|
|
||||||||
-Defensin-2 Expression in Human Airway Epithelium via JAK and NF-
B Signaling Pathways1
Center for Comparative Respiratory Biology and Medicine, University of California, Davis, CA 95616
| Abstract |
|---|
|
|
|---|
-defensin-2 (hBD-2) message in IL-17-treated primary human airway epithelial cells. Further comparison of this stimulation with a panel of cytokines (IL-1
, 1
, 213, and 1518; IFN-
; GM-CSF; and TNF-
) demonstrated that IL-17 was the most potent cytokine to induce hBD-2 message (>75-fold). IL-17-induced stimulation of hBD-2 was time and dose dependent, and this stimulation also occurred at the protein level. Further studies demonstrated that hBD-2 stimulation was attenuated by IL-17R-specific Ab, but not by IL-1R antagonist or the neutralizing anti-IL-6 Ab. This suggests an IL-17R-mediated signaling pathway rather than an IL-17-induced IL-1
and/or IL-6 autocrine/paracrine loop. hBD-2 stimulation was sensitive to the inhibition of the JAK pathway, and to the inhibitors that affect NF-
B translocation and the DNA-binding activity of its p65 NF-
B subunit. Transient transfection of airway epithelial cells with an hBD-2 promoter-luciferase reporter gene expression construct demonstrated that IL-17 stimulated promoter-reporter gene activity, suggesting a transcriptional mechanism for hBD-2 induction. These results support an IL-17R-mediated signaling pathway involving JAK and NF-
B in the transcriptional stimulation of hBD-2 gene expression in airway epithelium. Because IL-17 has been identified in a number of airway diseases, especially diseases related to microbial infection, these findings provide a new insight into how IL-17 may play an important link between innate and adaptive immunity, thereby combating infection locally within the airway epithelium. | Introduction |
|---|
|
|
|---|
- and
-defensin subfamilies (6). The
-defensins are produced by neutrophils and intestinal Paneths cells, while human
-defensins (hBDs)3 are mostly produced by epithelial cells of the skin and the tracheobronchial tree (7).
All of the known hBDs are cationic peptides. They share a conserved motif, which is composed of six spaced cysteines. The hBD coding sequence is organized into two exons. The N terminus of the translation product is led by a signal peptide, which is eventually cut off to form a propeptide and then a mature peptide. Currently, expression of five hBDs has been identified in airway cells (8). hBD-1 was isolated from human plasma and is expressed in most epithelial cells (9, 10). hBD-2 was originally isolated from human skin and is highly expressed after proinflammatory induction in the lung (11). hBD-3 was found recently through the use of several different approaches, which included a genomics-based PCR search and a traditional peptide purification. hBD-3 could be detected in lung tissue following induction with IL-1 (12, 13, 14). hBD-4, which is also reported to be expressed by lung epithelial cells, was discovered through a direct BLAST search of genome sequences on chromosome 8 (15). Using an ORFeome-based Hidden Markov Model search, we recently identified a novel
-defensin, hBD-6, verified its expression, and confirmed the bactericidal activity of the peptide in human airways (8). hBD-6 was found recently to also be expressed in the epididymis (16). All the
-defensins have a broad spectrum of antimicrobial activity at micromolar concentrations.
hBD-2 represents the first human defensin that is produced by epithelial cells following contact with bacteria, viruses, or cytokines, such as IL-1 and TNF-
(2, 17, 18, 19, 20, 21, 22). Although the nature of the regulation is not completely characterized, both the MAPK signal transduction pathway and the NF-
B transcription factor have been suggested to be involved (23, 24). Using a panel of cytokines that included IL-1
, 1
, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, and 18; IFN-
; GM-CSF; and TNF-
, we report that IL-17 is the most potent cytokine to stimulate hBD-2 expression in well-differentiated primary human tracheobronchial epithelial (TBE) cells. hBD-2 stimulation increased 75-fold after IL-17 treatment as compared with only 5- to 10-fold with IL-1 and TNF-
treatments. This stimulation also occurred at the protein level.
IL-17 is a proinflammatory cytokine originally identified as CTLA-8 (25). It displays 58% homology to the T-lymphotropic Herpesvirus Saimiri gene 13 product (26, 27). Subsequent studies of human IL-17 (hIL-17 or IL-17A) demonstrated exclusive expression of this cytokine by activated T cells, predominantly of the prototypic CD45+RO+CD4+ subtype (28). The other potential source of IL-17 was suggested from a recent mouse lung study that demonstrated the potential role of TLR-4 and IL-23 in mediating the stimulation of IL-17 production by CD4+ and CD8+ T cells (29). It was reported that IL-17 could regulate pulmonary neutrophil emigration in the context of local bacterial infections (30, 31). Recent studies have led to the discovery of several other IL-17 gene family members, IL-17B, C, D, E, and F, which are thought to have overlapping physiological functions with hIL-17/IL-17A (32, 33). However, the physiological functions of these new IL-17 gene family members are still unknown.
IL-17 has been found to be elevated in a variety of inflammatory conditions such as with asthma and Gram-negative bacterial pneumonia (33). IL-17 stimulates NF-
B activation and also the expression of IL-6, IL-8, ICAM, MIP-2, Gro, and GM-CSF in rodent and human cells (34). In human macrophages, IL-17 stimulated the production of proinflammatory cytokines, such as IL-1
and TNF-
(35). We have recently demonstrated that IL-17 stimulates MUC gene expression partly through a JAK-2-dependent and IL-6 autocrine/paracrine loop in primary human TBE cells (36).
In the present study, initially through microarray gene expression profile analysis, we identify a selective activation of hBD-2 expression by IL-17. Further studies with a panel of cytokines demonstrate that IL-17 is the most potent cytokine that stimulates hBD-2 expression. This stimulation appears to occur at the transcriptional level through JAK/NF-
B-dependent, and IL-1- and IL-6-independent mechanisms.
| Materials and Methods |
|---|
|
|
|---|
Recombinant human IL-1
, 1
, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, and 18; TNF-
; IFN-
; GM-CSF; IL-1R antagonist; and IL-17R Ab were purchased from R&D Systems (Minneapolis, MN). Mammalian cells secreting recombinant IL-17A, B, C, D, and E in conditioned medium were obtained from ProteinBank (San Diego, CA). Helenalin, sulfasalazine, AG490, and JAK inhibitor I were purchased from Calbiochem-Novabiochem (San Diego, CA).
Cell culture from human and mouse airway tissues
Human tracheobronchial tissues were obtained from the University of California Medical Center (Sacramento, CA) with patient consent, and also from National Disease Research Interchange (Philadelphia, PA). The University Human Subjects Review Committee approved all procedures involved in tissue procurement. Tissues were collected only from patients without known respiratory tract diseases. Primary cultures derived from these airway tissues have been established before (37, 38). Protease-dissociated TBE cells were plated on a collagen gel substratum-coated Transwell (Corning Costar, Corning, NY) chamber (25 mm) at 12 x 104 cells/cm2, in a Hams F12/DMEM (1:1) supplemented with insulin (5 µg/ml), transferrin (5 µg/ml), epidermal growth factor (10 ng/ml), dexamethasone (0.1 µM), cholera toxin (10 ng/ml), bovine hypothalamus extract (15 µg/ml), BSA (0.5 mg/ml), and all-trans-retinoic acid (30 nM). After 1 wk in an immersed culture condition, these primary TBE cultures were transferred to an air-liquid interface (biphasic) culture condition. HBE1 cell line is an immortalized line of normal human airway epithelial cells (39). HBE1 cells were cultured under four different conditions: 1) plastic tissue culture surface (TC), 2) Transwell chamber with air-liquid interface condition (BI), 3) collagen gel-coated surface (CG), and 4) collagen gel-coated Transwell chamber with an air-liquid interface condition (BI-CG).
Cytokine, antagonist, and inhibitor treatment
Recombinant human cytokines were dissolved in PBS with 1% BSA and added directly to both the apical and basal sides of medium of the primary TBE cultures (0100 ng/ml). The control treatments had the same amount of PBS-1% BSA added. In the receptor antagonist studies, the antagonists (40, 200, and 1000 ng/ml) were added to the cultures 30 min before IL-17 treatment. Helenalin, sulfasalazine, AG490, and JAK inhibitor I were dissolved in DMSO, and they were also added to the culture 30 min before IL-17 treatment. The optimal dose for each of the selected inhibitors was determined based on the current literature and by following the manufacturers recommendations. A dye exclusion assay with trypan blue was used to test the cell viability of cultured cells treated with each chemical. No obvious cytotoxicity (<0.5%) was found in cultures treated with these chemicals at the doses used.
RNA isolation and Affymetrix GeneChip array analysis
RNA was extracted from cultures using RNA TRIzol reagent (Invitrogen, Carlsbad, CA), according to the manufacturers protocol. Affymetrix GeneChip HuGene-U133A oligonucleotide microarrays (Santa Clara, CA) were used to profile gene expression patterns of TBE cells after IL-6 and IL-17 treatments. An initial 30 µg of RNA of each sample was sent to the University of California, Davis Microarray Core Facility (Sacramento, CA). Image data were further analyzed by statistical analysis tools written in R through the Bioconductor project (http://www.bioconductor.org).
Real-time RT-PCR expression analysis
Five micrograms of total RNA was reverse transcribed with Moloney murine leukemia virus-reverse transcriptase (Promega, Madison, WI) by oligo(dT) primers for 90 min at 42°C in 20 µl and then further diluted to 100 µl with water for the following procedures. A total of 2 µl of diluted cDNA was analyzed using 2x SYBR green PCR master mix (Applied Biosystems, Foster City, CA) by an ABI 5700 or ABI PRISM 7900HT Sequence Detection System (Applied Biosystems), following the manufacturers protocol. Gene-specific primers were designed according to the sequences to cover the conserved peptide sequence regions. PCR primers used were: hBD-1, forward, CAGTCGCCATGAGAACTTCCT, and reverse, CTGCTGACGCAATTGTAATGA; hBD-2, forward, GCCTCTTCCAGGTGTTTTTG, and reverse, GAGACCACAGGTGCCAATTT; hBD-3, forward, GGTGAAGCCTAGCAGCTATGAG, and reverse, CGCCTCTGACTCTGCAATAAT; mouse
-defensin-3 (mBD-3), forward, GTCTCCACCTGCAGCTTTTAG, and reverse, ACTGCCAATCTGACGAGTGTT;
-actin, forward, AGAAAATCTGGCACCACACC, and reverse, GGGGTGTTGAAGGTCTCAAA; and GAPDH, forward, CAATGACCCCTTCATTGACC, and reverse, GACAAGCTTCCCGTTCTCAG. The PCR was conducted in 96-well optical reaction plates, and each well contained a 50 µl reaction mixture that contained 25 µl of the SYBR green PCR master mix, 1 µl of each forward and reverse primer, 21 µl of water, and 2 µl of cDNA samples. The SYBR green dye was measured at 530 nm during the extension phase. The threshold cycle (Ct) value reflects the cycle number at which the fluorescence generated within a reaction crosses a given threshold. The Ct value assigned to each well thus reflects the point during the reaction at which a sufficient number of amplicons have been accumulated. The relative mRNA amount in each sample was calculated based on its Ct in comparison with the Ct of housekeeping genes, such as
-actin and GAPDH. The results were presented as 2 (Ct of housekeeping gene Ct of hBD-2), an arbitrary unit. The purity of amplified product was determined as a single peak of the dissociation curve. Real-time PCR was conducted in duplicate for each sample, and the mean value was calculated. This procedure was performed in two or three independent experiments.
Quantification of hBD-2 by a competitive ELISA method
Goat polyclonal Ab to hBD-2 was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Synthetic mature hBD-2 (GIG DPV TCL KSG AIC HPV FCP RRY KQI GTC GLP GTK CCK KP) and DEFB-106 (FFD EKC NKL KGT CKN NCG KNE ELI ALC QKF LKC CRT IQP CGS IID) (8) peptides (Alpha Diagnostic International, San Antonio, TX) were dissolved in 0.01% acetic acid with 0.2% BSA (Sigma-Aldrich, St. Louis, MO). A single Western blot band was detected with the synthetic mature hBD-2 peptide, but not the DEFB-106 peptide, by the commercial anti-hBD-2 polyclonal Ab (data not shown). For a competitive ELISA, hBD-2 was coated in immunoassay microplates (Immulon 2 HB; Fisher Scientific, Pittsburgh, PA) at 200 ng/well in coating buffer (0.1 M sodium bicarbonate/carbonate and 0.02% sodium azide, pH 9.6) overnight at 4°C. Plates were washed once with the washing solution, PBS/Tween 20 (0.05%) buffer (pH 7.4), and nonspecific binding sites were blocked by incubation with PBS/Tween 20/3% BSA buffer for 30 min at room temperature. Plates were further washed twice with the PBS-Tween washing solution (200 µl/well). A standard 1/1000 dilution of primary goat anti-hBD-2 Ab competition mixture containing different amounts of referenced hBD-2 peptide (050 ng/mixture) and samples of culture medium prepared from these airway cell cultures was added to each well (200 µl/well), and incubated at 37°C for 2 h. After four more washings, 200 µl/well of 1/1000 dilution of alkaline phosphatase-conjugated anti-goat IgG secondary Ab (Vector Laboratories, Burlingame, CA) was added to each well, and the incubation was continued at 37°C for 1 h. Wells were washed five times, and 200 µl/well of a 1 mg/ml solution of p-nitrophenyl phosphate (Sigma-Aldrich) in substrate buffer (10% diethanolanine and 0.02% sodium azide, pH 9.8) was added for color development (2040 min at room temperature). The plate was read at 405 nm for the absorbance. Unknown samples were preassayed at three different dilutions to assure that the data were within the linear range of the competition by referenced hBD-2. The results indicated a sensitivity of the competitive ELISA for referenced hBD-2 at 10 ng/well. The results were averaged from triplicate wells of one representative experiment from three independent assays. There was no detectable cross-reaction with the DEFB-106 peptide with this anti-hBD-2 Ab (data not shown).
Cloning of the hBD-2 promoter-luciferase reporter plasmid
A DNA fragment containing the proximal 2.2 kb of the hBD-2 promoter region (2210 to +24) was amplified from PstI-digested genomic DNA by PCR with the following primers: GTTGCTAGCCTTTGGGACTTCCCCAGCTATG (forward primer with NheI tail) and TTTAAGCTTTGGCTGATGGCTGGGAGCTT (reverse primer with HindIII tail). The amplified product was subcloned into a pGL-3 vector (Promega) with firefly luciferase reporter gene to generate hBD2-2210/Luc plasmid. The authenticity of the clone was confirmed and reconfirmed by DNA sequencing.
Transient transfection and luciferase assay
HBE1 cells were seeded into 24-well plates at a density of 5 x 104 cells/well. One day after plating, cells were transfected with 0.3 µg of hBD2-2210/Luc plasmid DNA and 50 ng of Renilla luciferase expression vector pRL-TK (Promega) using FuGENE 6-based gene transfer protocol (Roche Diagnostic Systems, Indianapolis, IN), according to the manufacturers instruction. Eighteen hours after the transfection, cells were treated with various concentrations of IL-17, and cell extracts were prepared for reporter gene assays 24 h after the cytokine treatment. The reporter gene assays were conducted with the Dual-Glo Luciferase Assay System (Promega), according to the manufacturers protocol. The relative hBD-2 promoter activities were expressed as relative light units after normalization to the control, Renilla luciferase activity. The results were averaged from triplicate wells of three separate experiments.
Statistical analysis
Data are expressed as mean ± SE. The number of repeats for each experiment is described under Results and also in the figure legends. Group differences were calculated by ANOVA, and p values <0.05 were considered significant.
| Results |
|---|
|
|
|---|
Our recent work has demonstrated that, among a panel of cytokines, both IL-6 and IL-17 are the most potent mediators to stimulate mucin gene expression in primary human TBE cells (36). As an extension of this work, Affymetrix microarray analysis was conducted to profile the gene expression patterns in cells treated with these cytokines. As shown in Fig. 1, the three-dimensional scatter plot of the array data showed that IL-17 pronouncedly stimulated both hBD-2 and MIP-3
, but not other antimicrobial genes, hBD-1 and various
-defensins by IL-17, whereas IL-6 had little influence on these genes. MIP-3
was recently shown to have antimicrobial activity (40). According to these data, the magnitude of the induction for both hBD-2 and MIP-3
is similar, although the basal level of hBD-2 is 7-fold higher than MIP-3
. Because of this analysis, this study focused on hBD-2 expression. In the microarray data set, we also observed that IL-17 induced the elevation of IL-8 and G-CSF expression. There was a >2-fold induction of IL-8 and a >3-fold induction of G-CSF, although these induction levels were small compared with the >8-fold induction of hBD-2 and MIP-3
(data not shown). Our data confirm the induction of IL-8 and G-CSF by IL-17 (34).
|
, 1
, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, and 18; IFN-
; GM-CSF; and TNF-
. Real-time RT-PCR analysis was conducted for hBD-2 expression in these cytokine-treated samples. As shown in Fig. 2, hBD-2 message was elevated in TBE cells by IL-1
, IL-1
, IL-6, IL-17, and TNF-
, whereas other cytokines had little influence. Inductions of hBD-2 by IL-1
, IL-1
, and TNF-
treatment are consistent with previous reports (17, 18, 41). The observed moderate induction by IL-6 has not been reported before. Overnight (16-h) treatment of airway epithelial cells with IL-17 consistently resulted in a >70-fold induction of hBD-2 message. Treatments of airway cells with IL-2, 3, 4, 8, 9, 10, 11, 12, and 13, even at higher doses (50 ng/ml), did not result in increased hBD-2 message (data not shown). We did not observe any cytokine-induced cytotoxicity. Cell viability, assessed by the trypan blue exclusion method, routinely was greater than 95%.
|
The stimulation of hBD-2 expression was further tested with different IL-17 variants. Mammalian cell-secreted recombinant IL-17A, B, C, D, and E conditioned medium was obtained from a commercial source, and the effects of these secretory products on hBD-2 expression were examined. For comparison, rhIL-17, used in the experiments described above, was included in this study. As shown in Fig. 3, only rhIL-17 and IL-17A conditioned medium was able to stimulate hBD-2 expression after both 24- and 72-h incubation, whereas other IL-17 variants had no effect. These results confirm the specificity of the IL-17A variant in the induction of hBD-2 expression.
|
-defensin gene, mBD-3To test the evolutionary conservation of IL-17-induced hBD-2 expression, the expressions of mouse homologues, mBD-3 and mBD-4, by mouse primary tracheal epithelial cells were analyzed by real-time RT-PCR. C57BL/6 mouse tracheal epithelial cells were isolated and cultured under an air-liquid interface condition, similar to that of human primary TBE cells, for 2 wk. IL-17 at 10 ng/ml was added to these cultures, and RNA was harvested 24 h later for real-time RT-PCR quantification, as described in Materials and Methods. Baseline mBD-4 expression was very low, and there was no IL-17 stimulation (data not included). However, IL-17 was able to significantly stimulate mBD-3 message in primary mouse tracheal epithelial cells (Fig. 4). This result is consistent with a recent report demonstrating increased mBD-3 expression, but not mBD-4 expression in mouse cells after bacterial challenge (42, 43). This result provides further support that IL-17 has a significant effect on hBD-2/mBD-3 expression.
|
The effects of IL-17 on hBD-2 gene expression were dose dependent (Fig. 5). IL-17 concentrations as low as 1 ng/ml elicited significant stimulation of hBD-2 gene expression in primary TBE cells after 48 h of treatment. Peak stimulation occurred at 50 ng/ml dose, with no further increase at 100 ng/ml level. Importantly, IL-17 had no effects on hBD-1 and hBD-3 expressions at all the concentrations tested (1100 ng/ml).
|
|
|
To further determine whether the observed effect of IL-17 on hBD-2 expression was due to a transcriptional activation, study of the effect of IL-17 on hBD-2 promoter activity was conducted in HBE1 cells using a transient transfection approach with hBD2-2210/Luc chimeric construct DNA. The HBE1 cell line was used simply because it is difficult to carry out gene transfer on primary TBE cells. We also grew HBE1 cells under four different culture conditions: 1) TC, 2) CG, 3) BI, or 4) BI-CG. As shown in Fig. 8, HBE1 cells grown under various culture conditions all responded to IL-17 (10 ng/ml) for elevated hBD-2 expression. These results support the notion that we can study hBD-2 gene expression on this cell line under various culture conditions, including the less differentiated TC condition.
|
|
B activation in the regulation of hBD-2 expressionTo elucidate whether this stimulation goes through the IL-17R A, the neutralizing anti-IL-17R A-specific Ab was used. Various amounts of anti-IL-17R A-specific Ab were applied to primary TBE cells with or without IL-17. Fig. 10 shows a dose-dependent inhibition of IL-17-mediated hBD-2 expression by anti-IL-17R A Ab. At 1 µg/ml level, the inhibition of the IL-17 stimulation was 50%, while the inhibition reached 65% when the Ab was used at 5 µg/ml level. This result suggests the stimulation of hBD-2 expression by IL-17 is via the IL-17R A.
|
, 1
, 6, and 8, in a number of cell types, including the human TBE cells (44, 45, 46, 47), some of these secretions may serve as an autocrine/paracrine function, as the IL-6 did for IL-17-mediated mucin gene expression, as shown in our recent publication (36). To rule out this possibility, various neutralizing Abs were used. For IL-8, there was no stimulation of hBD-2 expression by this cytokine, which rules out the possible IL-8 autocrine/paracrine loop in IL-17-mediated stimulation. For IL-1
and IL-1
, IL-1R antagonist at various doses was unable to down-regulate IL-17 stimulation (Fig. 10). A similar negative result was obtained with anti-IL-6-neutralizing Ab (data not shown). These results support the notion that there was no autocrine/paracrine loop mechanism involved in IL-17-mediated hBD-2 expression.
Inhibition of IL-17-dependent hBD-2 expression by JAK and NF-
B inhibitors
To gain an insight into the possible IL-17-mediated signaling on the regulation of hBD-2 expression, various signaling pathway inhibitors were used. Among these inhibitors, we found JAK inhibitor I and several NF-
B-related inhibitors were the most potent ones to reverse the enhancement. As shown in Fig. 11A, the reversal of IL-17-mediated hBD-2 expression by JAK inhibitor I was dose dependent. However, the JAK-2-specific inhibitor, AG490, did not diminish IL-17-induced hBD-2 expression (Fig. 11A). On the contrary, there was a superinduction effect for AG490 at the dose normally reported to be sufficient for the inhibition of JAK-2 until a much higher pharmacological dose was used. Fig. 11B shows that both helenalin, an inhibitor for the DNA-binding activity of NF-
B p65 subunit, and sulfasalazine, an inhibitor to block nuclear translocation of NF-
B, were very effective in abrogating IL-17-mediated hBD-2 expression. Fig. 11C, in a preliminary fashion, shows no synergistic effect for the combined treatment of JAK inhibitor I with helenalin or sulfasalazine. These results support the notion that both JAK signaling and the activation of NF-
B are involved in IL-17-mediated hBD-2 expression.
|
| Discussion |
|---|
|
|
|---|
, 1
, 6, and TNF-
, also have stimulatory effects, but to a much lesser extent (5- to 20-fold). Inductions of hBD-2 by IL-1
, IL-1
, and TNF-
treatment are consistent with previous reports (17, 18, 41). hBD-2 is expressed in epithelia of many organs, including the airways of the lungs, where the message is found in both surface epithelia and the serous cells of the submucosal glands (17). The known function of hBD-2 in innate immunity is believed to be related to its antimicrobial activity and to its chemotactic effects on immature dendritic cells and memory T cells (48). IL-17, mainly secreted by activated T cells (26, 27), is prominently elevated in the airway lumen after microbial infections (47, 49) and has a proinflammatory role in mediating neutrophil migration (50) and the production of IL-6 and IL-8 (51, 52). IL-17R knockout mice have impaired clearance of microbial infections (49). Thus, the stimulatory effects of IL-17 on hBD-2 expression suggest an important role of IL-17 for either directing or amplifying the airway inflammatory response from innate response processes to adaptive response mechanisms (Fig. 12).
|
expression based on microarray analysis (Fig. 1). IL-17s stimulation of hBD-2 is quite selective because other hBDs do not seem affected by IL-17. Like hBD-2, MIP-3
has recently been shown to have potent antimicrobial activity (40) and the chemoattract activity for both dendritic and T cells through their CCR6 receptors (53). Although these two peptides have no sequence homology and they belong to two different gene families, they share many similarities in the properties of antimicrobial activities, chemotactic activities, binding to the CCR6 receptor, and now, regulation by IL-17. Although the significance of this finding remains unclarified, the similarities and the redundant activity of hBD-2 and MIP-3
suggest an important role for these molecules in airway innate immunity. The present studies demonstrate the specificity of IL-17s effects on hBD-2 and on the mouse homologue, mBD-3. Our data show an IL-17 time- and dose-dependent stimulation of hBD-2 expression in airway epithelial cells. A concentration of IL-17 as low as 1 ng/ml was able to significantly stimulate hBD-2 expression. Other variants of the IL-17 superfamily IL-17 B, C, D, E, and F (32, 33) failed to exhibit any stimulation of hBD-2. This finding was further buttressed by the fact that anti-IL-17R A-neutralizing Ab inhibited the stimulation.
IL-17 has been reported to induce the production of proinflammatory cytokines (47). For example, IL-17 up-regulated IL-1
expression and synthesis in a dose- and time-dependent fashion in human macrophages (35). IL-1
has also been reported to be a major activator of hBD-2 expression in A549 cells cultured with mononuclear phagocytes (24). Furthermore, IL-1
and IL-1
have both been reported to stimulate the expression of hBD-2 in various tissues (19, 54, 55). It is thus reasonable to hypothesize that the IL-17 effect on hBD-2 gene expression be mediated in an autocrine/paracrine manner via locally secreted IL-1. However, because the IL-1R antagonist did not block IL-17 stimulation of hBD-2 expression, it is unlikely that IL-1 could be involved in IL-17-stimulated hBD-2 expression in human airway epithelial cells. Although the present studies show that IL-6 can mildly induce hBD-2 and IL-17 can induce the release of IL-6, treatment of IL-17-treated cells with an anti-IL-6 Ab did not block hBD-2 gene expression. This suggests that the IL-17 effect was not mediated through IL-6. Taken together, hBD-2 gene expression appears to be modulated by IL-17 via a unique pathway that is independent of an IL-1 or IL-6 autocrine/paracrine loop. This IL-17-dependent mechanism could serve to amplify an acquired immune response against a pathogen by directing innate immune mechanisms (such as antimicrobial peptide or chemoattraction of inflammatory cells) toward sites of T lymphocyte activation.
We have earlier shown that IL-17 induced up-regulation of mucin gene MUC5B expression through an IL-6 autocrine/paracrine loop, and the JAK/STAT pathway (36). However, different JAK isotypes appear to be involved in their regulation of MUC5B and hBD-2. In the case of MUC5B, the stimulation by IL-17 was blocked by the JAK2 inhibitor, AG490. However, hBD-2 was not inhibited by this inhibitor, and its induction by IL-17 was actually accentuated by the AG490 treatment. How this induction is augmented by a JAK2 inhibitor is not entirely clear at this point. Although IL-17A has a low affinity with its receptor, various JAK isotypes, such as JAK-1, -2, -3, and Tyk-2, have been demonstrated to interact with IL-17R A on binding to its ligand in human U937 monocytic leukemia cells (56). Our previous and present results, showing the sensitivity of IL-17s induction of MUC5B and hBD-2 to JAK inhibitors, support the notion that the IL-17R A in airway epithelial cells may interact with various JAK isotypes upon the ligand binding. The sensitivity of hBD-2 expression to a JAK inhibitor I, which is considered to be not a very specific JAK inhibitor, suggests the likely involvement of JAK-1, -2, -3, and/or Tyk-2 in the receptor-mediated signaling regulation (57).
Further promoter-reporter gene transfection studies in the immortalized normal human bronchial epithelial cell line HBE1 (39) were conducted to further elucidate the molecular nature of this regulation. This cell line behaves similarly to primary TBE cells in its response to IL-17 for inducing hBD-2 expression. We observed an IL-17-induced stimulation of the hBD-2 promoter activity in these transfected cells. This result supports an increased transcriptional activity as a mechanism for hBD-2 induction. We further demonstrated that inhibitors of NF-
B attenuate IL-17-induced hBD-2 expression. Because IL-17 has been shown to activate NF-
B in other cell types (58, 59, 60), these findings suggest this also occurs in airway epithelial cells and that hBD-2 is activated downstream to NF-
B activation. These results are consistent with other studies showing the importance of NF-
B in the regulation of hBD-2 expression by LPS and by other cytokines (24). Interestingly, in mouse airway epithelial cultures, we observed IL-17-stimulated mBD-3 expression, but not mBD-4. Both mBD-3 and mBD-4 are mouse homologues of hBD-2. However, the sequence analysis reveals the presence of a putative cis-binding site for NF-
B transcriptional factor in the mBD-3 gene, whereas no such putative site can be found in the 5'-flanking region of the mBD-4 gene. This result further strengthens the participation of NF-
B-mediated transcriptional mechanisms in IL-17-enhanced hBD-2 expression.
Taking these data together, we propose an IL-17R A-dependent JAK and NF-
B signaling pathway for the transcriptional induction of hBD-2 gene by IL-17 in airway epithelial cells. Because IL-17 is the most potent cytokine in the stimulation of hBD-2, and because IL-17 elevation has been associated with microbial infections of the airways (34), we propose that such a signaling mechanism may play a role in regulating the adaptive and innate immune responses in the airways (Fig. 12). We hypothesize that during the early stages of an airway bacterial infection, microbial products, such as LPS, bind to nonspecific receptors such as the TLR-4 on epithelial cells to stimulate a low level induction of hBD-2. This innate type of response gives limited protection from bacterial invasion through the antimicrobial and chemotactic activities of hBD-2 (61). Recently, Happel et al. (29) have demonstrated that the IL-17 production by CD4+ and CD8+ T cells in bacteria-infected mouse lung could be boosted by IL-23 through a TLR-4-dependent pathway. Regardless of the source of IL-17, it can be expected that when these acquired immune responses have had more time to develop, activated T cells arrive to the site of infection and locally release IL-17. A preliminary study has shown the presence of IL-17R A at the basal side of the polarized airway epithelia (data not shown). The locally secreted IL-17 can presumably augment the local airway antibacterial defense via its binding to the IL-17R via a JAK/NF-
B signaling pathway, thus further activating the induction of hBD-2 and/or other chemokines such as MIP-3
in neighboring epithelial cells.
To our knowledge, no studies have previously shown that IL-17 can induce hBD-2 gene expression in airway epithelial cells. Our results add to the growing body of evidence of the important role that cytokines play in regulating hBD-2 gene expression. We believe that the ability of IL-17 to induce hBD-2 gene expression could play an important role in the airway host defense against bacterial pathogens. Because IL-17 is notable for its ability to stimulate IL-6/IL-8 secretion and to regulate neutrophil migration, it would be intriguing to speculate whether it may play a role in inflammatory airway diseases characterized by neutrophil infiltration such as chronic obstructive pulmonary disease and cystic fibrosis (34).
In conclusion, the results from the present study indicate a novel role for IL-17 in directly stimulating hBD-2 gene expression in primary airway epithelial cells. We further demonstrated that IL-17 mediates its effect on hBD-2 mostly through JAK and NF-
B signaling events. Further investigations should address whether the involvement of other pathways, such as MAPK pathways, are also involved in IL-17-mediated hBD-2 gene expression. The present results widen the spectrum of known cytokines that can regulate defensin expression and offer preliminary evidence for a novel IL-17-related mechanism coordinating select innate and adaptive immune responses.
| Acknowledgments |
|---|
| Footnotes |
|---|
1 This work was supported by National Institutes of Health Grants HL35635, ES09701, ES00628, and AI 50496, and California Tobacco-Related Disease Research Program Grant 10RT-0262. Y.C. was aided by a grant from American Lung Association of California Research Program. P.T. was supported by National Institutes of Health Training Grant HL007013. R.W.H. was supported by National Institutes of Health KO8 Grant HL04404. ![]()
2 Address correspondence and reprint requests to Dr. Reen Wu, Center for Comparative Respiratory Biology and Medicine, Surge 1 Annex, Room 1121, University of California, One Shields Avenue, Davis, CA 95616. E-mail address: rwu{at}ucdavis.edu ![]()
3 Abbreviations used in this paper: hBD, human
-defensin; BI, Transwell chamber with air-liquid interface condition; CG, collagen gel-coated surface; Ct, threshold cycle; hIL, human IL; mBD, mouse
-defensin; TBE, tracheobronchial epithelial; TC, plastic tissue culture surface. ![]()
Received for publication December 29, 2003. Accepted for publication June 24, 2004.
| References |
|---|
|
|
|---|
-defensin-2 expression in human tracheobronchial epithelium. J. Biol. Chem. 275:29731.
-Defensins in lung host defense. Annu. Rev. Physiol. 64:709.[Medline]
-defensin genes. Am. J. Respir. Cell Mol. Biol. 29:71.
-defensin from human plasma. FEBS Lett. 368:331.[Medline]
-defensin hBD-1 in human secretory glands and epithelial cells. FEBS Lett. 396:319.[Medline]
-defensin (human
-defensin 3) with specific antimicrobial activity: its interaction with plasma membranes of Xenopus oocytes and the induction of macrophage chemoattraction. Cell Tissue Res. 306:257.[Medline]
-defensin-3, a novel human inducible peptide antibiotic. J. Biol. Chem. 276:5707.
-defensins using a genomics-based approach. Gene 263:211.[Medline]
-defensin 4: a novel inducible peptide with a specific salt-sensitive spectrum of antimicrobial activity. FASEB J. 15:1819.
-defensin isoforms in humans and mice. J. Immunol. 169:2516.
-defensins by human airway epithelia. Proc. Natl. Acad. Sci. USA 95:14961.
, and IL-1
, but not IL-6, induce human
-defensin-2 in respiratory epithelia. Am. J. Respir. Cell Mol. Biol. 22:714.
-defensin-2 production in keratinocytes is regulated by interleukin-1, bacteria, and the state of differentiation. J. Invest. Dermatol. 118:275.[Medline]
-defensin-2 and -3 mRNA expression in cultured bronchial epithelial cells. FEMS Immunol. Med. Microbiol. 38:59.[Medline]
-defensin-2 induction in Helicobacter pylori-infected gastric mucosal tissues: antimicrobial effect of overexpression. J. Med. Microbiol. 52:41.
-defensin-2 in gingival epithelial cells: the involvement of mitogen-activated protein kinase pathways, but not the NF-
B transcription factor family. J. Immunol. 168:316.
-defensin-2 transcription in pulmonary epithelial cells by lipopolysaccharide-stimulated mononuclear phagocytes via proinflammatory cytokine production. J. Immunol. 170:4226.
and TNF-
, by human macrophages. J. Immunol. 160:3513.
display antimicrobial activity. J. Leukocyte Biol. 74:448.
-defensins hBD-1 and hBD-2 in intestinal epithelium. J. Immunol. 163:6718.
-defensin 3 is an inducible antimicrobial peptide expressed in the epithelia of multiple organs. Infect. Immun. 67:3542.
-defensin expressed in tongue, esophagus, and trachea. J. Biol. Chem. 275:33314.
, and granulocyte-colony-stimulating factor by human airway epithelial cells. Am. J. Respir. Cell Mol. Biol. 26:748.
-induced up-regulation of
-defensin 2 in human middle ear epithelial cells. Biochim. Biophys. Acta 1590:41.[Medline]
stimulation of hBD-2 expression by human corneal epithelial cells. Invest. Ophthalmol. Visual Sci. 44:1859.
B. J. Biol. Chem. 273:27467.
B-inducing kinase is a common mediator of IL-17-, TNF-
-, and IL-1
-induced chemokine promoter activation in intestinal epithelial cells. J. Immunol. 162:5337.
B and MAP kinase pathways in human colonic myofibroblasts. Am. J. Physiol. 282:G1035.
-Defensins: linking innate and adaptive immunity through dendritic and T cell CCR6. Science 286:525.This article has been cited by other articles:
![]() |
A. Freitas, J. C. Alves-Filho, T. Victoni, T. Secher, H. P. Lemos, F. Sonego, F. Q. Cunha, and B. Ryffel IL-17 Receptor Signaling Is Required to Control Polymicrobial Sepsis J. Immunol., June 15, 2009; 182(12): 7846 - 7854. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhu, P.-k. Lee, W.-m. Lee, Y. Zhao, D. Yu, and Y. Chen Rhinovirus-Induced Major Airway Mucin Production Involves a Novel TLR3-EGFR-Dependent Pathway Am. J. Respir. Cell Mol. Biol., May 1, 2009; 40(5): 610 - 619. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. R. Chan, J. S. Liu, D. A. Pociask, M. Zheng, T. A. Mietzner, T. Berger, T. W. Mak, M. C. Clifton, R. K. Strong, P. Ray, et al. Lipocalin 2 Is Required for Pulmonary Host Defense against Klebsiella Infection J. Immunol., April 15, 2009; 182(8): 4947 - 4956. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hamada, M. d. l. L. Garcia-Hernandez, J. B. Reome, S. K. Misra, T. M. Strutt, K. K. McKinstry, A. M. Cooper, S. L. Swain, and R. W. Dutton Tc17, a Unique Subset of CD8 T Cells That Can Protect against Lethal Influenza Challenge J. Immunol., March 15, 2009; 182(6): 3469 - 3481. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. R. Conti, F. Shen, N. Nayyar, E. Stocum, J. N. Sun, M. J. Lindemann, A. W. Ho, J. H. Hai, J. J. Yu, J. W. Jung, et al. Th17 cells and IL-17 receptor signaling are essential for mucosal host defense against oral candidiasis J. Exp. Med., February 16, 2009; 206(2): 299 - 311. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Kreindler, C. A. Bertrand, R. J. Lee, T. Karasic, S. Aujla, J. M. Pilewski, R. A. Frizzell, and J. K. Kolls Interleukin-17A induces bicarbonate secretion in normal human bronchial epithelial cells Am J Physiol Lung Cell Mol Physiol, February 1, 2009; 296(2): L257 - L266. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Guttman-Yassky, M. A. Lowes, J. Fuentes-Duculan, L. C. Zaba, I. Cardinale, K. E. Nograles, A. Khatcherian, I. Novitskaya, J. A. Carucci, R. Bergman, et al. Low Expression of the IL-23/Th17 Pathway in Atopic Dermatitis Compared to Psoriasis J. Immunol., November 15, 2008; 181(10): 7420 - 7427. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Song, L. Luo, Z. Lei, B. Li, Z. Liang, G. Liu, D. Li, G. Zhang, B. Huang, and Z.-H. Feng IL-17-Producing Alveolar Macrophages Mediate Allergic Lung Inflammation Related to Asthma J. Immunol., November 1, 2008; 181(9): 6117 - 6124. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Brenchley, M. Paiardini, K. S. Knox, A. I. Asher, B. Cervasi, T. E. Asher, P. Scheinberg, D. A. Price, C. A. Hage, L. M. Kholi, et al. Differential Th17 CD4 T-cell depletion in pathogenic and nonpathogenic lentiviral infections Blood, October 1, 2008; 112(7): 2826 - 2835. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-Y. Kao, C. Kim, F. Huang, and R. Wu Requirements for Two Proximal NF-{kappa}B Binding Sites and I{kappa}B-{zeta} in IL-17A-induced Human {beta}-Defensin 2 Expression by Conducting Airway Epithelium J. Biol. Chem., May 30, 2008; 283(22): 15309 - 15318. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Godinez, T. Haneda, M. Raffatellu, M. D. George, T. A. Paixao, H. G. Rolan, R. L. Santos, S. Dandekar, R. M. Tsolis, and A. J. Baumler T Cells Help To Amplify Inflammatory Responses Induced by Salmonella enterica Serotype Typhimurium in the Intestinal Mucosa Infect. Immun., May 1, 2008; 76(5): 2008 - 2017. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zhu, J. Pi, S. Wachi, M. E. Andersen, R. Wu, and Y. Chen Identification of Nrf2-dependent airway epithelial adaptive response to proinflammatory oxidant-hypochlorous acid challenge by transcription profiling Am J Physiol Lung Cell Mol Physiol, March 1, 2008; 294(3): L469 - L477. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C. Zaba, I. Cardinale, P. Gilleaudeau, M. Sullivan-Whalen, M. Suarez-Farinas, J. Fuentes-Duculan, I. Novitskaya, A. Khatcherian, M. J. Bluth, M. A. Lowes, et al. Amelioration of epidermal hyperplasia by TNF inhibition is associated with reduced Th17 responses J. Exp. Med., December 24, 2007; 204(13): 3183 - 3194. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Harder, R. Glaser, and J.-M. Schroder Review: Human antimicrobial proteins effectors of innate immunity Innate Immunity, December 1, 2007; 13(6): 317 - 338. [Abstract] [PDF] |
||||
![]() |
F. Huang, C.-Y. Kao, S. Wachi, P. Thai, J. Ryu, and R. Wu Requirement for Both JAK-Mediated PI3K Signaling and ACT1/TRAF6/TAK1-Dependent NF-{kappa}B Activation by IL-17A in Enhancing Cytokine Expression in Human Airway Epithelial Cells J. Immunol., November 15, 2007; 179(10): 6504 - 6513. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Kim, K. S. Lee, S. J. Park, K. H. Min, K. Y. Lee, Y. H. Choe, Y. R. Lee, J. S. Kim, S. J. Hong, and Y. C. Lee PTEN Down-Regulates IL-17 Expression in a Murine Model of Toluene Diisocyanate-Induced Airway Disease J. Immunol., November 15, 2007; 179(10): 6820 - 6829. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Raffatellu, R. L. Santos, D. Chessa, R. P. Wilson, S. E. Winter, C. A. Rossetti, S. D. Lawhon, H. Chu, T. Lau, C. L. Bevins, et al. The Capsule Encoding the viaB Locus Reduces Interleukin-17 Expression and Mucosal Innate Responses in the Bovine Intestinal Mucosa during Infection with Salmonella enterica Serotype Typhi Infect. Immun., September 1, 2007; 75(9): 4342 - 4350. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Linden A Role for the Cytoplasmic Adaptor Protein Act1 in Mediating IL-17 Signaling Sci. Signal., August 7, 2007; 2007(398): re4 - re4. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wiehler and D. Proud Interleukin-17A modulates human airway epithelial responses to human rhinovirus infection Am J Physiol Lung Cell Mol Physiol, August 1, 2007; 293(2): L505 - L515. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Higgins, A. G. Jarnicki, E. C. Lavelle, and K. H. G. Mills TLR4 Mediates Vaccine-Induced Protective Cellular Immunity to Bordetella pertussis: Role of IL-17-Producing T Cells J. Immunol., December 1, 2006; 177(11): 7980 - 7989. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Chan, W. Blumenschein, E. Murphy, C. Diveu, M. Wiekowski, S. Abbondanzo, L. Lucian, R. Geissler, S. Brodie, A. B. Kimball, et al. IL-23 stimulates epidermal hyperplasia via TNF and IL-20R2-dependent mechanisms with implications for psoriasis pathogenesis J. Exp. Med., November 27, 2006; 203(12): 2577 - 2587. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. Chang, H. Park, and C. Dong Act1 Adaptor Protein Is an Immediate and Essential Signaling Component of Interleukin-17 Receptor J. Biol. Chem., November 24, 2006; 281(47): 35603 - 35607. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Shen, Z. Hu, J. Goswami, and S. L. Gaffen Identification of Common Transcriptional Regulatory Elements in Interleukin-17 Target Genes J. Biol. Chem., August 25, 2006; 281(34): 24138 - 24148. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Toy, D. Kugler, M. Wolfson, T. V. Bos, J. Gurgel, J. Derry, J. Tocker, and J. Peschon Cutting Edge: Interleukin 17 Signals through a Heteromeric Receptor Complex J. Immunol., July 1, 2006; 177(1): 36 - 39. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Malley, A. Srivastava, M. Lipsitch, C. M. Thompson, C. Watkins, A. Tzianabos, and P. W. Anderson Antibody-Independent, Interleukin-17A-Mediated, Cross-Serotype Immunity to Pneumococci in Mice Immunized Intranasally with the Cell Wall Polysaccharide Infect. Immun., April 1, 2006; 74(4): 2187 - 2195. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Chen, E. Hamati, P.-K. Lee, W.-M. Lee, S. Wachi, D. Schnurr, S. Yagi, G. Dolganov, H. Boushey, P. Avila, et al. Rhinovirus Induces Airway Epithelial Gene Expression through Double-Stranded RNA and IFN-Dependent Pathways Am. J. Respir. Cell Mol. Biol., February 1, 2006; 34(2): 192 - 203. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Voss, J. Wehkamp, K. Wehkamp, E. F. Stange, J. M. Schroder, and J. Harder NOD2/CARD15 Mediates Induction of the Antimicrobial Peptide Human Beta-defensin-2 J. Biol. Chem., January 27, 2006; 281(4): 2005 - 2011. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-M. Chen, S. P. O'Hara, J. B. Nelson, P. L. Splinter, A. J. Small, P. S. Tietz, A. H. Limper, and N. F. LaRusso Multiple TLRs Are Expressed in Human Cholangiocytes and Mediate Host Epithelial Defense Responses to Cryptosporidium parvum via Activation of NF-{kappa}B J. Immunol., December 1, 2005; 175(11): 7447 - 7456. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-Y. Kao, F. Huang, Y. Chen, P. Thai, S. Wachi, C. Kim, L. Tam, and R. Wu Up-Regulation of CC Chemokine Ligand 20 Expression in Human Airway Epithelium by IL-17 through a JAK-Independent but MEK/NF-{kappa}B-Dependent Signaling Pathway J. Immunol., November 15, 2005; 175(10): 6676 - 6685. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. I. Happel, P. J. Dubin, M. Zheng, N. Ghilardi, C. Lockhart, L. J. Quinton, A. R. Odden, J. E. Shellito, G. J. Bagby, S. Nelson, et al. Divergent roles of IL-23 and IL-12 in host defense against Klebsiella pneumoniae J. Exp. Med., September 19, 2005; 202(6): 761 - 769. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. van den Berg, M. Kuiper, M. Snoek, W. Timens, D. S. Postma, H. M. Jansen, and R. Lutter Interleukin-17 Induces Hyperresponsive Interleukin-8 and Interleukin-6 Production to Tumor Necrosis Factor-{alpha} in Structural Lung Cells Am. J. Respir. Cell Mol. Biol., July 1, 2005; 33(1): 97 - 104. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |