expression construct demonstrated that IL-17 stimulated promoter-reporter gene activity, suggesting a transcriptional mechanism for hBD-2 induction. These results support an IL-17R-mediated signaling pathway involving JAK and NF-{kappa}B in the transcriptional stimulation of hBD-2 gene expression in airway epithelium. Because IL-17 has been identified in a number of airway diseases, especially diseases related to microbial infection, these findings provide a new insight into how IL-17 may play an important link between innate and adaptive immunity, thereby combating infection locally within the airway epithelium.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Airway epithelium directly interacts with the environment through inhalation and exhalation, and many host defense systems have evolved to eliminate microbial invaders and control infection locally. In addition to providing a physical barrier against infection, the epithelium secretes a variety of antimicrobial substances that can inhibit or neutralize invading pathogens (1, 2, 3, 4). Defensins are one of the two major vertebrate antimicrobial peptide families that provide the chemical shields against a broad spectrum of microorganism infections (5). Based on different arrangements of the six-cysteine motifs, human defensins are categorized into {alpha}- and {beta}-defensin subfamilies (6). The {alpha}-defensins are produced by neutrophils and intestinal Paneth’s cells, while human {beta}-defensins (hBDs)3 are mostly produced by epithelial cells of the skin and the tracheobronchial tree (7).

All of the known hBDs are cationic peptides. They share a conserved motif, which is composed of six spaced cysteines. The hBD coding sequence is organized into two exons. The N terminus of the translation product is led by a signal peptide, which is eventually cut off to form a propeptide and then a mature peptide. Currently, expression of five hBDs has been identified in airway cells (8). hBD-1 was isolated from human plasma and is expressed in most epithelial cells (9, 10). hBD-2 was originally isolated from human skin and is highly expressed after proinflammatory induction in the lung (11). hBD-3 was found recently through the use of several different approaches, which included a genomics-based PCR search and a traditional peptide purification. hBD-3 could be detected in lung tissue following induction with IL-1 (12, 13, 14). hBD-4, which is also reported to be expressed by lung epithelial cells, was discovered through a direct BLAST search of genome sequences on chromosome 8 (15). Using an ORFeome-based Hidden Markov Model search, we recently identified a novel {beta}-defensin, hBD-6, verified its expression, and confirmed the bactericidal activity of the peptide in human airways (8). hBD-6 was found recently to also be expressed in the epididymis (16). All the {beta}-defensins have a broad spectrum of antimicrobial activity at micromolar concentrations.

hBD-2 represents the first human defensin that is produced by epithelial cells following contact with bacteria, viruses, or cytokines, such as IL-1 and TNF-{alpha} (2, 17, 18, 19, 20, 21, 22). Although the nature of the regulation is not completely characterized, both the MAPK signal transduction pathway and the NF-{kappa}B transcription factor have been suggested to be involved (23, 24). Using a panel of cytokines that included IL-1{alpha}, 1{beta}, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, and 18; IFN-{gamma}; GM-CSF; and TNF-{alpha}, we report that IL-17 is the most potent cytokine to stimulate hBD-2 expression in well-differentiated primary human tracheobronchial epithelial (TBE) cells. hBD-2 stimulation increased 75-fold after IL-17 treatment as compared with only 5- to 10-fold with IL-1 and TNF-{alpha} treatments. This stimulation also occurred at the protein level.

IL-17 is a proinflammatory cytokine originally identified as CTLA-8 (25). It displays 58% homology to the T-lymphotropic Herpesvirus Saimiri gene 13 product (26, 27). Subsequent studies of human IL-17 (hIL-17 or IL-17A) demonstrated exclusive expression of this cytokine by activated T cells, predominantly of the prototypic CD45+RO+CD4+ subtype (28). The other potential source of IL-17 was suggested from a recent mouse lung study that demonstrated the potential role of TLR-4 and IL-23 in mediating the stimulation of IL-17 production by CD4+ and CD8+ T cells (29). It was reported that IL-17 could regulate pulmonary neutrophil emigration in the context of local bacterial infections (30, 31). Recent studies have led to the discovery of several other IL-17 gene family members, IL-17B, C, D, E, and F, which are thought to have overlapping physiological functions with hIL-17/IL-17A (32, 33). However, the physiological functions of these new IL-17 gene family members are still unknown.

IL-17 has been found to be elevated in a variety of inflammatory conditions such as with asthma and Gram-negative bacterial pneumonia (33). IL-17 stimulates NF-{kappa}B activation and also the expression of IL-6, IL-8, ICAM, MIP-2, Gro, and GM-CSF in rodent and human cells (34). In human macrophages, IL-17 stimulated the production of proinflammatory cytokines, such as IL-1{beta} and TNF-{alpha} (35). We have recently demonstrated that IL-17 stimulates MUC gene expression partly through a JAK-2-dependent and IL-6 autocrine/paracrine loop in primary human TBE cells (36).

In the present study, initially through microarray gene expression profile analysis, we identify a selective activation of hBD-2 expression by IL-17. Further studies with a panel of cytokines demonstrate that IL-17 is the most potent cytokine that stimulates hBD-2 expression. This stimulation appears to occur at the transcriptional level through JAK/NF-{kappa}B-dependent, and IL-1- and IL-6-independent mechanisms.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents

Recombinant human IL-1{alpha}, 1{beta}, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, and 18; TNF-{alpha}; IFN-{gamma}; GM-CSF; IL-1R antagonist; and IL-17R Ab were purchased from R&D Systems (Minneapolis, MN). Mammalian cells secreting recombinant IL-17A, B, C, D, and E in conditioned medium were obtained from ProteinBank (San Diego, CA). Helenalin, sulfasalazine, AG490, and JAK inhibitor I were purchased from Calbiochem-Novabiochem (San Diego, CA).

Cell culture from human and mouse airway tissues

Human tracheobronchial tissues were obtained from the University of California Medical Center (Sacramento, CA) with patient consent, and also from National Disease Research Interchange (Philadelphia, PA). The University Human Subjects Review Committee approved all procedures involved in tissue procurement. Tissues were collected only from patients without known respiratory tract diseases. Primary cultures derived from these airway tissues have been established before (37, 38). Protease-dissociated TBE cells were plated on a collagen gel substratum-coated Transwell (Corning Costar, Corning, NY) chamber (25 mm) at 1–2 x 104 cells/cm2, in a Ham’s F12/DMEM (1:1) supplemented with insulin (5 µg/ml), transferrin (5 µg/ml), epidermal growth factor (10 ng/ml), dexamethasone (0.1 µM), cholera toxin (10 ng/ml), bovine hypothalamus extract (15 µg/ml), BSA (0.5 mg/ml), and all-trans-retinoic acid (30 nM). After 1 wk in an immersed culture condition, these primary TBE cultures were transferred to an air-liquid interface (biphasic) culture condition. HBE1 cell line is an immortalized line of normal human airway epithelial cells (39). HBE1 cells were cultured under four different conditions: 1) plastic tissue culture surface (TC), 2) Transwell chamber with air-liquid interface condition (BI), 3) collagen gel-coated surface (CG), and 4) collagen gel-coated Transwell chamber with an air-liquid interface condition (BI-CG).

Cytokine, antagonist, and inhibitor treatment

Recombinant human cytokines were dissolved in PBS with 1% BSA and added directly to both the apical and basal sides of medium of the primary TBE cultures (0–100 ng/ml). The control treatments had the same amount of PBS-1% BSA added. In the receptor antagonist studies, the antagonists (40, 200, and 1000 ng/ml) were added to the cultures 30 min before IL-17 treatment. Helenalin, sulfasalazine, AG490, and JAK inhibitor I were dissolved in DMSO, and they were also added to the culture 30 min before IL-17 treatment. The optimal dose for each of the selected inhibitors was determined based on the current literature and by following the manufacturer’s recommendations. A dye exclusion assay with trypan blue was used to test the cell viability of cultured cells treated with each chemical. No obvious cytotoxicity (<0.5%) was found in cultures treated with these chemicals at the doses used.

RNA isolation and Affymetrix GeneChip array analysis

RNA was extracted from cultures using RNA TRIzol reagent (Invitrogen, Carlsbad, CA), according to the manufacturer’s protocol. Affymetrix GeneChip HuGene-U133A oligonucleotide microarrays (Santa Clara, CA) were used to profile gene expression patterns of TBE cells after IL-6 and IL-17 treatments. An initial 30 µg of RNA of each sample was sent to the University of California, Davis Microarray Core Facility (Sacramento, CA). Image data were further analyzed by statistical analysis tools written in R through the Bioconductor project (http://www.bioconductor.org).

Real-time RT-PCR expression analysis

Five micrograms of total RNA was reverse transcribed with Moloney murine leukemia virus-reverse transcriptase (Promega, Madison, WI) by oligo(dT) primers for 90 min at 42°C in 20 µl and then further diluted to 100 µl with water for the following procedures. A total of 2 µl of diluted cDNA was analyzed using 2x SYBR green PCR master mix (Applied Biosystems, Foster City, CA) by an ABI 5700 or ABI PRISM 7900HT Sequence Detection System (Applied Biosystems), following the manufacturer’s protocol. Gene-specific primers were designed according to the sequences to cover the conserved peptide sequence regions. PCR primers used were: hBD-1, forward, CAGTCGCCATGAGAACTTCCT, and reverse, CTGCTGACGCAATTGTAATGA; hBD-2, forward, GCCTCTTCCAGGTGTTTTTG, and reverse, GAGACCACAGGTGCCAATTT; hBD-3, forward, GGTGAAGCCTAGCAGCTATGAG, and reverse, CGCCTCTGACTCTGCAATAAT; mouse {beta}-defensin-3 (mBD-3), forward, GTCTCCACCTGCAGCTTTTAG, and reverse, ACTGCCAATCTGACGAGTGTT; {beta}-actin, forward, AGAAAATCTGGCACCACACC, and reverse, GGGGTGTTGAAGGTCTCAAA; and GAPDH, forward, CAATGACCCCTTCATTGACC, and reverse, GACAAGCTTCCCGTTCTCAG. The PCR was conducted in 96-well optical reaction plates, and each well contained a 50 µl reaction mixture that contained 25 µl of the SYBR green PCR master mix, 1 µl of each forward and reverse primer, 21 µl of water, and 2 µl of cDNA samples. The SYBR green dye was measured at 530 nm during the extension phase. The threshold cycle (Ct) value reflects the cycle number at which the fluorescence generated within a reaction crosses a given threshold. The Ct value assigned to each well thus reflects the point during the reaction at which a sufficient number of amplicons have been accumulated. The relative mRNA amount in each sample was calculated based on its Ct in comparison with the Ct of housekeeping genes, such as {beta}-actin and GAPDH. The results were presented as 2 (Ct of housekeeping gene – Ct of hBD-2), an arbitrary unit. The purity of amplified product was determined as a single peak of the dissociation curve. Real-time PCR was conducted in duplicate for each sample, and the mean value was calculated. This procedure was performed in two or three independent experiments.

Quantification of hBD-2 by a competitive ELISA method

Goat polyclonal Ab to hBD-2 was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Synthetic mature hBD-2 (GIG DPV TCL KSG AIC HPV FCP RRY KQI GTC GLP GTK CCK KP) and DEFB-106 (FFD EKC NKL KGT CKN NCG KNE ELI ALC QKF LKC CRT IQP CGS IID) (8) peptides (Alpha Diagnostic International, San Antonio, TX) were dissolved in 0.01% acetic acid with 0.2% BSA (Sigma-Aldrich, St. Louis, MO). A single Western blot band was detected with the synthetic mature hBD-2 peptide, but not the DEFB-106 peptide, by the commercial anti-hBD-2 polyclonal Ab (data not shown). For a competitive ELISA, hBD-2 was coated in immunoassay microplates (Immulon 2 HB; Fisher Scientific, Pittsburgh, PA) at 200 ng/well in coating buffer (0.1 M sodium bicarbonate/carbonate and 0.02% sodium azide, pH 9.6) overnight at 4°C. Plates were washed once with the washing solution, PBS/Tween 20 (0.05%) buffer (pH 7.4), and nonspecific binding sites were blocked by incubation with PBS/Tween 20/3% BSA buffer for 30 min at room temperature. Plates were further washed twice with the PBS-Tween washing solution (200 µl/well). A standard 1/1000 dilution of primary goat anti-hBD-2 Ab competition mixture containing different amounts of referenced hBD-2 peptide (0–50 ng/mixture) and samples of culture medium prepared from these airway cell cultures was added to each well (200 µl/well), and incubated at 37°C for 2 h. After four more washings, 200 µl/well of 1/1000 dilution of alkaline phosphatase-conjugated anti-goat IgG secondary Ab (Vector Laboratories, Burlingame, CA) was added to each well, and the incubation was continued at 37°C for 1 h. Wells were washed five times, and 200 µl/well of a 1 mg/ml solution of p-nitrophenyl phosphate (Sigma-Aldrich) in substrate buffer (10% diethanolanine and 0.02% sodium azide, pH 9.8) was added for color development (20–40 min at room temperature). The plate was read at 405 nm for the absorbance. Unknown samples were preassayed at three different dilutions to assure that the data were within the linear range of the competition by referenced hBD-2. The results indicated a sensitivity of the competitive ELISA for referenced hBD-2 at 10 ng/well. The results were averaged from triplicate wells of one representative experiment from three independent assays. There was no detectable cross-reaction with the DEFB-106 peptide with this anti-hBD-2 Ab (data not shown).

Cloning of the hBD-2 promoter-luciferase reporter plasmid

A DNA fragment containing the proximal 2.2 kb of the hBD-2 promoter region (–2210 to +24) was amplified from PstI-digested genomic DNA by PCR with the following primers: GTTGCTAGCCTTTGGGACTTCCCCAGCTATG (forward primer with NheI tail) and TTTAAGCTTTGGCTGATGGCTGGGAGCTT (reverse primer with HindIII tail). The amplified product was subcloned into a pGL-3 vector (Promega) with firefly luciferase reporter gene to generate hBD2-2210/Luc plasmid. The authenticity of the clone was confirmed and reconfirmed by DNA sequencing.

Transient transfection and luciferase assay

HBE1 cells were seeded into 24-well plates at a density of 5 x 104 cells/well. One day after plating, cells were transfected with 0.3 µg of hBD2-2210/Luc plasmid DNA and 50 ng of Renilla luciferase expression vector pRL-TK (Promega) using FuGENE 6-based gene transfer protocol (Roche Diagnostic Systems, Indianapolis, IN), according to the manufacturer’s instruction. Eighteen hours after the transfection, cells were treated with various concentrations of IL-17, and cell extracts were prepared for reporter gene assays 24 h after the cytokine treatment. The reporter gene assays were conducted with the Dual-Glo Luciferase Assay System (Promega), according to the manufacturer’s protocol. The relative hBD-2 promoter activities were expressed as relative light units after normalization to the control, Renilla luciferase activity. The results were averaged from triplicate wells of three separate experiments.

Statistical analysis

Data are expressed as mean ± SE. The number of repeats for each experiment is described under Results and also in the figure legends. Group differences were calculated by ANOVA, and p values <0.05 were considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Profound effect of IL-17 on the stimulation of hBD-2 expression in human primary TBE cells

Our recent work has demonstrated that, among a panel of cytokines, both IL-6 and IL-17 are the most potent mediators to stimulate mucin gene expression in primary human TBE cells (36). As an extension of this work, Affymetrix microarray analysis was conducted to profile the gene expression patterns in cells treated with these cytokines. As shown in Fig. 1, the three-dimensional scatter plot of the array data showed that IL-17 pronouncedly stimulated both hBD-2 and MIP-3{alpha}, but not other antimicrobial genes, hBD-1 and various {alpha}-defensins by IL-17, whereas IL-6 had little influence on these genes. MIP-3{alpha} was recently shown to have antimicrobial activity (40). According to these data, the magnitude of the induction for both hBD-2 and MIP-3{alpha} is similar, although the basal level of hBD-2 is 7-fold higher than MIP-3{alpha}. Because of this analysis, this study focused on hBD-2 expression. In the microarray data set, we also observed that IL-17 induced the elevation of IL-8 and G-CSF expression. There was a >2-fold induction of IL-8 and a >3-fold induction of G-CSF, although these induction levels were small compared with the >8-fold induction of hBD-2 and MIP-3{alpha} (data not shown). Our data confirm the induction of IL-8 and G-CSF by IL-17 (34).



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 1. A three-dimensional scatter plot analysis of global gene expression patterns by primary human TBE cells after IL-17 or IL-6 treatment. RNAs were isolated from primary cultures after 24-h treatment with these cytokines (10 ng/ml). A global gene expression analysis was conducted on Affymetrix gene chip, HuGene U133A. Each dot on the plot represents the relative level of expression of a single gene related to cytokine-treated and -untreated cultures. For showing differential expression of genes in the analysis, these dots are plotted three dimensionally. A majority of genes are not differentially expressed, and they are diagonally projected at the center of the plot. These include the expression of various {alpha}-defensins and hBD-1, as shown in red dots in the enlarged inset. The expression of hBD-2 and CCL20 (MIP-3{alpha}), also shown in red dots, was highly differentially expressed with a preferential elevation toward the IL-17 axis.

 
To further evaluate induction of hBD-2, primary TBE cells were treated with a panel of cytokines (10 ng/ml), including IL-1{alpha}, 1{beta}, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, and 18; IFN-{gamma}; GM-CSF; and TNF-{alpha}. Real-time RT-PCR analysis was conducted for hBD-2 expression in these cytokine-treated samples. As shown in Fig. 2, hBD-2 message was elevated in TBE cells by IL-1{alpha}, IL-1{beta}, IL-6, IL-17, and TNF-{alpha}, whereas other cytokines had little influence. Inductions of hBD-2 by IL-1{alpha}, IL-1{beta}, and TNF-{alpha} treatment are consistent with previous reports (17, 18, 41). The observed moderate induction by IL-6 has not been reported before. Overnight (16-h) treatment of airway epithelial cells with IL-17 consistently resulted in a >70-fold induction of hBD-2 message. Treatments of airway cells with IL-2, 3, 4, 8, 9, 10, 11, 12, and 13, even at higher doses (50 ng/ml), did not result in increased hBD-2 message (data not shown). We did not observe any cytokine-induced cytotoxicity. Cell viability, assessed by the trypan blue exclusion method, routinely was greater than 95%.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 2. Real-time PCR analysis of hBD-2 mRNA levels in primary human TBE cells after cytokine treatment. Primary cultures were conducted under air-liquid interface culture condition, as described in the text. On day 21 after plating, cytokines (10 ng/ml) were added to both the apical and basal sides of the culture. Total RNA was collected after overnight incubation (16 h). Cytokines: IL-1{alpha}, 1{beta}, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, and 18; TNF-{alpha}; IFN-{gamma}; and GM-CSF. The expression of mRNA was normalized to {beta}-actin, and the relative quantity was further normalized with the control. Control is vehicle (PBS/1% BSA)-treated cultures. Results are expressed as means ± SE for duplicate samples from one representative experiment of three independent primary cultures from different donors. *, p < 0.05, compared with control.

 
Stimulation of hBD-2 expression by IL-17A and rhIL-17, not by other IL-17 variants

The stimulation of hBD-2 expression was further tested with different IL-17 variants. Mammalian cell-secreted recombinant IL-17A, B, C, D, and E conditioned medium was obtained from a commercial source, and the effects of these secretory products on hBD-2 expression were examined. For comparison, rhIL-17, used in the experiments described above, was included in this study. As shown in Fig. 3, only rhIL-17 and IL-17A conditioned medium was able to stimulate hBD-2 expression after both 24- and 72-h incubation, whereas other IL-17 variants had no effect. These results confirm the specificity of the IL-17A variant in the induction of hBD-2 expression.



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 3. Real-time PCR analysis of hBD-2 mRNA levels in primary human TBE cells after cytokine treatment. Recombinant human IL-17 (20 ng/ml) or undiluted IL-17A, B, C, D, E medium was added to both the apical and basal sides of the culture. Total RNA was collected after 24- and 72-h incubation. The expression of mRNA was analyzed by real-time PCR and normalized to {beta}-actin. The relative quantity was further normalized with the control. Results are means ± SE of duplicate samples from one representative experiment. *, p < 0.05, compared with control.

 
IL-17 stimulates the mouse homologue {beta}-defensin gene, mBD-3

To test the evolutionary conservation of IL-17-induced hBD-2 expression, the expressions of mouse homologues, mBD-3 and mBD-4, by mouse primary tracheal epithelial cells were analyzed by real-time RT-PCR. C57BL/6 mouse tracheal epithelial cells were isolated and cultured under an air-liquid interface condition, similar to that of human primary TBE cells, for 2 wk. IL-17 at 10 ng/ml was added to these cultures, and RNA was harvested 24 h later for real-time RT-PCR quantification, as described in Materials and Methods. Baseline mBD-4 expression was very low, and there was no IL-17 stimulation (data not included). However, IL-17 was able to significantly stimulate mBD-3 message in primary mouse tracheal epithelial cells (Fig. 4). This result is consistent with a recent report demonstrating increased mBD-3 expression, but not mBD-4 expression in mouse cells after bacterial challenge (42, 43). This result provides further support that IL-17 has a significant effect on hBD-2/mBD-3 expression.



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 4. Evolutionary conservation of IL-17 effect of mBD-3 gene expression. C57BL/6 mouse primary tracheal epithelial cells grown under air-liquid interface for 2 wk were replaced with medium containing 20 ng/ml IL-17 or PBS-BSA (control). Total RNA was collected after 24-h treatment. The level of mBD-3 message was analyzed by real-time PCR and normalized to {beta}-actin. Values are mean ± SE of three independent experiments and were compared between control- and IL-17-treated samples. *, p < 0.05.

 
Kinetics studies of IL-17 effects on hBD-2 expression

The effects of IL-17 on hBD-2 gene expression were dose dependent (Fig. 5). IL-17 concentrations as low as 1 ng/ml elicited significant stimulation of hBD-2 gene expression in primary TBE cells after 48 h of treatment. Peak stimulation occurred at 50 ng/ml dose, with no further increase at 100 ng/ml level. Importantly, IL-17 had no effects on hBD-1 and hBD-3 expressions at all the concentrations tested (1–100 ng/ml).



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 5. Dose-dependent elevation of hBD-2 gene expression by human rIL-17. Primary human TBE cells were treated with various amounts of IL-17, as indicated. RNAs were harvested 48 h after the treatment and analyzed by real-time RT-PCR, as described in the text. Notably, no induction of hBD-1 and hBD-3 messages was seen in cultures treated with different amounts of IL-17. Values are means ± SE of three independent primary cultures derived from different donors and were compared between untreated and IL-17-treated samples. *, p < 0.05.

 
Time course studies revealed that the effect of IL-17 on hBD-2 gene expression was also time dependent (Fig. 6). A significant level of stimulation of hBD-2 message by IL-17 (20 ng/ml) was seen within 3 h, and a maximum stimulation was seen at 12 h. This maximal stimulation was maintained for the duration of this time course. Remarkably, up to 100-fold stimulation was seen at 48 h after treatment. IL-17 had no effects on hBD-1 and hBD-3 expression at any time point.



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 6. Time course-dependent IL-17-induced hBD-2 expression. Primary human TBE cells were treated with IL-17 (20 ng/ml), and RNAs were harvested at various times, as indicated. Real-time RT-PCR was conducted to quantify the level of the expression, as described in the text. A and C, No induction of hBD-1 and hBD-3 messages was seen in cultures treated with IL-17 at any time point. B, The effect of IL-17 on hBD-2 expression is time dependent. Values are means ± SE of three independent experiments.

 
A competitive ELISA revealed that hBD-2 gene induction was associated with a significant increase in levels of hBD-2 peptide compared with control medium both after 24-h treatment with IL-17 in biphasic cultured primary human TBE cells and after 1 wk treatment with IL-17 in biphasic cultured HBE1 cells (Fig. 7B). Secretion of hBD-2 peptide was significantly increased from epithelial cells exposed to IL-17 compared with those without IL-17 treatment. Although the dose study of mRNA production (Fig. 5) shows a significant induction starting from 10 ng/ml IL-17 in TBE cells, IL-17-induced protein release was not detected at lower doses (data not shown). However, a long-term 10 ng/ml IL-17 treatment in biphasic HBE1 cells shows a significant induction of the apical hBD-2 peptide release.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 7. A competitive ELISA for the quantification of hBD-2 secretion by culture airway epithelial cells after IL-17 treatment. A, Serial dilutions of synthetic mature hBD-2 peptide were used to generate a competitive standard curve. The log of hBD-2 peptide concentration is plotted against the absorbance value. B, Apical culture fluids, including 300 µl of washing fluid, were collected from primary human TBE cells that were grown to confluency under an air-liquid interface condition, as described in the text. IL-17 was added at 100 ng/ml level 24 h before the medium collection. For the HBE1 cell line, cells were also cultured under an air-liquid interface condition, as described for primary human TBE cells. IL-17 (10 ng/ml) was added to the HBE1 cultures three times per week. At the end of incubation (24-h incubation), apical culture fluids including the wash (total 500 µl) were collected. These collected culture fluids, after a centrifugation to pellet cell debris, were subjected to the competitive hBD-2 ELISA. Secretion of hBD-2 peptide was significantly increased from both airway epithelial cells exposed to IL-17 compared with those without IL-17 treatment. *, p < 0.05.

 
IL-17 also stimulates hBD-2 promoter activity

To further determine whether the observed effect of IL-17 on hBD-2 expression was due to a transcriptional activation, study of the effect of IL-17 on hBD-2 promoter activity was conducted in HBE1 cells using a transient transfection approach with hBD2-2210/Luc chimeric construct DNA. The HBE1 cell line was used simply because it is difficult to carry out gene transfer on primary TBE cells. We also grew HBE1 cells under four different culture conditions: 1) TC, 2) CG, 3) BI, or 4) BI-CG. As shown in Fig. 8, HBE1 cells grown under various culture conditions all responded to IL-17 (10 ng/ml) for elevated hBD-2 expression. These results support the notion that we can study hBD-2 gene expression on this cell line under various culture conditions, including the less differentiated TC condition.



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 8. Effects of the culture conditions on IL-17-induced hBD-2 expression in HBE1 cell line. HBE1 cells were plated on four different culture conditions: 1) TC, 2) BI, 3) CG, and 4) BI-CG in the culture medium supplemented as described for primary human TBE cells. At day 21, these cultures were treated with human rIL-17 (10 ng/ml). For those cultures (BI and BI-CG) that were maintained in air-liquid interface condition, IL-17 was added to both the apical and basal sides of the culture. Total RNA was collected after 48-h incubation. The expression of mRNA was analyzed by real-time PCR and normalized to {beta}-actin. Results are expressed as means ± SE for duplicate samples from one representative experiment. *, p < 0.05 compared with tissue culture condition control.

 
To elucidate the promoter activity, HBE1 cells were plated on a TC dish, and transfection was conducted, as described in the text. As shown in Fig. 9, there was a dose-dependent increase in the relative hBD-2 promoter-based luciferase activity by IL-17. At 5 ng/ml level, IL-17 had a significant effect on the hBD-2 promoter activity, and this effect was maximized at 100 ng/ml level. These results were consistent with the mRNA data, further supporting a transcriptional mechanism of IL-17 in the regulation of hBD-2 expression.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 9. The effect of IL-17 on hBD-2 promoter-reporter gene expression activity. HBE1 cells plated on plastic tissue culture dish were transfected with the hBD2-2210/Luc construct. One day after transfection, different amounts of IL-17 were added, and cells were harvested 24 h later for the reporter gene activity assay, as described in the text. The relative reporter gene, luciferase activity after normalization for the transfection efficiency with the control reporter gene activity, was expressed as fold of activation relative to the unstimulated control. Values are mean ± SE of three independent experiments and were compared between untreated and IL-17-treated samples. *, p < 0.05.

 
Involvement of IL-17R A-mediated JAK/NF-{kappa}B activation in the regulation of hBD-2 expression

To elucidate whether this stimulation goes through the IL-17R A, the neutralizing anti-IL-17R A-specific Ab was used. Various amounts of anti-IL-17R A-specific Ab were applied to primary TBE cells with or without IL-17. Fig. 10 shows a dose-dependent inhibition of IL-17-mediated hBD-2 expression by anti-IL-17R A Ab. At 1 µg/ml level, the inhibition of the IL-17 stimulation was 50%, while the inhibition reached 65% when the Ab was used at 5 µg/ml level. This result suggests the stimulation of hBD-2 expression by IL-17 is via the IL-17R A.



View larger version (29K):
[in this window]
[in a new window]
 
FIGURE 10. The effect of receptor antagonists on IL-17-induced hBD-2 expression. Primary TBE cells were cultured, as described in the text. Confluent cultures were pretreated with 40 ng/ml (lane 3), 200 ng/ml (lane 4), and 1000 ng/ml (lane 5) IL-1R antagonist, and 0.5 µg/ml (lane 7), 1 µg/ml (lane 8), and 5 µg/ml (lanes 6 and 9) IL-17R A Ab 30 min before IL-17 (20 ng/ml) treatment (lanes 2-5 and lanes 7–9). Cells were harvested 24 h later. Lane 1 was control culture without any treatment with antagonist and IL-17. Lane 2 was IL-17 only. Results in IL-1R antagonist experiment are expressed as means ± SE for duplicate samples from one representative experiment. Results in IL-17R Ab neutralization are expressed as means ± SE for samples from two independent primary cultures derived from different donors. *,p < 0.05 when compared with IL-17 treatment alone (lane 2).

 
Because IL-17 has been shown to stimulate the secretion of several proinflammatory cytokines, such as IL-1{alpha}, 1{beta}, 6, and 8, in a number of cell types, including the human TBE cells (44, 45, 46, 47), some of these secretions may serve as an autocrine/paracrine function, as the IL-6 did for IL-17-mediated mucin gene expression, as shown in our recent publication (36). To rule out this possibility, various neutralizing Abs were used. For IL-8, there was no stimulation of hBD-2 expression by this cytokine, which rules out the possible IL-8 autocrine/paracrine loop in IL-17-mediated stimulation. For IL-1{alpha} and IL-1{beta}, IL-1R antagonist at various doses was unable to down-regulate IL-17 stimulation (Fig. 10). A similar negative result was obtained with anti-IL-6-neutralizing Ab (data not shown). These results support the notion that there was no autocrine/paracrine loop mechanism involved in IL-17-mediated hBD-2 expression.

Inhibition of IL-17-dependent hBD-2 expression by JAK and NF-{kappa}B inhibitors

To gain an insight into the possible IL-17-mediated signaling on the regulation of hBD-2 expression, various signaling pathway inhibitors were used. Among these inhibitors, we found JAK inhibitor I and several NF-{kappa}B-related inhibitors were the most potent ones to reverse the enhancement. As shown in Fig. 11A, the reversal of IL-17-mediated hBD-2 expression by JAK inhibitor I was dose dependent. However, the JAK-2-specific inhibitor, AG490, did not diminish IL-17-induced hBD-2 expression (Fig. 11A). On the contrary, there was a superinduction effect for AG490 at the dose normally reported to be sufficient for the inhibition of JAK-2 until a much higher pharmacological dose was used. Fig. 11B shows that both helenalin, an inhibitor for the DNA-binding activity of NF-{kappa}B p65 subunit, and sulfasalazine, an inhibitor to block nuclear translocation of NF-{kappa}B, were very effective in abrogating IL-17-mediated hBD-2 expression. Fig. 11C, in a preliminary fashion, shows no synergistic effect for the combined treatment of JAK inhibitor I with helenalin or sulfasalazine. These results support the notion that both JAK signaling and the activation of NF-{kappa}B are involved in IL-17-mediated hBD-2 expression.



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 11. The effect of JAK and NF-{kappa}B inhibitors on IL-17-induced hBD-2 expression. A, Primary TBE cells were cultured under the same condition as described in Fig. 9. A, Thirty minutes before IL-17 (20 ng/ml) treatment (lanes 2-8), cultures were treated with 10 nM (lane 3), 100 nM (lane 4), and 1000 nM (lane 5) JAK inhibitor I, and 2 µM (lane 6), 10 µM (lane 7), and 50 µM (lane 8) AG490. Cultures were harvested 24 h later for RNA isolation and real-time PCR analysis. Lane 1 was the control without any treatment. B, Primary TBE cells were pretreated with 5 µM (lane 3), 20 µM (lane 4), and 50 µM (lane 5) helenalin, and 100 µM (lane 6), 300 µM (lane 7), and 1000 µM (lane 8) sulfasalazine 30 min before IL-17 (20 ng/ml) treatment (lanes 2-8). Cells were harvested 24 h later after IL-17 treatment for RNA and real-time PCR quantitation. Lane 1 was the control without any treatment. C, TBE cells were cultured and treated, as described above. Thirty minutes before IL-17 treatment (lanes 2-6), cultures were pretreated with a combination of 100 nM (lane 3) and 1000 nM (lane 4) JAK inhibitor I and 5 µM helenalin; and a combination of 100 nM JAK inhibitor I with 300 µM (lane 5) and 1000 µM (lane 6) sulfasalazine. Lane 1 was the control without any treatment. Values in A and B are means ± SE of two to three independent primary cultures derived from different donors and were compared between IL-17- and inhibitor-treated samples. *, p < 0.05 when compared with IL-17 treatment alone (lane 2). Results in C are expressed as means ± SE for duplicate samples from one representative experiment. *, p < 0.05 when compared with IL-17 treatment alone (lane 2).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study describes a novel finding of IL-17 stimulation of hBD-2 expression in human airway epithelial cells. Among a panel of 21 cytokines selected for this study, IL-17 was the most potent stimulatory cytokine, inducing a 75-fold elevation of hBD-2 message. Other cytokines, such as IL-1{alpha}, 1{beta}, 6, and TNF-{alpha}, also have stimulatory effects, but to a much lesser extent (5- to 20-fold). Inductions of hBD-2 by IL-1{alpha}, IL-1{beta}, and TNF-{alpha} treatment are consistent with previous reports (17, 18, 41). hBD-2 is expressed in epithelia of many organs, including the airways of the lungs, where the message is found in both surface epithelia and the serous cells of the submucosal glands (17). The known function of hBD-2 in innate immunity is believed to be related to its antimicrobial activity and to its chemotactic effects on immature dendritic cells and memory T cells (48). IL-17, mainly secreted by activated T cells (26, 27), is prominently elevated in the airway lumen after microbial infections (47, 49) and has a proinflammatory role in mediating neutrophil migration (50) and the production of IL-6 and IL-8 (51, 52). IL-17R knockout mice have impaired clearance of microbial infections (49). Thus, the stimulatory effects of IL-17 on hBD-2 expression suggest an important role of IL-17 for either directing or amplifying the airway inflammatory response from innate response processes to adaptive response mechanisms (Fig. 12).



View larger version (69K):
[in this window]
[in a new window]
 
FIGURE 12. Schematic diagram of the role of IL-17-induced hBD-2 and MIP-3{alpha} in an airway inflammatory response to a bacteria infection. Both hBD-2 and MIP-3{alpha} are essential components of airway innate immunity. Through CCR6, immature dendritic cells and activated T cells are recruited by hBD-2/MIP-3{alpha} to boost the defense mechanism. Activated T cells are able to secrete IL-17 locally and to act on IL-17R A, which is located at the basal side of the polarized airway epithelia. Through JAK and NF-{kappa}B pathways, hBD-2 and MIP-3{alpha} are further induced to provide more antimicrobial activity and the chemotactic recruitment of more inflammatory cells to achieve adaptive immunity.

 
Consistent with this finding, we found that IL-17 can also stimulate MIP-3{alpha} expression based on microarray analysis (Fig. 1). IL-17’s stimulation of hBD-2 is quite selective because other hBDs do not seem affected by IL-17. Like hBD-2, MIP-3{alpha} has recently been shown to have potent antimicrobial activity (40) and the chemoattract activity for both dendritic and T cells through their CCR6 receptors (53). Although these two peptides have no sequence homology and they belong to two different gene families, they share many similarities in the properties of antimicrobial activities, chemotactic activities, binding to the CCR6 receptor, and now, regulation by IL-17. Although the significance of this finding remains unclarified, the similarities and the redundant activity of hBD-2 and MIP-3{alpha} suggest an important role for these molecules in airway innate immunity.

The present studies demonstrate the specificity of IL-17’s effects on hBD-2 and on the mouse homologue, mBD-3. Our data show an IL-17 time- and dose-dependent stimulation of hBD-2 expression in airway epithelial cells. A concentration of IL-17 as low as 1 ng/ml was able to significantly stimulate hBD-2 expression. Other variants of the IL-17 superfamily IL-17 B, C, D, E, and F (32, 33) failed to exhibit any stimulation of hBD-2. This finding was further buttressed by the fact that anti-IL-17R A-neutralizing Ab inhibited the stimulation.

IL-17 has been reported to induce the production of proinflammatory cytokines (47). For example, IL-17 up-regulated IL-1{beta} expression and synthesis in a dose- and time-dependent fashion in human macrophages (35). IL-1{beta} has also been reported to be a major activator of hBD-2 expression in A549 cells cultured with mononuclear phagocytes (24). Furthermore, IL-1{alpha} and IL-1{beta} have both been reported to stimulate the expression of hBD-2 in various tissues (19, 54, 55). It is thus reasonable to hypothesize that the IL-17 effect on hBD-2 gene expression be mediated in an autocrine/paracrine manner via locally secreted IL-1. However, because the IL-1R antagonist did not block IL-17 stimulation of hBD-2 expression, it is unlikely that IL-1 could be involved in IL-17-stimulated hBD-2 expression in human airway epithelial cells. Although the present studies show that IL-6 can mildly induce hBD-2 and IL-17 can induce the release of IL-6, treatment of IL-17-treated cells with an anti-IL-6 Ab did not block hBD-2 gene expression. This suggests that the IL-17 effect was not mediated through IL-6. Taken together, hBD-2 gene expression appears to be modulated by IL-17 via a unique pathway that is independent of an IL-1 or IL-6 autocrine/paracrine loop. This IL-17-dependent mechanism could serve to amplify an acquired immune response against a pathogen by directing innate immune mechanisms (such as antimicrobial peptide or chemoattraction of inflammatory cells) toward sites of T lymphocyte activation.

We have earlier shown that IL-17 induced up-regulation of mucin gene MUC5B expression through an IL-6 autocrine/paracrine loop, and the JAK/STAT pathway (36). However, different JAK isotypes appear to be involved in their regulation of MUC5B and hBD-2. In the case of MUC5B, the stimulation by IL-17 was blocked by the JAK2 inhibitor, AG490. However, hBD-2 was not inhibited by this inhibitor, and its induction by IL-17 was actually accentuated by the AG490 treatment. How this induction is augmented by a JAK2 inhibitor is not entirely clear at this point. Although IL-17A has a low affinity with its receptor, various JAK isotypes, such as JAK-1, -2, -3, and Tyk-2, have been demonstrated to interact with IL-17R A on binding to its ligand in human U937 monocytic leukemia cells (56). Our previous and present results, showing the sensitivity of IL-17’s induction of MUC5B and hBD-2 to JAK inhibitors, support the notion that the IL-17R A in airway epithelial cells may interact with various JAK isotypes upon the ligand binding. The sensitivity of hBD-2 expression to a JAK inhibitor I, which is considered to be not a very specific JAK inhibitor, suggests the likely involvement of JAK-1, -2, -3, and/or Tyk-2 in the receptor-mediated signaling regulation (57).

Further promoter-reporter gene transfection studies in the immortalized normal human bronchial epithelial cell line HBE1 (39) were conducted to further elucidate the molecular nature of this regulation. This cell line behaves similarly to primary TBE cells in its response to IL-17 for inducing hBD-2 expression. We observed an IL-17-induced stimulation of the hBD-2 promoter activity in these transfected cells. This result supports an increased transcriptional activity as a mechanism for hBD-2 induction. We further demonstrated that inhibitors of NF-{kappa}B attenuate IL-17-induced hBD-2 expression. Because IL-17 has been shown to activate NF-{kappa}B in other cell types (58, 59, 60), these findings suggest this also occurs in airway epithelial cells and that hBD-2 is activated downstream to NF-{kappa}B activation. These results are consistent with other studies showing the importance of NF-{kappa}B in the regulation of hBD-2 expression by LPS and by other cytokines (24). Interestingly, in mouse airway epithelial cultures, we observed IL-17-stimulated mBD-3 expression, but not mBD-4. Both mBD-3 and mBD-4 are mouse homologues of hBD-2. However, the sequence analysis reveals the presence of a putative cis-binding site for NF-{kappa}B transcriptional factor in the mBD-3 gene, whereas no such putative site can be found in the 5'-flanking region of the mBD-4 gene. This result further strengthens the participation of NF-{kappa}B-mediated transcriptional mechanisms in IL-17-enhanced hBD-2 expression.

Taking these data together, we propose an IL-17R A-dependent JAK and NF-{kappa}B signaling pathway for the transcriptional induction of hBD-2 gene by IL-17 in airway epithelial cells. Because IL-17 is the most potent cytokine in the stimulation of hBD-2, and because IL-17 elevation has been associated with microbial infections of the airways (34), we propose that such a signaling mechanism may play a role in regulating the adaptive and innate immune responses in the airways (Fig. 12). We hypothesize that during the early stages of an airway bacterial infection, microbial products, such as LPS, bind to nonspecific receptors such as the TLR-4 on epithelial cells to stimulate a low level induction of hBD-2. This innate type of response gives limited protection from bacterial invasion through the antimicrobial and chemotactic activities of hBD-2 (61). Recently, Happel et al. (29) have demonstrated that the IL-17 production by CD4+ and CD8+ T cells in bacteria-infected mouse lung could be boosted by IL-23 through a TLR-4-dependent pathway. Regardless of the source of IL-17, it can be expected that when these acquired immune responses have had more time to develop, activated T cells arrive to the site of infection and locally release IL-17. A preliminary study has shown the presence of IL-17R A at the basal side of the polarized airway epithelia (data not shown). The locally secreted IL-17 can presumably augment the local airway antibacterial defense via its binding to the IL-17R via a JAK/NF-{kappa}B signaling pathway, thus further activating the induction of hBD-2 and/or other chemokines such as MIP-3{alpha} in neighboring epithelial cells.

To our knowledge, no studies have previously shown that IL-17 can induce hBD-2 gene expression in airway epithelial cells. Our results add to the growing body of evidence of the important role that cytokines play in regulating hBD-2 gene expression. We believe that the ability of IL-17 to induce hBD-2 gene expression could play an important role in the airway host defense against bacterial pathogens. Because IL-17 is notable for its ability to stimulate IL-6/IL-8 secretion and to regulate neutrophil migration, it would be intriguing to speculate whether it may play a role in inflammatory airway diseases characterized by neutrophil infiltration such as chronic obstructive pulmonary disease and cystic fibrosis (34).

In conclusion, the results from the present study indicate a novel role for IL-17 in directly stimulating hBD-2 gene expression in primary airway epithelial cells. We further demonstrated that IL-17 mediates its effect on hBD-2 mostly through JAK and NF-{kappa}B signaling events. Further investigations should address whether the involvement of other pathways, such as MAPK pathways, are also involved in IL-17-mediated hBD-2 gene expression. The present results widen the spectrum of known cytokines that can regulate defensin expression and offer preliminary evidence for a novel IL-17-related mechanism coordinating select innate and adaptive immune responses.


    Acknowledgments
 
We thank Yu Hua Zhao for her suggestion on performing the competitive ELISA for hBD-2 and the superior cell culture work in providing primary human TBE cell cultures used in the study. We also acknowledge the support from the Microarray Core Lab at University of California Davis Cancer Center for performing the microarray analysis for this study. Drs. Suzette Smiley-Jewell and Carroll E. Cross are thanked for their editing of the manuscript.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by National Institutes of Health Grants HL35635, ES09701, ES00628, and AI 50496, and California Tobacco-Related Disease Research Program Grant 10RT-0262. Y.C. was aided by a grant from American Lung Association of California Research Program. P.T. was supported by National Institutes of Health Training Grant HL007013. R.W.H. was supported by National Institutes of Health KO8 Grant HL04404. Back

2 Address correspondence and reprint requests to Dr. Reen Wu, Center for Comparative Respiratory Biology and Medicine, Surge 1 Annex, Room 1121, University of California, One Shields Avenue, Davis, CA 95616. E-mail address: rwu{at}ucdavis.edu Back

3 Abbreviations used in this paper: hBD, human {beta}-defensin; BI, Transwell chamber with air-liquid interface condition; CG, collagen gel-coated surface; Ct, threshold cycle; hIL, human IL; mBD, mouse {beta}-defensin; TBE, tracheobronchial epithelial; TC, plastic tissue culture surface. Back

Received for publication December 29, 2003. Accepted for publication June 24, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Diamond, G., D. Legarda, L. K. Ryan. 2000. The innate immune response of the respiratory epithelium. Immunol. Rev. 173:27.[Medline]
  2. Becker, M. N., G. Diamond, M. W. Verghese, S. H. Randell. 2000. CD14-dependent lipopolysaccharide-induced {beta}-defensin-2 expression in human tracheobronchial epithelium. J. Biol. Chem. 275:29731.[Abstract/Free Full Text]
  3. Ganz, T.. 2002. Immunology: versatile defensins. Science 298:977.[Free Full Text]
  4. Ganz, T.. 2002. Epithelia: not just physical barriers. Proc. Natl. Acad. Sci. USA 99:3357.[Free Full Text]
  5. Lehrer, R. I., A. K. Lichtenstein, T. Ganz. 1993. Defensins: antimicrobial and cytotoxic peptides of mammalian cells. Annu. Rev. Immunol. 11:105.[Medline]
  6. Ganz, T.. 2002. Antimicrobial polypeptides in host defense of the respiratory tract. J. Clin. Invest. 109:693.[Medline]
  7. Schutte, B. C., P. B. McCray, Jr. 2002. {beta}-Defensins in lung host defense. Annu. Rev. Physiol. 64:709.[Medline]
  8. Kao, C. Y., Y. Chen, Y. H. Zhao, R. Wu. 2003. ORFeome-based search of airway epithelial cell-specific novel human {beta}-defensin genes. Am. J. Respir. Cell Mol. Biol. 29:71.[Abstract/Free Full Text]
  9. Bensch, K. W., M. Raida, H. J. Magert, P. Schulz-Knappe, W. G. Forssmann. 1995. hBD-1: a novel {beta}-defensin from human plasma. FEBS Lett. 368:331.[Medline]
  10. Zhao, C., I. Wang, R. I. Lehrer. 1996. Widespread expression of {beta}-defensin hBD-1 in human secretory glands and epithelial cells. FEBS Lett. 396:319.[Medline]
  11. Harder, J., J. Bartels, E. Christophers, J. M. Schroder. 1997. A peptide antibiotic from human skin. Nature 387:861.[Medline]
  12. Garcia, J. R., F. Jaumann, S. Schulz, A. Krause, J. Rodriguez-Jimenez, U. Forssmann, K. Adermann, E. Kluver, C. Vogelmeier, D. Becker, et al 2001. Identification of a novel, multifunctional {beta}-defensin (human {beta}-defensin 3) with specific antimicrobial activity: its interaction with plasma membranes of Xenopus oocytes and the induction of macrophage chemoattraction. Cell Tissue Res. 306:257.[Medline]
  13. Harder, J., J. Bartels, E. Christophers, J. M. Schroder. 2001. Isolation and characterization of human {beta}-defensin-3, a novel human inducible peptide antibiotic. J. Biol. Chem. 276:5707.[Abstract/Free Full Text]
  14. Jia, H. P., B. C. Schutte, A. Schudy, R. Linzmeier, J. M. Guthmiller, G. K. Johnson, B. F. Tack, J. P. Mitros, A. Rosenthal, T. Ganz, P. B. McCray, Jr. 2001. Discovery of new human {beta}-defensins using a genomics-based approach. Gene 263:211.[Medline]
  15. Garcia, J. R., A. Krause, S. Schulz, F. J. Rodriguez-Jimenez, E. Kluver, K. Adermann, U. Forssmann, A. Frimpong-Boateng, R. Bals, W. G. Forssmann. 2001. Human {beta}-defensin 4: a novel inducible peptide with a specific salt-sensitive spectrum of antimicrobial activity. FASEB J. 15:1819.[Free Full Text]
  16. Yamaguchi, Y., T. Nagase, R. Makita, S. Fukuhara, T. Tomita, T. Tominaga, H. Kurihara, Y. Ouchi. 2002. Identification of multiple novel epididymis-specific {beta}-defensin isoforms in humans and mice. J. Immunol. 169:2516.[Abstract/Free Full Text]
  17. Singh, P. K., H. P. Jia, K. Wiles, J. Hesselberth, L. Liu, B. A. Conway, E. P. Greenberg, E. V. Valore, M. J. Welsh, T. Ganz, et al 1998. Production of {beta}-defensins by human airway epithelia. Proc. Natl. Acad. Sci. USA 95:14961.[Abstract/Free Full Text]
  18. Harder, J., U. Meyer-Hoffert, L. M. Teran, L. Schwichtenberg, J. Bartels, S. Maune, J. M. Schroder. 2000. Mucoid Pseudomonas aeruginosa, TNF-{alpha}, and IL-1{beta}, but not IL-6, induce human {beta}-defensin-2 in respiratory epithelia. Am. J. Respir. Cell Mol. Biol. 22:714.[Abstract/Free Full Text]
  19. Liu, A. Y., D. Destoumieux, A. V. Wong, C. H. Park, E. V. Valore, L. Liu, T. Ganz. 2002. Human {beta}-defensin-2 production in keratinocytes is regulated by interleukin-1, bacteria, and the state of differentiation. J. Invest. Dermatol. 118:275.[Medline]
  20. Liu, L., A. A. Roberts, T. Ganz. 2003. By IL-1 signaling, monocyte-derived cells dramatically enhance the epidermal antimicrobial response to lipopolysaccharide. J. Immunol. 170:575.[Abstract/Free Full Text]
  21. Duits, L. A., P. H. Nibbering, E. van Strijen, J. B. Vos, S. P. Mannesse-Lazeroms, M. A. van Sterkenburg, P. S. Hiemstra. 2003. Rhinovirus increases human {beta}-defensin-2 and -3 mRNA expression in cultured bronchial epithelial cells. FEMS Immunol. Med. Microbiol. 38:59.[Medline]
  22. Uehara, N., A. Yagihashi, K. Kondoh, N. Tsuji, T. Fujita, H. Hamada, N. Watanabe. 2003. Human {beta}-defensin-2 induction in Helicobacter pylori-infected gastric mucosal tissues: antimicrobial effect of overexpression. J. Med. Microbiol. 52:41.[Abstract/Free Full Text]
  23. Krisanaprakornkit, S., J. R. Kimball, B. A. Dale. 2002. Regulation of human {beta}-defensin-2 in gingival epithelial cells: the involvement of mitogen-activated protein kinase pathways, but not the NF-{kappa}B transcription factor family. J. Immunol. 168:316.[Abstract/Free Full Text]
  24. Tsutsumi-Ishii, Y., I. Nagaoka. 2003. Modulation of human {beta}-defensin-2 transcription in pulmonary epithelial cells by lipopolysaccharide-stimulated mononuclear phagocytes via proinflammatory cytokine production. J. Immunol. 170:4226.[Abstract/Free Full Text]
  25. Rouvier, E., M. F. Luciani, M. G. Mattei, F. Denizot, P. Golstein. 1993. CTLA-8, cloned from an activated T cell, bearing AU-rich messenger RNA instability sequences, and homologous to a herpesvirus Saimiri gene. J. Immunol. 150:5445.[Abstract]
  26. Yao, Z., S. L. Painter, W. C. Fanslow, D. Ulrich, B. M. Macduff, M. K. Spriggs, R. J. Armitage. 1995. Human IL-17: a novel cytokine derived from T cells. J. Immunol. 155:5483.[Abstract]
  27. Yao, Z., W. C. Fanslow, M. F. Seldin, A. M. Rousseau, S. L. Painter, M. R. Comeau, J. I. Cohen, M. K. Spriggs. 1995. Herpesvirus Saimiri encodes a new cytokine, IL-17, which binds to a novel cytokine receptor. Immunity 3:811.[Medline]
  28. Fossiez, F., O. Djossou, P. Chomarat, L. Flores-Romo, S. Ait-Yahia, C. Maat, J. J. Pin, P. Garrone, E. Garcia, S. Saeland, et al 1996. T cell interleukin-17 induces stromal cells to produce proinflammatory and hematopoietic cytokines. J. Exp. Med. 183:2593.[Abstract/Free Full Text]
  29. Happel, K. I., M. Zheng, E. Young, L. J. Quinton, E. Lockhart, A. J. Ramsay, J. E. Shellito, J. R. Schurr, G. J. Bagby, S. Nelson, J. K. Kolls. 2003. Cutting edge: roles of Toll-like receptor 4 and IL-23 in IL-17 expression in response to Klebsiella pneumoniae infection. J. Immunol. 170:4432.[Abstract/Free Full Text]
  30. Miyamoto, M., O. Prause, M. Sjostrand, M. Laan, J. Lotvall, A. Linden. 2003. Endogenous IL-17 as a mediator of neutrophil recruitment caused by endotoxin exposure in mouse airways. J. Immunol. 170:4665.[Abstract/Free Full Text]
  31. Ferretti, S., O. Bonneau, G. R. Dubois, C. E. Jones, A. Trifilieff. 2003. IL-17, produced by lymphocytes and neutrophils, is necessary for lipopolysaccharide-induced airway neutrophilia: IL-15 as a possible trigger. J. Immunol. 170:2106.[Abstract/Free Full Text]
  32. Aggarwal, S., A. L. Gurney. 2002. IL-17: prototype member of an emerging cytokine family. J. Leukocyte Biol. 71:1.[Abstract/Free Full Text]
  33. Moseley, T. A., D. R. Haudenschild, L. Rose, A. H. Reddi. 2003. Interleukin-17 family and IL-17 receptors. Cytokine Growth Factor Rev. 14:155.[Medline]
  34. Kolls, J. K., S. T. Kanaly, A. J. Ramsay. 2003. Interleukin-17: an emerging role in lung inflammation. Am. J. Respir. Cell Mol. Biol. 28:9.[Free Full Text]
  35. Jovanovic, D. V., J. A. Di Battista, J. Martel-Pelletier, F. C. Jolicoeur, Y. He, M. Zhang, F. Mineau, J. P. Pelletier. 1998. IL-17 stimulates the production and expression of proinflammatory cytokines, IL-{beta} and TNF-{alpha}, by human macrophages. J. Immunol. 160:3513.[Abstract/Free Full Text]
  36. Chen, Y., P. Thai, Y. H. Zhao, Y. S. Ho, M. M. DeSouza, R. Wu. 2003. Stimulation of airway mucin gene expression by interleukin (IL)-17 through IL-6 paracrine/autocrine loop. J. Biol. Chem. 278:17036.[Abstract/Free Full Text]
  37. Wu, R., W. R. Martin, C. B. Robinson, J. A. St. George, C. G. Plopper, G. Kurland, J. A. Last, C. E. Cross, R. J. McDonald, R. Boucher. 1990. Expression of mucin synthesis and secretion in human tracheobronchial epithelial cells grown in culture. Am. J. Respir. Cell Mol. Biol. 3:467.
  38. Wu, R., Y. H. Zhao, M. M. Chang. 1997. Growth and differentiation of conducting airway epithelial cells in culture. Eur. Respir. J. 10:2398.[Abstract]
  39. Yankaskas, J. R., J. E. Haizlip, M. Conrad, D. Koval, E. Lazarowski, A. M. Paradiso, C. A. Rinehart, Jr, B. Sarkadi, R. Schlegel, R. C. Boucher. 1993. Papilloma virus immortalized tracheal epithelial cells retain a well-differentiated phenotype. Am. J. Physiol. 264:C1219.
  40. Yang, D., Q. Chen, D. M. Hoover, P. Staley, K. D. Tucker, J. Lubkowski, J. J. Oppenheim. 2003. Many chemokines including CCL20/MIP-3{alpha} display antimicrobial activity. J. Leukocyte Biol. 74:448.[Abstract/Free Full Text]
  41. O’Neil, D. A., E. M. Porter, D. Elewaut, G. M. Anderson, L. Eckmann, T. Ganz, M. F. Kagnoff. 1999. Expression and regulation of the human {beta}-defensins hBD-1 and hBD-2 in intestinal epithelium. J. Immunol. 163:6718.[Abstract/Free Full Text]
  42. Bals, R., X. Wang, R. L. Meegalla, S. Wattler, D. J. Weiner, M. C. Nehls, J. M. Wilson. 1999. Mouse {beta}-defensin 3 is an inducible antimicrobial peptide expressed in the epithelia of multiple organs. Infect. Immun. 67:3542.[Abstract/Free Full Text]
  43. Jia, H. P., S. A. Wowk, B. C. Schutte, S. K. Lee, A. Vivado, B. F. Tack, C. L. Bevins, P. B. McCray, Jr. 2000. A novel murine {beta}-defensin expressed in tongue, esophagus, and trachea. J. Biol. Chem. 275:33314.[Abstract/Free Full Text]
  44. Laan, M., Z. H. Cui, H. Hoshino, J. Lotvall, M. Sjostrand, D. C. Gruenert, B. E. Skoogh, A. Linden. 1999. Neutrophil recruitment by human IL-17 via C-X-C chemokine release in the airways. J. Immunol. 162:2347.[Abstract/Free Full Text]
  45. Molet, S., Q. Hamid, F. Davoine, E. Nutku, R. Taha, N. Page, R. Olivenstein, J. Elias, J. Chakir. 2001. IL-17 is increased in asthmatic airways and induces human bronchial fibroblasts to produce cytokines. J. Allergy Clin. Immunol. 108:430.[Medline]
  46. Laan, M., L. Palmberg, K. Larsson, A. Linden. 2002. Free, soluble interleukin-17 protein during severe inflammation in human airways. Eur. Respir. J. 19:534.[Abstract/Free Full Text]
  47. Ye, P., P. B. Garvey, P. Zhang, S. Nelson, G. Bagby, W. R. Summer, P. Schwarzenberger, J. E. Shellito, J. K. Kolls. 2001. Interleukin-17 and lung host defense against Klebsiella pneumoniae infection. Am. J. Respir. Cell Mol. Biol. 25:335.[Abstract/Free Full Text]
  48. Yang, D., A. Biragyn, L. W. Kwak, J. J. Oppenheim. 2002. Mammalian defensins in immunity: more than just microbicidal. Trends Immunol. 23:291.[Medline]
  49. Ye, P., F. H. Rodriguez, S. Kanaly, K. L. Stocking, J. Schurr, P. Schwarzenberger, P. Oliver, W. Huang, P. Zhang, J. Zhang, et al 2001. Requirement of interleukin 17 receptor signaling for lung CXC chemokine and granulocyte colony-stimulating factor expression, neutrophil recruitment, and host defense. J. Exp. Med. 194:519.[Abstract/Free Full Text]
  50. Hoshino, H., J. Lotvall, B. E. Skoogh, A. Linden. 1999. Neutrophil recruitment by interleukin-17 into rat airways in vivo: role of tachykinins. Am. J. Respir. Crit. Care Med. 159:1423.[Abstract/Free Full Text]
  51. Kawaguchi, M., F. Kokubu, H. Kuga, S. Matsukura, H. Hoshino, K. Ieki, T. Imai, M. Adachi, S. K. Huang. 2001. Modulation of bronchial epithelial cells by IL-17. J. Allergy Clin. Immunol. 108:804.[Medline]
  52. Jones, C. E., K. Chan. 2002. Interleukin-17 stimulates the expression of interleukin-8, growth-related oncogene-{alpha}, and granulocyte-colony-stimulating factor by human airway epithelial cells. Am. J. Respir. Cell Mol. Biol. 26:748.[Abstract/Free Full Text]
  53. Schutyser, E., S. Struyf, J. Van Damme. 2003. The CC chemokine CCL20 and its receptor CCR6. Cytokine Growth Factor Rev. 14:409.[Medline]
  54. Moon, S. K., H. Y. Lee, J. D. Li, M. Nagura, S. H. Kang, Y. M. Chun, F. H. Linthicum, T. Ganz, A. Andalibi, D. J. Lim. 2002. Activation of a Src-dependent Raf-MEK1/2-ERK signaling pathway is required for IL-1{alpha}-induced up-regulation of {beta}-defensin 2 in human middle ear epithelial cells. Biochim. Biophys. Acta 1590:41.[Medline]
  55. McDermott, A. M., R. L. Redfern, B. Zhang, Y. Pei, L. Huang, R. J. Proske. 2003. Defensin expression by the cornea: multiple signalling pathways mediate IL-1{beta} stimulation of hBD-2 expression by human corneal epithelial cells. Invest. Ophthalmol. Visual Sci. 44:1859.[Abstract/Free Full Text]
  56. Subramaniam, S. V., R. S. Cooper, S. E. Adunyah. 1999. Evidence for the involvement of JAK/STAT pathway in the signaling mechanism of interleukin-17. Biochem. Biophys. Res. Commun. 262:14.[Medline]
  57. Thompson, J. E., R. M. Cubbon, R. T. Cummings, L. S. Wicker, R. Frankshun, B. R. Cunningham, P. M. Cameron, P. T. Meinke, N. Liverton, Y. Weng, J. A. DeMartino. 2002. Photochemical preparation of a pyridone containing tetracycle: a Jak protein kinase inhibitor. Bioorg. Med. Chem. Lett. 12:1219.[Medline]
  58. Shalom-Barak, T., J. Quach, M. Lotz. 1998. Interleukin-17-induced gene expression in articular chondrocytes is associated with activation of mitogen-activated protein kinases and NF-{kappa}B. J. Biol. Chem. 273:27467.[Abstract/Free Full Text]
  59. Awane, M., P. G. Andres, D. J. Li, H. C. Reinecker. 1999. NF-{kappa}B-inducing kinase is a common mediator of IL-17-, TNF-{alpha}-, and IL-1{beta}-induced chemokine promoter activation in intestinal epithelial cells. J. Immunol. 162:5337.[Abstract/Free Full Text]
  60. Hata, K., A. Andoh, M. Shimada, S. Fujino, S. Bamba, Y. Araki, T. Okuno, Y. Fujiyama, T. Bamba. 2002. IL-17 stimulates inflammatory responses via NF-{kappa}B and MAP kinase pathways in human colonic myofibroblasts. Am. J. Physiol. 282:G1035.
  61. Yang, D., O. Chertov, S. N. Bykovskaia, Q. Chen, M. J. Buffo, J. Shogan, M. Anderson, J. M. Schroder, J. M. Wang, O. M. Howard, J. J. Oppenheim. 1999. {beta}-Defensins: linking innate and adaptive immunity through dendritic and T cell CCR6. Science 286:525.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
A. Freitas, J. C. Alves-Filho, T. Victoni, T. Secher, H. P. Lemos, F. Sonego, F. Q. Cunha, and B. Ryffel
IL-17 Receptor Signaling Is Required to Control Polymicrobial Sepsis
J. Immunol., June 15, 2009; 182(12): 7846 - 7854.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
L. Zhu, P.-k. Lee, W.-m. Lee, Y. Zhao, D. Yu, and Y. Chen
Rhinovirus-Induced Major Airway Mucin Production Involves a Novel TLR3-EGFR-Dependent Pathway
Am. J. Respir. Cell Mol. Biol., May 1, 2009; 40(5): 610 - 619.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. R. Chan, J. S. Liu, D. A. Pociask, M. Zheng, T. A. Mietzner, T. Berger, T. W. Mak, M. C. Clifton, R. K. Strong, P. Ray, et al.
Lipocalin 2 Is Required for Pulmonary Host Defense against Klebsiella Infection
J. Immunol., April 15, 2009; 182(8): 4947 - 4956.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Hamada, M. d. l. L. Garcia-Hernandez, J. B. Reome, S. K. Misra, T. M. Strutt, K. K. McKinstry, A. M. Cooper, S. L. Swain, and R. W. Dutton
Tc17, a Unique Subset of CD8 T Cells That Can Protect against Lethal Influenza Challenge
J. Immunol., March 15, 2009; 182(6): 3469 - 3481.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
H. R. Conti, F. Shen, N. Nayyar, E. Stocum, J. N. Sun, M. J. Lindemann, A. W. Ho, J. H. Hai, J. J. Yu, J. W. Jung, et al.
Th17 cells and IL-17 receptor signaling are essential for mucosal host defense against oral candidiasis
J. Exp. Med., February 16, 2009; 206(2): 299 - 311.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. L. Kreindler, C. A. Bertrand, R. J. Lee, T. Karasic, S. Aujla, J. M. Pilewski, R. A. Frizzell, and J. K. Kolls
Interleukin-17A induces bicarbonate secretion in normal human bronchial epithelial cells
Am J Physiol Lung Cell Mol Physiol, February 1, 2009; 296(2): L257 - L266.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Guttman-Yassky, M. A. Lowes, J. Fuentes-Duculan, L. C. Zaba, I. Cardinale, K. E. Nograles, A. Khatcherian, I. Novitskaya, J. A. Carucci, R. Bergman, et al.
Low Expression of the IL-23/Th17 Pathway in Atopic Dermatitis Compared to Psoriasis
J. Immunol., November 15, 2008; 181(10): 7420 - 7427.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Song, L. Luo, Z. Lei, B. Li, Z. Liang, G. Liu, D. Li, G. Zhang, B. Huang, and Z.-H. Feng
IL-17-Producing Alveolar Macrophages Mediate Allergic Lung Inflammation Related to Asthma
J. Immunol., November 1, 2008; 181(9): 6117 - 6124.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. M. Brenchley, M. Paiardini, K. S. Knox, A. I. Asher, B. Cervasi, T. E. Asher, P. Scheinberg, D. A. Price, C. A. Hage, L. M. Kholi, et al.
Differential Th17 CD4 T-cell depletion in pathogenic and nonpathogenic lentiviral infections
Blood, October 1, 2008; 112(7): 2826 - 2835.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-Y. Kao, C. Kim, F. Huang, and R. Wu
Requirements for Two Proximal NF-{kappa}B Binding Sites and I{kappa}B-{zeta} in IL-17A-induced Human {beta}-Defensin 2 Expression by Conducting Airway Epithelium
J. Biol. Chem., May 30, 2008; 283(22): 15309 - 15318.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
I. Godinez, T. Haneda, M. Raffatellu, M. D. George, T. A. Paixao, H. G. Rolan, R. L. Santos, S. Dandekar, R. M. Tsolis, and A. J. Baumler
T Cells Help To Amplify Inflammatory Responses Induced by Salmonella enterica Serotype Typhimurium in the Intestinal Mucosa
Infect. Immun., May 1, 2008; 76(5): 2008 - 2017.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
L. Zhu, J. Pi, S. Wachi, M. E. Andersen, R. Wu, and Y. Chen
Identification of Nrf2-dependent airway epithelial adaptive response to proinflammatory oxidant-hypochlorous acid challenge by transcription profiling
Am J Physiol Lung Cell Mol Physiol, March 1, 2008; 294(3): L469 - L477.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
L. C. Zaba, I. Cardinale, P. Gilleaudeau, M. Sullivan-Whalen, M. Suarez-Farinas, J. Fuentes-Duculan, I. Novitskaya, A. Khatcherian, M. J. Bluth, M. A. Lowes, et al.
Amelioration of epidermal hyperplasia by TNF inhibition is associated with reduced Th17 responses
J. Exp. Med., December 24, 2007; 204(13): 3183 - 3194.
[Abstract] [Full Text] [PDF]


Home page
Innate ImmunityHome page
J. Harder, R. Glaser, and J.-M. Schroder
Review: Human antimicrobial proteins effectors of innate immunity
Innate Immunity, December 1, 2007; 13(6): 317 - 338.
[Abstract] [PDF]


Home page
J. Immunol.Home page
F. Huang, C.-Y. Kao, S. Wachi, P. Thai, J. Ryu, and R. Wu
Requirement for Both JAK-Mediated PI3K Signaling and ACT1/TRAF6/TAK1-Dependent NF-{kappa}B Activation by IL-17A in Enhancing Cytokine Expression in Human Airway Epithelial Cells
J. Immunol., November 15, 2007; 179(10): 6504 - 6513.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. R. Kim, K. S. Lee, S. J. Park, K. H. Min, K. Y. Lee, Y. H. Choe, Y. R. Lee, J. S. Kim, S. J. Hong, and Y. C. Lee
PTEN Down-Regulates IL-17 Expression in a Murine Model of Toluene Diisocyanate-Induced Airway Disease
J. Immunol., November 15, 2007; 179(10): 6820 - 6829.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. Raffatellu, R. L. Santos, D. Chessa, R. P. Wilson, S. E. Winter, C. A. Rossetti, S. D. Lawhon, H. Chu, T. Lau, C. L. Bevins, et al.
The Capsule Encoding the viaB Locus Reduces Interleukin-17 Expression and Mucosal Innate Responses in the Bovine Intestinal Mucosa during Infection with Salmonella enterica Serotype Typhi
Infect. Immun., September 1, 2007; 75(9): 4342 - 4350.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
A. Linden
A Role for the Cytoplasmic Adaptor Protein Act1 in Mediating IL-17 Signaling
Sci. Signal., August 7, 2007; 2007(398): re4 - re4.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Wiehler and D. Proud
Interleukin-17A modulates human airway epithelial responses to human rhinovirus infection
Am J Physiol Lung Cell Mol Physiol, August 1, 2007; 293(2): L505 - L515.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. C. Higgins, A. G. Jarnicki, E. C. Lavelle, and K. H. G. Mills
TLR4 Mediates Vaccine-Induced Protective Cellular Immunity to Bordetella pertussis: Role of IL-17-Producing T Cells
J. Immunol., December 1, 2006; 177(11): 7980 - 7989.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J. R. Chan, W. Blumenschein, E. Murphy, C. Diveu, M. Wiekowski, S. Abbondanzo, L. Lucian, R. Geissler, S. Brodie, A. B. Kimball, et al.
IL-23 stimulates epidermal hyperplasia via TNF and IL-20R2-dependent mechanisms with implications for psoriasis pathogenesis
J. Exp. Med., November 27, 2006; 203(12): 2577 - 2587.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. H. Chang, H. Park, and C. Dong
Act1 Adaptor Protein Is an Immediate and Essential Signaling Component of Interleukin-17 Receptor
J. Biol. Chem., November 24, 2006; 281(47): 35603 - 35607.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Shen, Z. Hu, J. Goswami, and S. L. Gaffen
Identification of Common Transcriptional Regulatory Elements in Interleukin-17 Target Genes
J. Biol. Chem., August 25, 2006; 281(34): 24138 - 24148.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Toy, D. Kugler, M. Wolfson, T. V. Bos, J. Gurgel, J. Derry, J. Tocker, and J. Peschon
Cutting Edge: Interleukin 17 Signals through a Heteromeric Receptor Complex
J. Immunol., July 1, 2006; 177(1): 36 - 39.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
R. Malley, A. Srivastava, M. Lipsitch, C. M. Thompson, C. Watkins, A. Tzianabos, and P. W. Anderson
Antibody-Independent, Interleukin-17A-Mediated, Cross-Serotype Immunity to Pneumococci in Mice Immunized Intranasally with the Cell Wall Polysaccharide
Infect. Immun., April 1, 2006; 74(4): 2187 - 2195.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
Y. Chen, E. Hamati, P.-K. Lee, W.-M. Lee, S. Wachi, D. Schnurr, S. Yagi, G. Dolganov, H. Boushey, P. Avila, et al.
Rhinovirus Induces Airway Epithelial Gene Expression through Double-Stranded RNA and IFN-Dependent Pathways
Am. J. Respir. Cell Mol. Biol., February 1, 2006; 34(2): 192 - 203.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Voss, J. Wehkamp, K. Wehkamp, E. F. Stange, J. M. Schroder, and J. Harder
NOD2/CARD15 Mediates Induction of the Antimicrobial Peptide Human Beta-defensin-2
J. Biol. Chem., January 27, 2006; 281(4): 2005 - 2011.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
X.-M. Chen, S. P. O'Hara, J. B. Nelson, P. L. Splinter, A. J. Small, P. S. Tietz, A. H. Limper, and N. F. LaRusso
Multiple TLRs Are Expressed in Human Cholangiocytes and Mediate Host Epithelial Defense Responses to Cryptosporidium parvum via Activation of NF-{kappa}B
J. Immunol., December 1, 2005; 175(11): 7447 - 7456.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C.-Y. Kao, F. Huang, Y. Chen, P. Thai, S. Wachi, C. Kim, L. Tam, and R. Wu
Up-Regulation of CC Chemokine Ligand 20 Expression in Human Airway Epithelium by IL-17 through a JAK-Independent but MEK/NF-{kappa}B-Dependent Signaling Pathway
J. Immunol., November 15, 2005; 175(10): 6676 - 6685.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
K. I. Happel, P. J. Dubin, M. Zheng, N. Ghilardi, C. Lockhart, L. J. Quinton, A. R. Odden, J. E. Shellito, G. J. Bagby, S. Nelson, et al.
Divergent roles of IL-23 and IL-12 in host defense against Klebsiella pneumoniae
J. Exp. Med., September 19, 2005; 202(6): 761 - 769.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
A. van den Berg, M. Kuiper, M. Snoek, W. Timens, D. S. Postma, H. M. Jansen, and R. Lutter
Interleukin-17 Induces Hyperresponsive Interleukin-8 and Interleukin-6 Production to Tumor Necrosis Factor-{alpha} in Structural Lung Cells
Am. J. Respir. Cell Mol. Biol., July 1, 2005; 33(1): 97 - 104.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kao, C.-Y.
Right arrow Articles by Wu, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kao, C.-Y.
Right arrow Articles by Wu, R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS