The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, T.
Right arrow Articles by Phan, S. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, T.
Right arrow Articles by Phan, S. H.
The Journal of Immunology, 2004, 173: 3425-3431.
Copyright © 2004 by The American Association of Immunologists

Regulation of Found in Inflammatory Zone 1 Expression in Bleomycin-Induced Lung Fibrosis: Role of IL-4/IL-13 and Mediation via STAT-61

Tianju Liu*, Hong Jin*, Matthew Ullenbruch*, Biao Hu*, Naozumi Hashimoto*, Bethany Moore{dagger}, Andrew McKenzie{ddagger}, Nicholas W. Lukacs* and Sem H. Phan2,*

Departments of * Pathology and {dagger} Internal Medicine, University of Michigan Medical School, Ann Arbor, MI 48109; and {ddagger} Medical Research Council Laboratory of Molecular Biology, Cambridge, United Kingdom


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Found in inflammatory zone (FIZZ)1, also known as resistin-like molecule {alpha}, belongs to a novel class of cysteine-rich secreted protein family, named FIZZ/resistin-like molecule, with unique tissue expression patterns. FIZZ1 is induced in alveolar type II epithelial cells (AECs) in bleomycin (BLM)-induced lung fibrosis, and found to induce myofibroblast differentiation in vitro. The objective of this study was to elucidate the regulation of AEC FIZZ1 expression in pulmonary fibrosis. AECs were isolated from rat lungs and the effects of a number of cytokines on FIZZ1 expression were evaluated by RT-PCR. Of all cytokines examined, only IL-4 and IL-13 were effective in stimulating FIZZ1 expression in AECs. Stimulation by IL-4/IL-13 was accompanied by increases in phosphorylated STAT6 and JAK1. FIZZ1 expression was also stimulated by transfection with a STAT6 expression plasmid, but was inhibited by antisense oligonucleotides directed against STAT6. In vivo studies showed that compared with wild-type controls, both IL-4- and IL-13-deficient mice showed reduced BLM-induced lung FIZZ1 expression and fibrosis, which were essentially abolished in IL-4 and IL-13 doubly deficient mice. Furthermore, STAT6-deficient mice showed marked reduction in BLM-induced lung FIZZ1 expression. Thus, IL-4 and IL-13 are potent inducers of AEC FIZZ1 expression via STAT6 and play key roles in BLM-induced lung FIZZ1 expression and fibrosis. This represents a potential mechanism by which IL-4/IL-13 could play a role in the pathogenesis of lung fibrosis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The protein, found in inflammatory zone (FIZZ)1,3 initially found in lung allergic inflammation, belongs to a novel class of cysteine-rich secreted proteins, also known as resistin-like molecules (RELMs) (1, 2, 3). The FIZZ/RELM family consists of three known members, FIZZ1/RELM-{alpha}, FIZZ2/RELM-{beta}, and FIZZ3/resistin. These three members have unique tissue specific distribution. Thus, FIZZ1 is expressed in lung, white adipose tissue, mammary, tongue, and heart (1), and is found lately to be a key marker, along with Ym-1, of alternatively activated macrophages (4, 5). FIZZ2 is detected exclusively in the colon and small bowel (2), whereas FIZZ3 is found in white adipose tissue and circulating mononuclear cells (1, 6). More recently, there is evidence of an additional member of this family of proteins, referred to as RELM-{gamma} (7). This newest member exhibits 69.4 and 72.1% homology with RELM-{alpha}/FIZZ1 in the rat and mouse, respectively. This high degree of homology is thought to have made it difficult to distinguish expression of RELM-{alpha}/FIZZ1 from RELM-{gamma} expression in white adipose tissue in the previous study (7). The FIZZ/RELM family is characterized by a signature carboxyl terminus sequence containing 10 completely conserved cysteine residues, in which the spacing between cysteines is invariant (1, 2). FIZZ1 lacks one cysteine residue in the amino terminus that is present in both FIZZ2 and FIZZ3 in multiple species. This difference may be responsible for the inability of FIZZ1 to form disulfide-linked homodimers, while both FIZZ2 and FIZZ3 have been found as homodimers (8). However, FIZZ1 has been found to form hetero-oligomers with FIZZ3 but not FIZZ2 (9). These structural signatures of conserved spacing between cysteine residues and small size (between 8 and 12 kDa) indicate that FIZZ1 is likely to be a secreted protein with potential as a signaling molecule. This possibility is supported by a study showing that FIZZ1 is secreted into the culture supernatant of FIZZ1-transfected 293T cells (2).

There is only limited information about the precise biological function or activity of this family of molecules. FIZZ1 is first reported to inhibit the nerve growth factor-mediated gene expression of dorsal root ganglion neurons (1). It has an inhibitory effect on 3T3-L1 preadipocyte differentiation into adipocytes, which is not accompanied by an increase in cell proliferation (9). Recently, a study in a mouse chronic hypoxia model of pulmonary hypertension revealed that FIZZ1 is able to stimulate the proliferation of pulmonary vascular smooth muscle cells, and thus, is referred to also as a hypoxia-induced mitogenic factor (10). FIZZ1 is also highly induced in bleomycin (BLM)-induced lung fibrosis as assessed by cDNA microarray analysis, and found to localize primarily to alveolar epithelial cells by in situ hybridization (11, 12). Furthermore, FIZZ1 can induce myofibroblast differentiation in lung fibroblast cultures, as manifested by increased expression of {alpha}-smooth muscle actin ({alpha}-SMA) and type I collagen (11). This suggests the potential involvement of FIZZ1 in the fibrotic response in BLM-induced lung injury model. However, the mechanism of induction and regulation of FIZZ1 expression in alveolar epithelial cells in the context of lung injury and fibrosis is undetermined.

However, there is evidence from studies with alternatively activated macrophages that suggest induction of FIZZ1 expression may be under the influence of type 2 cytokines (4, 5). Moreover, there is ample evidence to suggest the involvement of the type 2 cytokines, IL-4 and IL-13, in fibrotic diseases (13, 14, 15, 16). For instance, IL-4 gene expression is significantly increased in a murine model of lung injury induced by BLM with primary expression by macrophages and T lymphocytes (14). Moreover, IL-4 and IL-13 are capable of stimulating fibroblast proliferation, as well as {alpha}-SMA and collagen expression, thus triggering myofibroblast differentiation (17). A recent study suggests that IL-13 could mediate its fibrogenic effects in the lung and other organs by inducing and activating TGF-{beta}1 (18). Like TGF-{beta}1, IL-4 and IL-13 have similar effects on myofibroblast differentiation by inducing {alpha}-SMA production in human synovial fibroblasts (19). These data clearly suggest the profibrotic roles of IL-4 and IL-13 in fibrosis by affecting fibroblast activation and myofibroblast differentiation. These findings suggest the possibility that FIZZ1 expression in alveolar epithelial cells may be regulated by cytokines, especially type 2 cytokines.

IL-13 shares 30% homology with IL-4 and appears to have certain overlapping biological activities in Th2 type responses. Both cytokines bind to the IL-4R {alpha}-chain (20). In response to treatment with IL-4 or IL-13, receptor multimerization is accompanied with binding and activation of the downstream signaling molecules, JAKs, resulting in their transphosphorylation, as well as receptor phosphorylation. The phosphorylated receptor creates docking sites for STAT6, which can then be phosphorylated by JAKs, leading to STAT6 dissociation from the receptor, homodimerization and translocation to the nucleus. These STAT6 homodimers can then interact with specific DNA elements on promoters of IL-4/IL-13 target genes and regulate gene transcription (21, 22, 23). Although this pathway seems to be operational in mononuclear leukocytes, its role in alveolar epithelial cell response to IL-4/IL-13 treatment is unclear, especially with respect to regulation of FIZZ1 gene expression.

Hence, the objective of this study was to investigate the role of the type 2 cytokines, IL-4/IL-13, in regulation of type II alveolar epithelial cell (AEC) FIZZ1 gene expression, and evaluate the participation of the JAK-STAT signal transduction pathway in mediating this regulation. The roles of these molecules in vivo were then confirmed in vivo in the BLM-induced lung injury and fibrosis model.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals and induction of pulmonary fibrosis

Male specific pathogen-free Fisher 344 rats (6~8 wk old) were purchased from Charles River Breeding Laboratories (Wilmington, MA). BALB/c, C57BL/6, and IL-4-deficient (IL-4–/–) mice on a C57BL/6 background (6–8 wk old) were purchased from The Jackson Laboratory (Bar Harbor, ME). IL-13-deficient (IL-13–/–) mice, IL-4 and IL-13 doubly deficient (IL-4/13–/–) mice, and STAT6-deficient mice, all on BALB/c background (7–10 wk old) were produced as previously described (24, 25), and bred at the University of Michigan (Ann Arbor, MI) for these studies. To induce pulmonary fibrosis, BLM (Blenoxane; Mead Johnson, Princeton, NJ) was dissolved in sterile PBS and instilled endotracheally on day 0 as previously described (26). Due to the strain-dependent differences in sensitivity to BLM (27), the doses of BLM were 0.0015 U/g and 0.01 U/g body weight for C57BL/6 and BALB/c mice, respectively. Control groups received the same volume of sterile PBS only. Mice (n = 3–5) were randomly assigned to each of the indicated treatment groups. At indicated time points after BLM treatment, the mice were sacrificed and the lungs were harvested rapidly. Where indicated, the lung tissue samples were immediately placed in TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA) for total RNA isolation, or in lysis buffer (50 mM Tris.Cl, pH 7.5, 1% Nonidet P-40) for Western blotting analysis.

Isolation of rat AECs and treatment with cytokines

AECs were isolated by elastase digestion and IgG panning as previously described (28). Briefly, after multiple whole lung lavages with 1 mM EGTA in balanced salt solution, porcine pancreatic elastase (4.3 U/ml; Worthington Biochemical, Lakewood, NJ) was instilled via the trachea to release type II cells. Contaminating cells bearing FcRs were removed from the cell suspension by panning on plates coated with rat IgG (Sigma-Aldrich, St. Louis, MO). The cells were suspended in DMEM supplemented with 10% newborn calf serum (Sigma-Aldrich), and then plated onto 6-well tissue culture dishes precoated with fibronectin (R&D Systems, Minneapolis, MN). Isolated cells were evaluated by immunofluorescence after staining with anti-cytokeratin 5/8 Abs (BD Biosciences, San Diego, CA), which recognized the cytokeratins found in AECs, but not present in macrophages, fibroblasts, or endothelial cells (28, 29). After 2 days in culture, the adherent cells were consistently >90% epithelial cells. Primary cultured AECs were used without passaging.

When ready to use, AECs were cultured in DMEM supplemented with 10% FBS. When they reached ~90% confluence, the cells were made quiescent by culturing in DMEM containing 0.5% FBS for 4–6 h. Where indicated, recombinant rat IL-4 and/or recombinant mouse IL-13 (R&D Systems) were then added at the indicated doses, and further incubated for 4, 8, 12, and 24 h before harvesting for total RNA isolation.

RNA analysis by RT-PCR

For quantitative mRNA analysis, total RNA was isolated from lung tissue or AECs. Primer Express 2.0 software (Applied Biosystems, Foster City, CA) was used to design TaqMan primers and MGB probes (6-FAM conjugated) for FIZZ1 and STAT6, which were then purchased from Applied Biosystems. The primer sequences were as follows: rat FIZZ1 forward primer, 5'-CAACAGGATGAAGACTGCAACCT-3'; reverse primer, 5'-GGGACCATCAGCTAAAGAAG-3'; probe, 5'-6FAM-CCCTTCTCATCTGCGTCT-3'; and murine FIZZ1 forward primer, 5'-TCCAGCTAACTATCCCTCCACTGT-3'; reverse primer, 5'-GGCCCATCTGTTCATAGTCTTGA-3'; probe, 5'-6FAM-CGAAGACTCTCTCTTGC-3'; and murine STAT6 forward primer, 5'-CCTCAACGAGCCAGATGGAA3'; reverse primer, 5'TGATGCCCCCAATCTCAGA-3'; probe, 5'6FAMTTCCTCCTCCGCTTTA-3'.

Primers and probe for GAPDH were purchased from Applied Biosystems. For each assay, 100 ng of total RNA was used as template. GAPDH mRNA was used as internal control to normalize the amount of input RNA. One-step real time RT-PCR (48°C 30 min, 95°C 10 s, followed by 45 cycles of 95°C 10 s, 60°C 1 min) was undertaken with TaqMan One Step RT-PCR Master Mix (Applied Biosystems) using a GeneAmp 5700 Sequence Detection System (Applied Biosystems). Results were expressed as 2{Delta}{Delta}CT as previously described (30).

Western blotting analysis for STAT6 and JAK1

Western blotting to detect STAT6 or JAK1 protein expression was performed as previously described (11). Briefly, 20 µg of cell extract protein was loaded and separated by SDS-PAGE (10%). Mouse anti-STAT6, rabbit anti-phospho-STAT6, and rabbit anti-JAK1 Abs (Santa Cruz Biotechnology, Santa Cruz, CA) were used as primary Abs, and immunostained bands were visualized with HRP-labeled anti-mouse or anti-rabbit IgG (Amersham Biosciences, Buckinghamshire, U.K.) as appropriate, followed by exposure to ECL Hyperfilm (Amersham Biosciences). The film was then scanned and quantitated using 1D Image Analysis software (Kodak, Rochester, NY).

Transfection of STAT6 and antisense oligonucleotides

Prokaryotic expression plasmid mouse pBSK-STAT6 was a kind gift of Dr. J. N. Ihle (St. Jude Children’s Research Hospital, Memphis, TN). STAT6 cDNA was digested with EcoRI and NotI from pBSK-STAT6, and then subcloned into pEGFP-C1 (BD Clontech, Palo Alto, CA) using T4 DNA ligase (Promega, Madison, WI) in accordance with the manufacturer’s instructions to form mammalian expression plasmid pEGFP-STAT6. The identity of the construct was confirmed by sequencing.

Where indicated, AECs were transiently transfected with pEGFP-STAT6 using the transfection reagent Fugene 6 (Roche Molecular Biochemicals, Indianapolis, IN) at a ratio of 2:3 (microgram:microliter). At 20 h after transfection, 10 ng/ml IL-4 or IL-13 were added and incubation was continued for an additional 4 h before harvesting for RNA purification. Empty plasmid pEGFP-C1 was also transfected under identical conditions and used as negative control. Where indicated, transfected cells were also transfected with antisense STAT6 phosphorothioate-derivatized oligonucleotides (5'CCCCACAGAGACATGATCTG3') at a final concentration of 500 nM to study the effects of specific inhibition of induced FIZZ1 expression. The corresponding sense oligonucleotide was used as control.

Hydroxyproline assay

Lung collagen deposition was estimated by measuring the hydroxyproline content of whole lung homogenates as previously described (17). Briefly, the lungs were excised, homogenized in 0.5 M acetic acid, and hydrolyzed in 6 N HCl overnight at 110°C. Hydroxyproline was assessed by colorimetric assay and the results were expressed as micrograms of hydroxyproline per lung.

Statistic analysis

All data were expressed as mean ± SE unless otherwise indicated. Differences between means of various treatment and control groups were assessed for statistical significance by ANOVA followed by post hoc analysis using Scheffé’s test for comparison between any two groups. A p value < 0.05 was considered to indicate statistical significance.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Effects of IL-4 and IL-13 on FIZZ1 expression in AECs

BLM-induced lung injury in rats is known to induce FIZZ1 gene expression, which is localized to airway epithelial cells and AECs, but not to fibroblasts (11, 12). To seek out a possible mechanism for the regulation of FIZZ1 gene expression, a number of cytokines were investigated for their ability to regulate FIZZ1 gene expression in isolated AECs using RT-PCR. Initial screening showed that FIZZ1 expression was not significantly affected by treatment with a number of cytokines, including IL-1, TNF-{alpha}, IFN-{gamma}, and IL-12 (data not shown). However, FIZZ1 gene expression was significantly up-regulated in a dose-dependent manner by the Th2 cytokines, IL-4 and IL-13 (Fig. 1A). Stimulation was not significantly enhanced beyond 10 ng/ml for either cytokine at the 4-h time point (Fig. 1A). Stimulation by IL-4 was rapid with detectable increase as early as 2 h and peak increase at 4 h after addition of cytokine (Fig. 1B). Significantly stimulated levels were sustained up to as long as 20 h of treatment. Similar kinetics was noted with IL-13 treatment (data not shown). These results clearly indicated the ability of both IL-4 and IL-13 to significantly stimulate FIZZ1 gene expression by AECs in a dose- and time-dependent manner.



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 1. Effects of IL-4 or IL-13 on FIZZ1 expression in AECs. AECs were treated with the indicated concentrations of IL-4 or IL-13, and then harvested for total cell RNA to analyze for FIZZ1 mRNA by RT-PCR analysis. The amount of FIZZ1 mRNA was normalized to GAPDH signals and expressed as 2{Delta}{Delta}CT, using the untreated control sample as reference. Mean ± SE of triplicate samples are shown. A dose-response curve is shown in A, which revealed significant increases (p < 0.01) in FIZZ1 mRNA levels in cells treated with 10 and 20 ng/ml either cytokine. B, The kinetics of IL-4 stimulation of FIZZ1 expression is shown. Stimulation by IL-4 was statistically significant (p < 0.001) at 4, 8, and 20 h after treatment. The same dose of IL-13 showed similar kinetics of stimulation (data not shown).

 
Effects of IL-4 and/or IL-13 deficiency on lung FIZZ1 gene expression and fibrosis

To confirm the in vivo significance of the in vitro observation using isolated AECs, the effects of IL-4 and/or IL-13 deficiency on lung FIZZ1 gene expression and fibrosis were examined using the BLM model. For these studies, the responses of IL-4–/–, IL-13–/–, and IL-4 and IL-13 doubly deficient (IL-4/13–/–) mice to BLM-induced lung injury were compared with those in their respective wild-type controls. In the wild-type strain, lung FIZZ1 mRNA was significantly increased over 6-fold that in saline-treated control lungs at the day-14 (after BLM administration) time point (Fig. 2A). This increase was significantly reduced to <3-fold in IL-4–/– mice. Thus, IL-4 deficiency resulted in a >50% decrease in BLM-induced stimulation of lung FIZZ1 mRNA levels. A slight decrease in lung FIZZ1 mRNA was also observed in saline-injected IL-4–/– mice in comparison with IL-4+/+ saline controls. Similar reductions in BLM-induced stimulation of lung FIZZ1 mRNA levels were noted in IL-13–/– mice when compared with their respective wild-type controls (Fig. 2B). Remarkably, this BLM-induced increase in lung FIZZ1 mRNA levels was completely abolished in the doubly deficient IL-4/13–/– mice. Thus, the BLM-induced stimulation of lung FIZZ1 expression appeared to be dependent entirely on IL-4 and IL-13, which would confirm the in vivo significance of the in vitro data obtained above using isolated AECs in tissue culture. It appears that in the absence of one of these Th2 cytokines, stimulation of FIZZ1 expression could be maintained partially by the unaffected cytokine.



View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 2. Effects of IL-4 and/or IL-13 deficiency on lung FIZZ1 expression. Lung total RNA were isolated from either BLM- or saline-injected wild-type, IL-4–/–, IL-13 –/– or IL-4/13–/– mice at day 14 after BLM administration. Lung FIZZ1 mRNA levels were measured and the results expressed as described in Fig. 1. The FIZZ1 mRNA levels in saline-treated wild-type animals were used as reference. A, Lung FIZZ1 mRNA levels were compared between wild-type (wt) and IL-4–/– mice. In both wild-type and knockout mice, BLM caused a significant increase in lung FIZZ1 mRNA levels, but the increase was significantly less (p < 0.001) in the IL-4-deficient mice. Mean ± SE of five IL-4–/– mice or three wild-type mice are shown. B, Lung FIZZ1 mRNA levels were compared between wild-type and IL-13–/– or IL-4/13–/– mice. Relative to the wild-type strain, the reduction in BLM-induced increase in FIZZ1 expression in both IL-13–/– and IL-4/13–/– mice was significant (p < 0.001). Mean ± SE of five knockout mice or three wild-type mice are shown.

 
Previously, IL-4 deficiency was shown to cause reduced BLM-induced lung fibrosis at a dose of BLM used in this study (17). Thus, reduced lung FIZZ1 expression in IL-4–/– mice appears to correlate with reduced lung fibrosis. To examine whether such a link also existed between lung FIZZ1 expression and BLM-induced lung fibrosis in IL-13-deficient mice or IL-4/IL-13 doubly deficient mice, the amplitude of lung fibrosis was compared in IL-13–/– and IL-4/13–/– mice to their respective wild-type control mice. Analysis of lung hydroxyproline at day 21 after BLM administration showed significant reduction in both IL-13–/– and IL-4/13–/– mice, relative to that in wild-type controls (Fig. 3). Thus, similar to that in IL-4 deficiency, decreased levels of BLM-induced increase in lung FIZZ1 expression in IL-13-deficient or IL-4/IL-13 doubly deficient mice were associated with significant reduction in pulmonary fibrosis.



View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 3. Effects of IL-13 or IL-4 plus IL-13 deficiency on pulmonary fibrosis. The whole lung homogenates were prepared from BLM- or saline-treated mice at day 21 after treatment. They were then analyzed for hydroxyproline content and the results expressed as micrograms per lung. Relative to that in wild-type (wt) mice, the BLM-induced increase in lung hydroxyproline content was significantly reduced (p < 0.05) in both IL-13-deficient (IL-13 ko) and IL-4/IL-13 doubly deficient (IL-4/IL-13 ko) mice. The levels of lung hydroxyproline in both BLM-treated knockout murine strains were not significantly different from their respective saline-treated controls. For each murine strain, mean ± SE of five animals per treatment group are shown.

 
Effects of IL-4 and IL-13 on STAT-6 and JAK-1 expression in AECs

To find out whether STAT-6 and JAK-1 were involved in the IL-4- and IL-13-induced signal transduction cascade leading to the regulation of FIZZ1 gene expression, STAT-6 and JAK-1 expression in AECs were evaluated by Western blotting. AECs were treated for 24 or 48 h with IL-4 or IL-13, and the total cellular proteins were then analyzed for levels of phosphorylated STAT6, total STAT6, and JAK-1 protein levels by Western blotting using the appropriately specific Abs. The results showed that at both 24 and 48 h of treatment, the levels of phosphorylated STAT6 were markedly induced in cells treated with either cytokine, while the levels of total STAT6 protein were not significantly altered (Fig. 4). JAK-1 protein levels showed stimulation by both cytokines at both time points examined, but appear to decline at the 48-h time point. The increase in JAK-1 at the 24-h time point was 173.5% ± 3.34 and 128.6% ± 5.8 above the control level as a result of IL-4 and IL-13 stimulation, respectively. These results suggested that the activation of STAT-6 and JAK-1 were likely involved in IL-4- and IL-13-induced increase in AEC FIZZ1 expression.



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 4. Effects of IL-4 or IL-13 on STAT6 and JAK1 expression. AECs were treated with buffer only (None) or 10 ng/ml IL-4 or IL-13, respectively. Cell extracts were harvested at the indicated time points for analysis of the indicated proteins by Western blotting. Equal amounts (20 µg) of protein were loaded for analysis. Both IL-4 and IL-13 caused phosphorylation of STAT6 at both time points examined. Total STAT6 levels were not affected by these cytokine treatments, while JAK-1 levels were increased by both cytokines. A representative blot from three independent experiments is shown.

 
Effects of transduced STAT-6 overexpression on FIZZ1 expression in AECs

To confirm the importance of STAT6 in induction of FIZZ1 expression, the effect of transfecting a STAT6 expression plasmid, pEGFP-STAT6, on AEC FIZZ1 expression was examined. Transfection of pEGFP-STAT6 caused a marked (>16-fold over empty vector only) increase in cellular STAT6 mRNA levels by RT-PCR analysis (Fig. 5A). IL-4 treatment caused an increase in STAT6 mRNA levels in control cells treated with the empty vector, but failed to affect the expression in cells transfected with pEGFP-STAT6. Thus, the transduced level of STAT-6 overexpression could not be stimulated further by IL-4 treatment. Examination of FIZZ1 expression by RT-PCR in similarly treated cells revealed significant stimulation of FIZZ1 expression by the STAT6 expression plasmid compared with untreated cells, or cells transfected with the empty vector (Fig. 5B). Furthermore, the increase induced by the STAT6 expression plasmid was abrogated by transfection with an antisense STAT6 oligonucleotide, indicating that the stimulation in FIZZ1 expression was specifically due to an increase in STAT6 expression in the pEGFP-STAT6-transfected cells. These results strongly suggest that IL-4 stimulation of AEC FIZZ1 expression was mediated by STAT6.



View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 5. Effect of forced STAT6 expression on AEC FIZZ1 expression. STAT6 expression plasmid pEGFP-STAT6 (pSTAT6) or empty vector pEGFP-C1 (Vector) was transfected into rat AECs. The cells were then stimulated for 4 h with 10 ng/ml IL-4. Total cell RNA was then harvested and analyzed for FIZZ1 mRNA level by RT-PCR, and the results were expressed as described in Fig. 1. Mean ± SE of triplicate samples are shown. A, STAT6 mRNA levels were examined to confirm successful transfection, which revealed over 16-fold (relative to empty vector) induction in cells transfected with pSTAT6, which was not further stimulated by treatment with IL-4. The untreated vector control was used as a reference. B, FIZZ1 mRNA levels were significantly (p < 0.001) increased in cells transfected with pSTAT6 relative to both untreated and vector-transfected controls. Cotransfection with antisense STAT6 oligonucleotides abolished this increase induced by pSTAT6 transfection (p < 0.05).

 
Role of STAT6 in regulation of FIZZ1 expression in vivo

To explore the potential in vivo relevance of these in vitro effects of STAT6 on FIZZ1 expression, the levels of STAT6 mRNA were determined in the lung tissue of mice treated with BLM. As previously noted, lung FIZZ1 expression was markedly induced in animals treated with BLM (11), and this was associated with significant elevation in lung STAT6 mRNA (Fig. 6A). These results showed correlation between lung FIZZ1 and STAT6 expression, which would be consistent with the in vitro demonstration of the dependence of AEC FIZZ1 expression on STAT6 as shown above. Thus, IL-4- or IL-13-induced FIZZ1 expression in pulmonary fibrosis may depend on signaling via STAT6. To further confirm the importance of STAT6 in induction of FIZZ1 expression in pulmonary fibrosis, the effects of STAT6 deficiency on BLM-induced lung FIZZ1 expression were examined. Because induction of lung FIZZ1 expression is maximal at day 7 after BLM injury (11), this time point was chosen for this experiment. As expected, lung FIZZ1 mRNA was markedly induced in wild-type mice at day 7 after BLM treatment compared with that in saline controls (Fig. 6B). This induction was essentially abolished in STAT6 knockout mice. These findings confirmed the dependence of FIZZ1 induction on STAT6, which are consistent with the in vitro findings showing IL-4 or IL-13 induction of FIZZ1 expression via STAT6.



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 6. STAT6 expression and effect on FIZZ1 expression in BLM-induced lung fibrosis. A, Lung tissue total RNA was isolated from wild-type mice 14 days after intratracheal BLM instillation for STAT6 mRNA analysis by RT-PCR. Similarly, in B, lung RNA was isolated from wild-type (WT) or STAT6 knockout mice (STAT6-KO) 7 days after BLM treatment, but analyzed for FIZZ1 mRNA by RT-PCR. The results were expressed as described in Fig. 1. The differences in STAT6 (A) as well as FIZZ1 (B) expression between BLM- and saline-treated wild-type mice were significant (p < 0.05), but FIZZ1 expression was not significantly increased in BLM-treated STAT6 knockout mice (B). Mean ± SE of five BLM-treated and three saline-treated control animals are shown.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Pulmonary fibrosis is often a progressive disorder that culminates in respiratory failure and a fatal outcome. Its pathogenesis remains incompletely understood, but has been extensively studied using a well-characterized animal model based on a single intratracheal administration of BLM (31, 32). BLM initially induces epithelial injury and alveolar inflammation that is followed by a fibroproliferative process. Idiopathic pulmonary fibrosis has been hypothesized as being due to repeated episodes of epithelial injury and abnormal wound healing, resulting in the formation of so-called fibroblastic foci composed of fibroblast-like cells, including myofibroblasts (33). Formation of these foci is thought to be due to cross-talk between alveolar epithelial cells, a primary source of profibrotic cytokines, and underlying or adjacent proliferating fibroblastic cells. FIZZ1 is recently found to be highly induced in BLM-induced lung fibrosis, and primarily expressed by airway and alveolar epithelial cells (11, 12). This novel peptide mediator is found to stimulate type I collagen and {alpha}-SMA expression in lung fibroblasts, two key parameters of fibroblast activation and myofibroblast differentiation that are known to occur in lung fibrosis (11). These properties indicate that FIZZ1 might play a potent role in mediating the cross-talk between epithelial cells and fibroblastic cells that is postulated as being important in formation of fibroblastic foci (33). Given this potentially important role in the pathogenesis of pulmonary fibrosis, elucidation of the mechanisms responsible for the induction of lung FIZZ1 expression should contribute to further understanding of key processes involved in progressive fibrosis. In this study, we present evidence that IL-4 and IL-13 could induce FIZZ1 gene expression in AECs in vitro and in vivo during BLM-induced lung fibrosis, and that this induction was mediated by STAT6 with the possible involvement of JAK1.

Based on previous data showing that induction of lung FIZZ1 in BLM-induced lung fibrosis was mainly observed in AECs, but not in fibroblasts, a number of candidate cytokines were screened for their ability to regulate FIZZ1 expression in isolated AECs. Of the cytokines tested, only IL-4 and IL-13 had consistent and significant effects on FIZZ1 gene expression. Other cytokines such as IL-1, TNF-{alpha}, and IFN-{gamma}, failed to induce FIZZ1 gene expression. This is consistent with previous reports of the inability of LPS, TNF-{alpha}, or IL-6 to significantly affect FIZZ1/RELM-{alpha} expression (34). The Th2 cytokines, IL-4 and IL-13, are known to be important in BLM-induced lung fibrogenesis (13, 16, 35, 36). IL-4 plays a pivotal role in the extension of pulmonary fibrosis by enabling and/or enhancing fibroblast activation and myofibroblast differentiation (17). IL-13 can activate TGF-{beta}1 in vivo with mediation by a serine protease/plasmin and MMP-9-dependent mechanism (18). Markedly diminished eosinophil recruitment and airway remodeling were observed in IL-4/13–/– mice (37). In our present and previous studies (17), IL-4 and IL-13 were also shown to be important for the development of BLM-induced lung fibrosis by hydroxyproline estimation. In this study, we show that IL-4 and IL-13 were able to up-regulate FIZZ1 expression in vitro in AECs in a dose-dependent manner. This in vitro effect appears to be important in vivo, as well as in the BLM-induced pulmonary fibrosis model. Thus, substantial reduction in lung FIZZ1 expression was noted in BLM-treated IL-4- or IL-13-deficient mice when compared with their respective wild-type controls. Furthermore, there was essentially complete suppression of BLM-induced lung FIZZ1 expression in IL-4/IL-13 doubly deficient mice, indicating that induction of FIZZ1 expression in this animal model was completely dependent on these two Th2 cytokines. This reduced FIZZ1 expression in the deficient mice was accompanied by significant reduction in pulmonary fibrosis as assessed by lung hydroxyproline content. Thus, an additional role for these two cytokines in fibrosis is the ability to up-regulate FIZZ1 expression, which could in turn promote fibroblast activation and myofibroblast differentiation, two key elements in fibroblastic foci formation.

The kinetics of cytokine-induced FIZZ1 expression in AECs indicated a rapid induction of FIZZ1 mRNA, starting at 2 h after addition of cytokine. This is consistent with IL-4 or IL-13 stimulation of FIZZ1 expression in alternatively activated peritoneal macrophages (4) and the BMnot cell line isolated from bone marrow of temperature-sensitive SV40 T-Ag transgenic mice (38). In the latter study, FIZZ1 mRNA is elevated starting as early as 1 h after IL-4 stimulation and increased stably for up to 24 h.

The involvement of JAK1 and STAT6 in IL-4- and IL-13-induced signaling pathways is well elucidated (39, 40). Upon IL-4 or IL-13 stimulation, JAK1 activation is followed by activation of STAT6 by tyrosine phosphorylation, leading to homodimerization and translocation of the protein into the nucleus. There, STAT6 homodimers can interact with promoters of IL-4 or IL-13 responsive genes to regulate gene expression. Indeed, a functional STAT6-binding element has been identified in the murine FIZZ1 promoter in studies using the BMnot cell line (38), which could cooperate with C/EBP, a transcription factor known to bind to the FIZZ3/resistin promoter and found to be sufficient for activation of this promoter (41). Consistent with these findings, our data indicated a similar regulatory role for STAT6 in rat AECs. First there is the evidence showing activation of STAT6 in cells treated with IL-4 or IL-13 that was associated with increased expression of JAK-1. Moreover, transfection of a STAT6 expression plasmid into rat AECs stimulated the expression of FIZZ1, which was inhibited by antisense STAT6 oligonucleotides. These findings confirmed that the observed effect on FIZZ1 was specifically due to mediation by STAT6. Furthermore, our findings revealed that STAT6 gene expression was markedly increased in BLM-induced lung fibrosis in a mouse model and its deficiency abolished lung FIZZ1 induction. One study recently showed that peribronchial inflammation was markedly diminished and fibrosis was also significantly reduced in STAT6-deficient mice in contrast to corresponding wild-type mice in a model of airway disease (42). Given the activity of FIZZ1 on myofibroblast differentiation, the STAT6 mediated up-regulation in FIZZ1 expression would be expected to promote fibrosis. Thus, taken together, these observations strongly suggest that STAT6 may be involved in FIZZ1 induction in lung fibrosis and remodeling.

Finally, the relevance of these findings to human pulmonary fibrosis remains to be elucidated. Establishing such relevance is handicapped by the lack of information concerning a human homologue of rodent FIZZ1 (2). Although the human counterparts for FIZZ2 and FIZZ3 have been reported and analyzed, human FIZZ1 has yet to be identified. Recently, two additional members of this family of molecules have been reported, namely murine RELM-{gamma} (7, 43) and human/murine 10 cysteine protein 1 (44). Although RELM-{gamma} shows extensive homology to FIZZ1, its human counterpart is unknown. As with RELM-{gamma}, the in vivo function of 10 cysteine protein 1 is uncertain, and its potential relationship to a human FIZZ1 remains to be determined. Thus, it is unclear at this time whether a human FIZZ1 homologue exists, and/or whether these additional novel members have similar function as rodent FIZZ1. Elucidation of the in vivo role of FIZZ1 in human disease must await identification of a human FIZZ1 and/or further functional characterization of the various members of this gene family.


    Acknowledgments
 
We are grateful to Dr. James N. Ihle (St. Jude Children’s Research Hospital, Memphis, TN) for the generous gift of the prokaryotic expression plasmid mouse pBSK-STAT6, and Dr. Mark H. Kaplan (Indiana University School of Medicine, Indianapolis, IN) for providing the STAT6 knockout mice.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by research Grants HL28737, HL31963, and HL52285 from the National Institutes of Health. Back

2 Address correspondence and reprint requests to Dr. Sem H. Phan, Department of Pathology, University of Michigan Medical School, 1301 Catherine Street, MS 1 4211, Ann Arbor, MI 48109-0602. E-mail address: shphan{at}umich.edu Back

3 Abbreviations used in this paper: FIZZ, found in inflammatory zone; RELM, resistin-like molecule; BLM, bleomycin; AEC, type II alveolar epithelial cell; SMA, smooth muscle actin. Back

Received for publication March 26, 2004. Accepted for publication June 23, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Holcomb, I. N., R. C. Kabakoff, B. Chan, T. W. Baker, A. Gurney, W. Henzel, C. Nelson, H. B. Lowman, B. D. Wright, N. J. Skelton, et al 2000. FIZZ1 a novel cysteine-rich secreted protein associated with pulmonary inflammation defines a new gene family. EMBO J. 19:4046.[Medline]
  2. Steppan, C. M., E. J. Brown, C. M. Wright, S. Bhat, R. Banerjee, C. Y. Dai, G. H. Enders, D. G. Silberg, X. Wen, G. D. Wu. 2001. A family of tissue-specific resistin-like molecules. Proc. Natl. Acad. Sci. USA 98:502.[Abstract/Free Full Text]
  3. Steppan, C. M., S. T. Bailey, S. Bhat, E. J. Brown, R. R. Banerjee, C. M. Wright, H. R. Patel, R. S. Ahima, M. A. Larzar. 2001. The hormone resistin links obesity to diabetes. Nature 409:307.[Medline]
  4. Raes, G., P. D. Baetselier, W. Noël, A. Beschin, F. Brombacher, G. H. , G. Hassanzadeh. 2002. Differential expression of FIZZ1 and Ym1 in alternatively versus classically activated macrophages. J. Leukocyte Biol. 71:597.[Abstract/Free Full Text]
  5. Nair, M. G., D. M. Cochrane, J. E. Allen. 2003. Macrophages in chronic type 2 inflammation have a novel phenotype characterized by the abundant expression of Ym1 and Fizz1 that can be partly replicated in vitro. Immunol. Lett. 85:173.[Medline]
  6. Savage, D. B., C. P. Sewter, E. S. Klenk, D. G. Segal, A. Vidal-Puig, R.V. Considine, S. O’Rahilly. 2001. Resistin/FIZZ3 expression in relation to obesity and peroxisome proliferator-activated receptor-{gamma} action in humans. Diabetes 50:2199.[Abstract/Free Full Text]
  7. Gerstmayer, B., D. Küsters, S. Gebel, T. Müller, E. Van Miert, K. Hofmann, A. Bosio. 2003. Identification of RELM{gamma}, a novel resistin-like molecular with a distinct expression pattern. Genomics 81:588.[Medline]
  8. Banerjee, R. R., M. A. Lazar. 2001. Dimerization of resistin and resistin-like molecules is determined by a single cysteine. J. Biol. Chem. 276:25970.[Abstract/Free Full Text]
  9. Blagoev, B., I. Kratchmarova, M. M. Nielsen, M. M. Fernandez, J. Voldby, J. S. Andersen, K. Kristiansen, A. Pandey, M. Mann. 2002. Inhibition of adipocyte differentiation by resistin like molecule {alpha} (RELM{alpha}): biochemical characterization of its oligomeric nature. J. Biol. Chem. 277:42011.[Abstract/Free Full Text]
  10. Teng, X., D. Li, C. Champion, R. A. Johns. 2003. FIZZ1/RELM{alpha}, a novel hypoxia-induced mitogenic factor in lung with vasoconstrictive and angiogenic properties. Circ. Res. 92:1.[Free Full Text]
  11. Liu, T., S. M. Dhanasekaran, H. Jin, B. Hu, S. A. Tomlins, A. M. Chinnaiyan, S. H. Phan. 2004. FIZZ1 stimulation of myofibroblasts differentiation. Am. J. Pathol. 164:1315.[Abstract/Free Full Text]
  12. Katsuma, S., K. Nishi, K. Tanigawara, H. Ikawa, S. Shiojima, K. Takagak, Y. Kaminishi, Y. Suzuki, A. Hirasawa, T. Ohgi, et al 2001. Molecular monitoring of bleomycin-induced pulmonary fibrosis by cDNA microarray –based gene expression profiling. Biochem. Biophys. Res. Commun. 288:747.[Medline]
  13. Zhu, Z., R. J. Homer, Z. Wang, Q. Chen, G. P. Geba, J. Wang, Y. Zhang, J. A. Elias. 1999. Pulmonary expression of interleukin-13 causes inflammation, mucus hypersecretion, subepithelial fibrosis, physiologic abnormalities and eotaxin production. J. Clin. Invest. 103:779.[Medline]
  14. Gharaee-Kermani, M., Y. Nozaki, K. Hatano, S. H. Phan. 2001. Lung interleukin 4 gene expression in a murine model of bleomycin-induced pulmonary fibrosis. Cytokine 15:138.[Medline]
  15. Sempowski, G. D., M. P. Beckmann, S. Derdak, R. P. Phipps. 1994. Subsets of murine lung fibroblasts express membrane-bound and soluble IL-4 receptor: role of IL-4 in enhancing fibroblast proliferation and collagen synthesis. J. Immunol. 152:3606.[Abstract]
  16. Doucet, C., D. Brouty Boye, C. Potti Clemenceau, G. W. Canonica, C. Jasmin, B. Azzarone. 1998. Interleukin (IL) 4 and IL-13 act on human lung fibroblasts: implication in asthma. J. Clin. Invest. 101:2129.[Medline]
  17. Huaux, F., T. Liu, B. McGarry, M. Ullenbruch, S. H. Phan. 2003. Dual roles of interleukin-4 (IL-4) in lung injury and fibrosis. J. Immunol. 170:2083.[Abstract/Free Full Text]
  18. Lee, C. G., R. J. Homer, Z. Zhu, S. Lanone, X. Wang, J. V. Koteliansky, M. Shipley, P. Gotwals, P. Nobel, Q. Chen, et al 2001. Interleukin-13 induces tissue fibrosis by selectively stimulating and activating transforming growth factor {beta}1. J. Exp. Med. 194:809.[Abstract/Free Full Text]
  19. Mattey, D. L., P. T. Dawes, N. B. Nixon, H. Slater. 1997. Transforming growth factor {beta}1 and interleukin 4 induced {alpha} smooth muscle actin expression and myofibroblast-like differentiation in human synovial fibroblasts in vitro: modulation by basic fibroblast growth factor. Ann. Rheum. Dis. 56:426.[Abstract/Free Full Text]
  20. Nelms, K., A. D. Keegan, J. Zamorano, J. J. Ryan, W. Paul. 1999. The IL-4 receptor: signaling mechanisms and biologic functions. Annu. Rev. Immunol. 17:701.[Medline]
  21. Kelly-Welch, A. E., E. M. Hanson, M. R. Boothby, A. D. Keegan. 2003. Interleukin-4 and interleukin-13 signaling connections maps. Science 300:1527.[Abstract/Free Full Text]
  22. Hilton, D. J.. 1999. Native regulators of cytokine signal transduction. Cell. Mol. Life Sci. 55:1568.[Medline]
  23. Ihle, J. N.. 1996. STATs: signal transducers and activators of transcription. Cell 84:331.[Medline]
  24. McKenzie, G. J., P. G. Fallon, C. L. Emson, R. K. Grencis, A. N. J. McKenzie. 1999. Simultaneous disruption of interleukin (IL)-4 and IL-13 defines individual roles in T helper cell type 2-mediated responses. J. Exp. Med. 189:1565.[Abstract/Free Full Text]
  25. Kaplan, M. H., U. Schindler, S. T. Smiley, M. J. Grusby. 1996. Stat6 is required for mediating responses to IL-4 and for the development of Th2 cells. Immunity 4:313.[Medline]
  26. Phan, S. H., J. Varani, D. Smith. 1985. Rat lung fibroblast collagen metabolism in bleomycin-induced pulmonary fibrosis. J. Clin. Invest. 76:241.
  27. Schrier, D. J., R. G. Kunkel, S. H. Phan. 1983. The role of strain variation in murine bleomycin-induced pulmonary fibrosis. Am. Rev. Respir. Dis. 127:63.[Medline]
  28. Dobbs, L. G.. 1990. Isolation and culture of alveolar type II cells. Am. J. Physiol. 258:L134.
  29. Christensen, P. J., M. B. Bailie, R. E. Goodman, A. D. O’Brien, G. B. Toews, B. Paine, III. 2000. Role of diminished epithelial GM-CSF in the pathogenesis of BLM-induced pulmonary fibrosis. Am. J. Physiol. 279:L487.
  30. Livak, K. J., T. D. Schmittgen. 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2{Delta}{Delta}CT method. Methods 25:402.[Medline]
  31. Snider, G. L., J. A. Hayes, A. L. Korthy. 1978. Chronic interstitial pulmonary fibrosis produced in hamsters by endotracheal bleomycin: pathology and stereology. Am. Rev. Respir. Dis. 117:1099.[Medline]
  32. Kuhn, C., J. Boldt, E. King, E. Crouch, T. Vartio, J. A. McDonald. 1989. An immunohistochemical study of architectural remodeling and connective tissue synthesis in pulmonary fibrosis. Am. Rev. Respir. Dis. 140:1693.[Medline]
  33. Selman, M., T. King, Jr, A. Pardo. 2001. Idiopathic pulmonary fibrosis: prevailing and evolving hypotheses about its pathogenesis and implications for therapy. Ann. Intern. Med. 134:136.[Abstract/Free Full Text]
  34. Rajala, M. W., Y. Lin, M. Ranalletta, X. M. Yang, H. Qian, R. Gingerich, N. Barzilai, P. E. Schereer. 2002. Cell type-specific expression and co-regulation of murine resistin and resistin-like molecule-{alpha} in adipose tissue. Mol. Endocrinol. 16:1920.[Abstract/Free Full Text]
  35. Luckacs, N. W., C. Hogaboam, S. W. Chensue, K. Blease, S. Kunkel. 2001. Type 1/type 2 cytokine paradigm and the progression of pulmonary fibrosis. Chest 120:(Suppl. 1):5S.
  36. Wenzel, S. E., J. B. Trudeau, S. Barnes, X. X. Zhou, M. Cundall, J. Y. Westcott, K. McCord, H. W. Chu. 2002. TGF-{beta} and IL-13 synergistically increase eotaxin-1 production in human airway fibroblasts. J. Immunol. 169:4613.[Abstract/Free Full Text]
  37. Foster, P. S., D. C. Webb, M. Yang, C. Herbert, R. K. Kumar. 2003. Dissociation of T helper type 2 cytokine-dependent airway lesions from signal transducer and activator of transcription 6 signaling in experimental chronic asthma. Clin. Exp. Allergy 33:688.[Medline]
  38. Stütz, A. M., L. A. Pickart, A. Trifilieff, T. Baumruker, E. Prieschl-Strassmayr, M. Woisetschläger. 2003. The Th 2 cell cytokines IL-4 and IL-13 regulate found in inflammatory zone 1/resistin-like molecule {alpha} gene expression by a STAT 6 and CCAAT/enhancer-binding protein-dependent mechanism. J. Immunol. 170:1789.[Abstract/Free Full Text]
  39. Hou, J., U. Schindler, W. J. Henzel, T. C. Ho, M. Brasseur, S. L. McKinght. 1994. An interleukin-4 induced transcription factor: IL-4 Stat. Science 256:1701.
  40. Hoey, T., U. Schindler. 1998. STAT structure and function in signaling. Curr. Opin. Genet. Dev. 8:582.[Medline]
  41. Hartman, H. B., X. Hu, K. X. Tyler, C. K. Dalal, M. A. Lazar. 2002. Mechanisms regulating adipocyte expression of resistin. J. Biol. Chem. 277:19754.[Abstract/Free Full Text]
  42. Blease, K., J. M. Schuh, C. Jakubzick, N. W. Lukacs, S. L. Kunkel, B. H. Joshi, R. K. Puri, M. H. Kaplan, C. M. Hogaboam. 2002. Stat6-deficient mice develop airway hyperresponsiveness and peribronchial fibrosis during chronic fungal asthma. Am. J. Pathol. 160:481.[Abstract/Free Full Text]
  43. Schinke, T., M. Haberland, A. Jamshidi, P. Nollau, J. M. Rueger, M. Amlig. 2004. Cloning and functional characterization of resistin-like molecule {gamma}. Biochem. Biophys. Res. Commun. 314:356.[Medline]
  44. Chumakov, A. M., T. Kubota, S. Walter, H. P. Koeffler. 2004. Identification of murine and human XCP1 genes as C/EBP-{epsilon}-dependent members of FIZZ/Resistin gene family. Oncogene 23:3414.[Medline]

Related articles in The JI:

IN THIS ISSUE

The JI 2004 173: 2893-2894. [Full Text]  



This article has been cited by other articles:


Home page
J. Immunol.Home page
K. Yamaji-Kegan, Q. Su, D. J. Angelini, and R. A. Johns
IL-4 Is Proangiogenic in the Lung under Hypoxic Conditions
J. Immunol., May 1, 2009; 182(9): 5469 - 5476.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
T. Liu, B. Hu, Y. Y. Choi, M. Chung, M. Ullenbruch, H. Yu, J. B. Lowe, and S. H. Phan
Notch1 Signaling in FIZZ1 Induction of Myofibroblast Differentiation
Am. J. Pathol., May 1, 2009; 174(5): 1745 - 1755.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. G. Nair, Y. Du, J. G. Perrigoue, C. Zaph, J. J. Taylor, M. Goldschmidt, G. P. Swain, G. D. Yancopoulos, D. M. Valenzuela, A. Murphy, et al.
Alternatively activated macrophage-derived RELM-{alpha} is a negative regulator of type 2 inflammation in the lung
J. Exp. Med., April 13, 2009; 206(4): 937 - 952.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
D. J. Angelini, Q. Su, K. Yamaji-Kegan, C. Fan, J. T. Skinner, H. C. Champion, M. T. Crow, and R. A. Johns
Hypoxia-induced mitogenic factor (HIMF/FIZZ1/RELM{alpha}) induces the vascular and hemodynamic changes of pulmonary hypertension
Am J Physiol Lung Cell Mol Physiol, April 1, 2009; 296(4): L582 - L593.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. J. Reece, M. C. Siracusa, T. L. Southard, C. F. Brayton, J. F. Urban Jr., and A. L. Scott
Hookworm-Induced Persistent Changes to the Immunological Environment of the Lung
Infect. Immun., August 1, 2008; 76(8): 3511 - 3524.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
B. Gangadharan, M. A. Hoeve, J. E. Allen, B. Ebrahimi, S. M. Rhind, B. M. Dutia, and A. A. Nash
Murine gammaherpesvirus-induced fibrosis is associated with the development of alternatively activated macrophages
J. Leukoc. Biol., July 1, 2008; 84(1): 50 - 58.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
G. Trujillo, E. C. O'Connor, S. L. Kunkel, and C. M. Hogaboam
A Novel Mechanism for CCR4 in the Regulation of Macrophage Activation in Bleomycin-Induced Pulmonary Fibrosis
Am. J. Pathol., May 1, 2008; 172(5): 1209 - 1221.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
E. Daley, C. Emson, C. Guignabert, R. de Waal Malefyt, J. Louten, V. P. Kurup, C. Hogaboam, L. Taraseviciene-Stewart, N. F. Voelkel, M. Rabinovitch, et al.
Pulmonary arterial remodeling induced by a Th2 immune response
J. Exp. Med., February 18, 2008; 205(2): 361 - 372.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. C. MacKinnon, S. L. Farnworth, P. S. Hodkinson, N. C. Henderson, K. M. Atkinson, H. Leffler, U. J. Nilsson, C. Haslett, S. J. Forbes, and T. Sethi
Regulation of Alternative Macrophage Activation by Galectin-3
J. Immunol., February 15, 2008; 180(4): 2650 - 2658.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
C. J. Scotton and R. C. Chambers
Molecular Targets in Pulmonary Fibrosis: The Myofibroblast in Focus
Chest, October 1, 2007; 132(4): 1311 - 1321.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Loke, I. Gallagher, M. G. Nair, X. Zang, F. Brombacher, M. Mohrs, J. P. Allison, and J. E. Allen
Alternative Activation Is an Innate Response to Injury That Requires CD4+ T Cells to be Sustained during Chronic Infection
J. Immunol., September 15, 2007; 179(6): 3926 - 3936.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. D. Swain, S. Han, A. Harmsen, K. Shampeny, and A. G. Harmsen
Pulmonary Hypertension Can Be a Sequela of Prior Pneumocystis Pneumonia
Am. J. Pathol., September 1, 2007; 171(3): 790 - 799.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
A. Mishra, M. Wang, J. Schlotman, N. M. Nikolaidis, C. W. DeBrosse, M. L. Karow, and M. E. Rothenberg
Resistin-like molecule-beta is an allergen-induced cytokine with inflammatory and remodeling activity in the murine lung
Am J Physiol Lung Cell Mol Physiol, August 1, 2007; 293(2): L305 - L313.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
R. J. Homer
Airway remodeling and RELM-beta
Am J Physiol Lung Cell Mol Physiol, August 1, 2007; 293(2): L303 - L304.
[Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Amatucci, T. Novobrantseva, K. Gilbride, M. Brickelmaier, P. Hochman, and A. Ibraghimov
Recombinant ST2 boosts hepatic Th2 response in vivo
J. Leukoc. Biol., July 1, 2007; 82(1): 124 - 132.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
K. Chen, Y. Wei, G. C. Sharp, and H. Braley-Mullen
Decreasing TNF-{alpha} results in less fibrosis and earlier resolution of granulomatous experimental autoimmune thyroiditis
J. Leukoc. Biol., January 1, 2007; 81(1): 306 - 314.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
P. Misson, F. Brombacher, M. Delos, D. Lison, and F. Huaux
Type 2 immune response associated with silicosis is not instrumental in the development of the disease
Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L107 - L113.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
K. Yamaji-Kegan, Q. Su, D. J. Angelini, H. C. Champion, and R. A. Johns
Hypoxia-induced mitogenic factor has proangiogenic and proinflammatory effects in the lung via VEGF and VEGF receptor-2
Am J Physiol Lung Cell Mol Physiol, December 1, 2006; 291(6): L1159 - L1168.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
Q. Tong, L. Zheng, L. Lin, B. Li, D. Wang, and D. Li
Hypoxia-Induced Mitogenic Factor Promotes Vascular Adhesion Molecule-1 Expression via the PI-3K/Akt-NF-{kappa}B Signaling Pathway
Am. J. Respir. Cell Mol. Biol., October 1, 2006; 35(4): 444 - 456.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. G. Nair, K. J. Guild, and D. Artis
Novel Effector Molecules in Type 2 Inflammation: Lessons Drawn from Helminth Infection and Allergy
J. Immunol., August 1, 2006; 177(3): 1393 - 1399.
[Full Text] [PDF]


Home page
Am. J. Pathol.Home page
J. H. Kim, H. Y. Kim, S. Kim, J.-H. Chung, W. S. Park, and D. H. Chung
Natural Killer T (NKT) Cells Attenuate Bleomycin-Induced Pulmonary Fibrosis by Producing Interferon-{gamma}
Am. J. Pathol., November 1, 2005; 167(5): 1231 - 1241.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, T.
Right arrow Articles by Phan, S. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, T.
Right arrow Articles by Phan, S. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS