|
|
||||||||


Departments of
*
Pathology and
Internal Medicine, University of Michigan Medical School, Ann Arbor, MI 48109; and
Medical Research Council Laboratory of Molecular Biology, Cambridge, United Kingdom
| Abstract |
|---|
|
|
|---|
, belongs to a novel class of cysteine-rich secreted protein family, named FIZZ/resistin-like molecule, with unique tissue expression patterns. FIZZ1 is induced in alveolar type II epithelial cells (AECs) in bleomycin (BLM)-induced lung fibrosis, and found to induce myofibroblast differentiation in vitro. The objective of this study was to elucidate the regulation of AEC FIZZ1 expression in pulmonary fibrosis. AECs were isolated from rat lungs and the effects of a number of cytokines on FIZZ1 expression were evaluated by RT-PCR. Of all cytokines examined, only IL-4 and IL-13 were effective in stimulating FIZZ1 expression in AECs. Stimulation by IL-4/IL-13 was accompanied by increases in phosphorylated STAT6 and JAK1. FIZZ1 expression was also stimulated by transfection with a STAT6 expression plasmid, but was inhibited by antisense oligonucleotides directed against STAT6. In vivo studies showed that compared with wild-type controls, both IL-4- and IL-13-deficient mice showed reduced BLM-induced lung FIZZ1 expression and fibrosis, which were essentially abolished in IL-4 and IL-13 doubly deficient mice. Furthermore, STAT6-deficient mice showed marked reduction in BLM-induced lung FIZZ1 expression. Thus, IL-4 and IL-13 are potent inducers of AEC FIZZ1 expression via STAT6 and play key roles in BLM-induced lung FIZZ1 expression and fibrosis. This represents a potential mechanism by which IL-4/IL-13 could play a role in the pathogenesis of lung fibrosis. | Introduction |
|---|
|
|
|---|
, FIZZ2/RELM-
, and FIZZ3/resistin. These three members have unique tissue specific distribution. Thus, FIZZ1 is expressed in lung, white adipose tissue, mammary, tongue, and heart (1), and is found lately to be a key marker, along with Ym-1, of alternatively activated macrophages (4, 5). FIZZ2 is detected exclusively in the colon and small bowel (2), whereas FIZZ3 is found in white adipose tissue and circulating mononuclear cells (1, 6). More recently, there is evidence of an additional member of this family of proteins, referred to as RELM-
(7). This newest member exhibits 69.4 and 72.1% homology with RELM-
/FIZZ1 in the rat and mouse, respectively. This high degree of homology is thought to have made it difficult to distinguish expression of RELM-
/FIZZ1 from RELM-
expression in white adipose tissue in the previous study (7). The FIZZ/RELM family is characterized by a signature carboxyl terminus sequence containing 10 completely conserved cysteine residues, in which the spacing between cysteines is invariant (1, 2). FIZZ1 lacks one cysteine residue in the amino terminus that is present in both FIZZ2 and FIZZ3 in multiple species. This difference may be responsible for the inability of FIZZ1 to form disulfide-linked homodimers, while both FIZZ2 and FIZZ3 have been found as homodimers (8). However, FIZZ1 has been found to form hetero-oligomers with FIZZ3 but not FIZZ2 (9). These structural signatures of conserved spacing between cysteine residues and small size (between 8 and 12 kDa) indicate that FIZZ1 is likely to be a secreted protein with potential as a signaling molecule. This possibility is supported by a study showing that FIZZ1 is secreted into the culture supernatant of FIZZ1-transfected 293T cells (2).
There is only limited information about the precise biological function or activity of this family of molecules. FIZZ1 is first reported to inhibit the nerve growth factor-mediated gene expression of dorsal root ganglion neurons (1). It has an inhibitory effect on 3T3-L1 preadipocyte differentiation into adipocytes, which is not accompanied by an increase in cell proliferation (9). Recently, a study in a mouse chronic hypoxia model of pulmonary hypertension revealed that FIZZ1 is able to stimulate the proliferation of pulmonary vascular smooth muscle cells, and thus, is referred to also as a hypoxia-induced mitogenic factor (10). FIZZ1 is also highly induced in bleomycin (BLM)-induced lung fibrosis as assessed by cDNA microarray analysis, and found to localize primarily to alveolar epithelial cells by in situ hybridization (11, 12). Furthermore, FIZZ1 can induce myofibroblast differentiation in lung fibroblast cultures, as manifested by increased expression of
-smooth muscle actin (
-SMA) and type I collagen (11). This suggests the potential involvement of FIZZ1 in the fibrotic response in BLM-induced lung injury model. However, the mechanism of induction and regulation of FIZZ1 expression in alveolar epithelial cells in the context of lung injury and fibrosis is undetermined.
However, there is evidence from studies with alternatively activated macrophages that suggest induction of FIZZ1 expression may be under the influence of type 2 cytokines (4, 5). Moreover, there is ample evidence to suggest the involvement of the type 2 cytokines, IL-4 and IL-13, in fibrotic diseases (13, 14, 15, 16). For instance, IL-4 gene expression is significantly increased in a murine model of lung injury induced by BLM with primary expression by macrophages and T lymphocytes (14). Moreover, IL-4 and IL-13 are capable of stimulating fibroblast proliferation, as well as
-SMA and collagen expression, thus triggering myofibroblast differentiation (17). A recent study suggests that IL-13 could mediate its fibrogenic effects in the lung and other organs by inducing and activating TGF-
1 (18). Like TGF-
1, IL-4 and IL-13 have similar effects on myofibroblast differentiation by inducing
-SMA production in human synovial fibroblasts (19). These data clearly suggest the profibrotic roles of IL-4 and IL-13 in fibrosis by affecting fibroblast activation and myofibroblast differentiation. These findings suggest the possibility that FIZZ1 expression in alveolar epithelial cells may be regulated by cytokines, especially type 2 cytokines.
IL-13 shares 30% homology with IL-4 and appears to have certain overlapping biological activities in Th2 type responses. Both cytokines bind to the IL-4R
-chain (20). In response to treatment with IL-4 or IL-13, receptor multimerization is accompanied with binding and activation of the downstream signaling molecules, JAKs, resulting in their transphosphorylation, as well as receptor phosphorylation. The phosphorylated receptor creates docking sites for STAT6, which can then be phosphorylated by JAKs, leading to STAT6 dissociation from the receptor, homodimerization and translocation to the nucleus. These STAT6 homodimers can then interact with specific DNA elements on promoters of IL-4/IL-13 target genes and regulate gene transcription (21, 22, 23). Although this pathway seems to be operational in mononuclear leukocytes, its role in alveolar epithelial cell response to IL-4/IL-13 treatment is unclear, especially with respect to regulation of FIZZ1 gene expression.
Hence, the objective of this study was to investigate the role of the type 2 cytokines, IL-4/IL-13, in regulation of type II alveolar epithelial cell (AEC) FIZZ1 gene expression, and evaluate the participation of the JAK-STAT signal transduction pathway in mediating this regulation. The roles of these molecules in vivo were then confirmed in vivo in the BLM-induced lung injury and fibrosis model.
| Materials and Methods |
|---|
|
|
|---|
Male specific pathogen-free Fisher 344 rats (6
8 wk old) were purchased from Charles River Breeding Laboratories (Wilmington, MA). BALB/c, C57BL/6, and IL-4-deficient (IL-4/) mice on a C57BL/6 background (68 wk old) were purchased from The Jackson Laboratory (Bar Harbor, ME). IL-13-deficient (IL-13/) mice, IL-4 and IL-13 doubly deficient (IL-4/13/) mice, and STAT6-deficient mice, all on BALB/c background (710 wk old) were produced as previously described (24, 25), and bred at the University of Michigan (Ann Arbor, MI) for these studies. To induce pulmonary fibrosis, BLM (Blenoxane; Mead Johnson, Princeton, NJ) was dissolved in sterile PBS and instilled endotracheally on day 0 as previously described (26). Due to the strain-dependent differences in sensitivity to BLM (27), the doses of BLM were 0.0015 U/g and 0.01 U/g body weight for C57BL/6 and BALB/c mice, respectively. Control groups received the same volume of sterile PBS only. Mice (n = 35) were randomly assigned to each of the indicated treatment groups. At indicated time points after BLM treatment, the mice were sacrificed and the lungs were harvested rapidly. Where indicated, the lung tissue samples were immediately placed in TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA) for total RNA isolation, or in lysis buffer (50 mM Tris.Cl, pH 7.5, 1% Nonidet P-40) for Western blotting analysis.
Isolation of rat AECs and treatment with cytokines
AECs were isolated by elastase digestion and IgG panning as previously described (28). Briefly, after multiple whole lung lavages with 1 mM EGTA in balanced salt solution, porcine pancreatic elastase (4.3 U/ml; Worthington Biochemical, Lakewood, NJ) was instilled via the trachea to release type II cells. Contaminating cells bearing FcRs were removed from the cell suspension by panning on plates coated with rat IgG (Sigma-Aldrich, St. Louis, MO). The cells were suspended in DMEM supplemented with 10% newborn calf serum (Sigma-Aldrich), and then plated onto 6-well tissue culture dishes precoated with fibronectin (R&D Systems, Minneapolis, MN). Isolated cells were evaluated by immunofluorescence after staining with anti-cytokeratin 5/8 Abs (BD Biosciences, San Diego, CA), which recognized the cytokeratins found in AECs, but not present in macrophages, fibroblasts, or endothelial cells (28, 29). After 2 days in culture, the adherent cells were consistently >90% epithelial cells. Primary cultured AECs were used without passaging.
When ready to use, AECs were cultured in DMEM supplemented with 10% FBS. When they reached
90% confluence, the cells were made quiescent by culturing in DMEM containing 0.5% FBS for 46 h. Where indicated, recombinant rat IL-4 and/or recombinant mouse IL-13 (R&D Systems) were then added at the indicated doses, and further incubated for 4, 8, 12, and 24 h before harvesting for total RNA isolation.
RNA analysis by RT-PCR
For quantitative mRNA analysis, total RNA was isolated from lung tissue or AECs. Primer Express 2.0 software (Applied Biosystems, Foster City, CA) was used to design TaqMan primers and MGB probes (6-FAM conjugated) for FIZZ1 and STAT6, which were then purchased from Applied Biosystems. The primer sequences were as follows: rat FIZZ1 forward primer, 5'-CAACAGGATGAAGACTGCAACCT-3'; reverse primer, 5'-GGGACCATCAGCTAAAGAAG-3'; probe, 5'-6FAM-CCCTTCTCATCTGCGTCT-3'; and murine FIZZ1 forward primer, 5'-TCCAGCTAACTATCCCTCCACTGT-3'; reverse primer, 5'-GGCCCATCTGTTCATAGTCTTGA-3'; probe, 5'-6FAM-CGAAGACTCTCTCTTGC-3'; and murine STAT6 forward primer, 5'-CCTCAACGAGCCAGATGGAA3'; reverse primer, 5'TGATGCCCCCAATCTCAGA-3'; probe, 5'6FAMTTCCTCCTCCGCTTTA-3'.
Primers and probe for GAPDH were purchased from Applied Biosystems. For each assay, 100 ng of total RNA was used as template. GAPDH mRNA was used as internal control to normalize the amount of input RNA. One-step real time RT-PCR (48°C 30 min, 95°C 10 s, followed by 45 cycles of 95°C 10 s, 60°C 1 min) was undertaken with TaqMan One Step RT-PCR Master Mix (Applied Biosystems) using a GeneAmp 5700 Sequence Detection System (Applied Biosystems). Results were expressed as 2
CT as previously described (30).
Western blotting analysis for STAT6 and JAK1
Western blotting to detect STAT6 or JAK1 protein expression was performed as previously described (11). Briefly, 20 µg of cell extract protein was loaded and separated by SDS-PAGE (10%). Mouse anti-STAT6, rabbit anti-phospho-STAT6, and rabbit anti-JAK1 Abs (Santa Cruz Biotechnology, Santa Cruz, CA) were used as primary Abs, and immunostained bands were visualized with HRP-labeled anti-mouse or anti-rabbit IgG (Amersham Biosciences, Buckinghamshire, U.K.) as appropriate, followed by exposure to ECL Hyperfilm (Amersham Biosciences). The film was then scanned and quantitated using 1D Image Analysis software (Kodak, Rochester, NY).
Transfection of STAT6 and antisense oligonucleotides
Prokaryotic expression plasmid mouse pBSK-STAT6 was a kind gift of Dr. J. N. Ihle (St. Jude Childrens Research Hospital, Memphis, TN). STAT6 cDNA was digested with EcoRI and NotI from pBSK-STAT6, and then subcloned into pEGFP-C1 (BD Clontech, Palo Alto, CA) using T4 DNA ligase (Promega, Madison, WI) in accordance with the manufacturers instructions to form mammalian expression plasmid pEGFP-STAT6. The identity of the construct was confirmed by sequencing.
Where indicated, AECs were transiently transfected with pEGFP-STAT6 using the transfection reagent Fugene 6 (Roche Molecular Biochemicals, Indianapolis, IN) at a ratio of 2:3 (microgram:microliter). At 20 h after transfection, 10 ng/ml IL-4 or IL-13 were added and incubation was continued for an additional 4 h before harvesting for RNA purification. Empty plasmid pEGFP-C1 was also transfected under identical conditions and used as negative control. Where indicated, transfected cells were also transfected with antisense STAT6 phosphorothioate-derivatized oligonucleotides (5'CCCCACAGAGACATGATCTG3') at a final concentration of 500 nM to study the effects of specific inhibition of induced FIZZ1 expression. The corresponding sense oligonucleotide was used as control.
Hydroxyproline assay
Lung collagen deposition was estimated by measuring the hydroxyproline content of whole lung homogenates as previously described (17). Briefly, the lungs were excised, homogenized in 0.5 M acetic acid, and hydrolyzed in 6 N HCl overnight at 110°C. Hydroxyproline was assessed by colorimetric assay and the results were expressed as micrograms of hydroxyproline per lung.
Statistic analysis
All data were expressed as mean ± SE unless otherwise indicated. Differences between means of various treatment and control groups were assessed for statistical significance by ANOVA followed by post hoc analysis using Scheffés test for comparison between any two groups. A p value < 0.05 was considered to indicate statistical significance.
| Results |
|---|
|
|
|---|
BLM-induced lung injury in rats is known to induce FIZZ1 gene expression, which is localized to airway epithelial cells and AECs, but not to fibroblasts (11, 12). To seek out a possible mechanism for the regulation of FIZZ1 gene expression, a number of cytokines were investigated for their ability to regulate FIZZ1 gene expression in isolated AECs using RT-PCR. Initial screening showed that FIZZ1 expression was not significantly affected by treatment with a number of cytokines, including IL-1, TNF-
, IFN-
, and IL-12 (data not shown). However, FIZZ1 gene expression was significantly up-regulated in a dose-dependent manner by the Th2 cytokines, IL-4 and IL-13 (Fig. 1A). Stimulation was not significantly enhanced beyond 10 ng/ml for either cytokine at the 4-h time point (Fig. 1A). Stimulation by IL-4 was rapid with detectable increase as early as 2 h and peak increase at 4 h after addition of cytokine (Fig. 1B). Significantly stimulated levels were sustained up to as long as 20 h of treatment. Similar kinetics was noted with IL-13 treatment (data not shown). These results clearly indicated the ability of both IL-4 and IL-13 to significantly stimulate FIZZ1 gene expression by AECs in a dose- and time-dependent manner.
|
To confirm the in vivo significance of the in vitro observation using isolated AECs, the effects of IL-4 and/or IL-13 deficiency on lung FIZZ1 gene expression and fibrosis were examined using the BLM model. For these studies, the responses of IL-4/, IL-13/, and IL-4 and IL-13 doubly deficient (IL-4/13/) mice to BLM-induced lung injury were compared with those in their respective wild-type controls. In the wild-type strain, lung FIZZ1 mRNA was significantly increased over 6-fold that in saline-treated control lungs at the day-14 (after BLM administration) time point (Fig. 2A). This increase was significantly reduced to <3-fold in IL-4/ mice. Thus, IL-4 deficiency resulted in a >50% decrease in BLM-induced stimulation of lung FIZZ1 mRNA levels. A slight decrease in lung FIZZ1 mRNA was also observed in saline-injected IL-4/ mice in comparison with IL-4+/+ saline controls. Similar reductions in BLM-induced stimulation of lung FIZZ1 mRNA levels were noted in IL-13/ mice when compared with their respective wild-type controls (Fig. 2B). Remarkably, this BLM-induced increase in lung FIZZ1 mRNA levels was completely abolished in the doubly deficient IL-4/13/ mice. Thus, the BLM-induced stimulation of lung FIZZ1 expression appeared to be dependent entirely on IL-4 and IL-13, which would confirm the in vivo significance of the in vitro data obtained above using isolated AECs in tissue culture. It appears that in the absence of one of these Th2 cytokines, stimulation of FIZZ1 expression could be maintained partially by the unaffected cytokine.
|
|
To find out whether STAT-6 and JAK-1 were involved in the IL-4- and IL-13-induced signal transduction cascade leading to the regulation of FIZZ1 gene expression, STAT-6 and JAK-1 expression in AECs were evaluated by Western blotting. AECs were treated for 24 or 48 h with IL-4 or IL-13, and the total cellular proteins were then analyzed for levels of phosphorylated STAT6, total STAT6, and JAK-1 protein levels by Western blotting using the appropriately specific Abs. The results showed that at both 24 and 48 h of treatment, the levels of phosphorylated STAT6 were markedly induced in cells treated with either cytokine, while the levels of total STAT6 protein were not significantly altered (Fig. 4). JAK-1 protein levels showed stimulation by both cytokines at both time points examined, but appear to decline at the 48-h time point. The increase in JAK-1 at the 24-h time point was 173.5% ± 3.34 and 128.6% ± 5.8 above the control level as a result of IL-4 and IL-13 stimulation, respectively. These results suggested that the activation of STAT-6 and JAK-1 were likely involved in IL-4- and IL-13-induced increase in AEC FIZZ1 expression.
|
To confirm the importance of STAT6 in induction of FIZZ1 expression, the effect of transfecting a STAT6 expression plasmid, pEGFP-STAT6, on AEC FIZZ1 expression was examined. Transfection of pEGFP-STAT6 caused a marked (>16-fold over empty vector only) increase in cellular STAT6 mRNA levels by RT-PCR analysis (Fig. 5A). IL-4 treatment caused an increase in STAT6 mRNA levels in control cells treated with the empty vector, but failed to affect the expression in cells transfected with pEGFP-STAT6. Thus, the transduced level of STAT-6 overexpression could not be stimulated further by IL-4 treatment. Examination of FIZZ1 expression by RT-PCR in similarly treated cells revealed significant stimulation of FIZZ1 expression by the STAT6 expression plasmid compared with untreated cells, or cells transfected with the empty vector (Fig. 5B). Furthermore, the increase induced by the STAT6 expression plasmid was abrogated by transfection with an antisense STAT6 oligonucleotide, indicating that the stimulation in FIZZ1 expression was specifically due to an increase in STAT6 expression in the pEGFP-STAT6-transfected cells. These results strongly suggest that IL-4 stimulation of AEC FIZZ1 expression was mediated by STAT6.
|
To explore the potential in vivo relevance of these in vitro effects of STAT6 on FIZZ1 expression, the levels of STAT6 mRNA were determined in the lung tissue of mice treated with BLM. As previously noted, lung FIZZ1 expression was markedly induced in animals treated with BLM (11), and this was associated with significant elevation in lung STAT6 mRNA (Fig. 6A). These results showed correlation between lung FIZZ1 and STAT6 expression, which would be consistent with the in vitro demonstration of the dependence of AEC FIZZ1 expression on STAT6 as shown above. Thus, IL-4- or IL-13-induced FIZZ1 expression in pulmonary fibrosis may depend on signaling via STAT6. To further confirm the importance of STAT6 in induction of FIZZ1 expression in pulmonary fibrosis, the effects of STAT6 deficiency on BLM-induced lung FIZZ1 expression were examined. Because induction of lung FIZZ1 expression is maximal at day 7 after BLM injury (11), this time point was chosen for this experiment. As expected, lung FIZZ1 mRNA was markedly induced in wild-type mice at day 7 after BLM treatment compared with that in saline controls (Fig. 6B). This induction was essentially abolished in STAT6 knockout mice. These findings confirmed the dependence of FIZZ1 induction on STAT6, which are consistent with the in vitro findings showing IL-4 or IL-13 induction of FIZZ1 expression via STAT6.
|
| Discussion |
|---|
|
|
|---|
-SMA expression in lung fibroblasts, two key parameters of fibroblast activation and myofibroblast differentiation that are known to occur in lung fibrosis (11). These properties indicate that FIZZ1 might play a potent role in mediating the cross-talk between epithelial cells and fibroblastic cells that is postulated as being important in formation of fibroblastic foci (33). Given this potentially important role in the pathogenesis of pulmonary fibrosis, elucidation of the mechanisms responsible for the induction of lung FIZZ1 expression should contribute to further understanding of key processes involved in progressive fibrosis. In this study, we present evidence that IL-4 and IL-13 could induce FIZZ1 gene expression in AECs in vitro and in vivo during BLM-induced lung fibrosis, and that this induction was mediated by STAT6 with the possible involvement of JAK1.
Based on previous data showing that induction of lung FIZZ1 in BLM-induced lung fibrosis was mainly observed in AECs, but not in fibroblasts, a number of candidate cytokines were screened for their ability to regulate FIZZ1 expression in isolated AECs. Of the cytokines tested, only IL-4 and IL-13 had consistent and significant effects on FIZZ1 gene expression. Other cytokines such as IL-1, TNF-
, and IFN-
, failed to induce FIZZ1 gene expression. This is consistent with previous reports of the inability of LPS, TNF-
, or IL-6 to significantly affect FIZZ1/RELM-
expression (34). The Th2 cytokines, IL-4 and IL-13, are known to be important in BLM-induced lung fibrogenesis (13, 16, 35, 36). IL-4 plays a pivotal role in the extension of pulmonary fibrosis by enabling and/or enhancing fibroblast activation and myofibroblast differentiation (17). IL-13 can activate TGF-
1 in vivo with mediation by a serine protease/plasmin and MMP-9-dependent mechanism (18). Markedly diminished eosinophil recruitment and airway remodeling were observed in IL-4/13/ mice (37). In our present and previous studies (17), IL-4 and IL-13 were also shown to be important for the development of BLM-induced lung fibrosis by hydroxyproline estimation. In this study, we show that IL-4 and IL-13 were able to up-regulate FIZZ1 expression in vitro in AECs in a dose-dependent manner. This in vitro effect appears to be important in vivo, as well as in the BLM-induced pulmonary fibrosis model. Thus, substantial reduction in lung FIZZ1 expression was noted in BLM-treated IL-4- or IL-13-deficient mice when compared with their respective wild-type controls. Furthermore, there was essentially complete suppression of BLM-induced lung FIZZ1 expression in IL-4/IL-13 doubly deficient mice, indicating that induction of FIZZ1 expression in this animal model was completely dependent on these two Th2 cytokines. This reduced FIZZ1 expression in the deficient mice was accompanied by significant reduction in pulmonary fibrosis as assessed by lung hydroxyproline content. Thus, an additional role for these two cytokines in fibrosis is the ability to up-regulate FIZZ1 expression, which could in turn promote fibroblast activation and myofibroblast differentiation, two key elements in fibroblastic foci formation.
The kinetics of cytokine-induced FIZZ1 expression in AECs indicated a rapid induction of FIZZ1 mRNA, starting at 2 h after addition of cytokine. This is consistent with IL-4 or IL-13 stimulation of FIZZ1 expression in alternatively activated peritoneal macrophages (4) and the BMnot cell line isolated from bone marrow of temperature-sensitive SV40 T-Ag transgenic mice (38). In the latter study, FIZZ1 mRNA is elevated starting as early as 1 h after IL-4 stimulation and increased stably for up to 24 h.
The involvement of JAK1 and STAT6 in IL-4- and IL-13-induced signaling pathways is well elucidated (39, 40). Upon IL-4 or IL-13 stimulation, JAK1 activation is followed by activation of STAT6 by tyrosine phosphorylation, leading to homodimerization and translocation of the protein into the nucleus. There, STAT6 homodimers can interact with promoters of IL-4 or IL-13 responsive genes to regulate gene expression. Indeed, a functional STAT6-binding element has been identified in the murine FIZZ1 promoter in studies using the BMnot cell line (38), which could cooperate with C/EBP, a transcription factor known to bind to the FIZZ3/resistin promoter and found to be sufficient for activation of this promoter (41). Consistent with these findings, our data indicated a similar regulatory role for STAT6 in rat AECs. First there is the evidence showing activation of STAT6 in cells treated with IL-4 or IL-13 that was associated with increased expression of JAK-1. Moreover, transfection of a STAT6 expression plasmid into rat AECs stimulated the expression of FIZZ1, which was inhibited by antisense STAT6 oligonucleotides. These findings confirmed that the observed effect on FIZZ1 was specifically due to mediation by STAT6. Furthermore, our findings revealed that STAT6 gene expression was markedly increased in BLM-induced lung fibrosis in a mouse model and its deficiency abolished lung FIZZ1 induction. One study recently showed that peribronchial inflammation was markedly diminished and fibrosis was also significantly reduced in STAT6-deficient mice in contrast to corresponding wild-type mice in a model of airway disease (42). Given the activity of FIZZ1 on myofibroblast differentiation, the STAT6 mediated up-regulation in FIZZ1 expression would be expected to promote fibrosis. Thus, taken together, these observations strongly suggest that STAT6 may be involved in FIZZ1 induction in lung fibrosis and remodeling.
Finally, the relevance of these findings to human pulmonary fibrosis remains to be elucidated. Establishing such relevance is handicapped by the lack of information concerning a human homologue of rodent FIZZ1 (2). Although the human counterparts for FIZZ2 and FIZZ3 have been reported and analyzed, human FIZZ1 has yet to be identified. Recently, two additional members of this family of molecules have been reported, namely murine RELM-
(7, 43) and human/murine 10 cysteine protein 1 (44). Although RELM-
shows extensive homology to FIZZ1, its human counterpart is unknown. As with RELM-
, the in vivo function of 10 cysteine protein 1 is uncertain, and its potential relationship to a human FIZZ1 remains to be determined. Thus, it is unclear at this time whether a human FIZZ1 homologue exists, and/or whether these additional novel members have similar function as rodent FIZZ1. Elucidation of the in vivo role of FIZZ1 in human disease must await identification of a human FIZZ1 and/or further functional characterization of the various members of this gene family.
| Acknowledgments |
|---|
| Footnotes |
|---|
1 This work was supported in part by research Grants HL28737, HL31963, and HL52285 from the National Institutes of Health. ![]()
2 Address correspondence and reprint requests to Dr. Sem H. Phan, Department of Pathology, University of Michigan Medical School, 1301 Catherine Street, MS 1 4211, Ann Arbor, MI 48109-0602. E-mail address: shphan{at}umich.edu ![]()
3 Abbreviations used in this paper: FIZZ, found in inflammatory zone; RELM, resistin-like molecule; BLM, bleomycin; AEC, type II alveolar epithelial cell; SMA, smooth muscle actin. ![]()
Received for publication March 26, 2004. Accepted for publication June 23, 2004.
| References |
|---|
|
|
|---|
action in humans. Diabetes 50:2199.
, a novel resistin-like molecular with a distinct expression pattern. Genomics 81:588.[Medline]
(RELM
): biochemical characterization of its oligomeric nature. J. Biol. Chem. 277:42011.
, a novel hypoxia-induced mitogenic factor in lung with vasoconstrictive and angiogenic properties. Circ. Res. 92:1.
1. J. Exp. Med. 194:809.
1 and interleukin 4 induced
smooth muscle actin expression and myofibroblast-like differentiation in human synovial fibroblasts in vitro: modulation by basic fibroblast growth factor. Ann. Rheum. Dis. 56:426.
CT method. Methods 25:402.[Medline]
in adipose tissue. Mol. Endocrinol. 16:1920.
and IL-13 synergistically increase eotaxin-1 production in human airway fibroblasts. J. Immunol. 169:4613.
gene expression by a STAT 6 and CCAAT/enhancer-binding protein-dependent mechanism. J. Immunol. 170:1789.
. Biochem. Biophys. Res. Commun. 314:356.[Medline]
-dependent members of FIZZ/Resistin gene family. Oncogene 23:3414.[Medline]Related articles in The JI:
This article has been cited by other articles:
![]() |
D. J. Angelini, Q. Su, K. Yamaji-Kegan, C. Fan, X. Teng, P. M. Hassoun, S. C. Yang, H. C. Champion, R. M. Tuder, and R. A. Johns Resistin-Like Molecule-{beta} in Scleroderma-Associated Pulmonary Hypertension Am. J. Respir. Cell Mol. Biol., November 1, 2009; 41(5): 553 - 561. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ishii, H. Wen, C. A. S. Corsa, T. Liu, A. L. Coelho, R. M. Allen, W. F. Carson IV, K. A. Cavassani, X. Li, N. W. Lukacs, et al. Epigenetic regulation of the alternatively activated macrophage phenotype Blood, October 8, 2009; 114(15): 3244 - 3254. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Takagi, N. Hashimoto, S. H. Phan, K. Imaizumi, M. Matsuo, H. Nakashima, I. Hashimoto, Y. Hayashi, T. Kawabe, K. Shimokata, et al. Erythromycin-induced CXCR4 expression on microvascular endothelial cells Am J Physiol Lung Cell Mol Physiol, September 1, 2009; 297(3): L420 - L431. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Fan, Q. Su, Y. Li, L. Liang, D. J. Angelini, W. B. Guggino, and R. A. Johns Hypoxia-induced mitogenic factor/FIZZ1 induces intracellular calcium release through the PLC-IP3 pathway Am J Physiol Lung Cell Mol Physiol, August 1, 2009; 297(2): L263 - L270. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yamaji-Kegan, Q. Su, D. J. Angelini, and R. A. Johns IL-4 Is Proangiogenic in the Lung under Hypoxic Conditions J. Immunol., May 1, 2009; 182(9): 5469 - 5476. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Liu, B. Hu, Y. Y. Choi, M. Chung, M. Ullenbruch, H. Yu, J. B. Lowe, and S. H. Phan Notch1 Signaling in FIZZ1 Induction of Myofibroblast Differentiation Am. J. Pathol., May 1, 2009; 174(5): 1745 - 1755. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Nair, Y. Du, J. G. Perrigoue, C. Zaph, J. J. Taylor, M. Goldschmidt, G. P. Swain, G. D. Yancopoulos, D. M. Valenzuela, A. Murphy, et al. Alternatively activated macrophage-derived RELM-{alpha} is a negative regulator of type 2 inflammation in the lung J. Exp. Med., April 13, 2009; 206(4): 937 - 952. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Angelini, Q. Su, K. Yamaji-Kegan, C. Fan, J. T. Skinner, H. C. Champion, M. T. Crow, and R. A. Johns Hypoxia-induced mitogenic factor (HIMF/FIZZ1/RELM{alpha}) induces the vascular and hemodynamic changes of pulmonary hypertension Am J Physiol Lung Cell Mol Physiol, April 1, 2009; 296(4): L582 - L593. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Reece, M. C. Siracusa, T. L. Southard, C. F. Brayton, J. F. Urban Jr., and A. L. Scott Hookworm-Induced Persistent Changes to the Immunological Environment of the Lung Infect. Immun., August 1, 2008; 76(8): 3511 - 3524. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Gangadharan, M. A. Hoeve, J. E. Allen, B. Ebrahimi, S. M. Rhind, B. M. Dutia, and A. A. Nash Murine gammaherpesvirus-induced fibrosis is associated with the development of alternatively activated macrophages J. Leukoc. Biol., July 1, 2008; 84(1): 50 - 58. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Trujillo, E. C. O'Connor, S. L. Kunkel, and C. M. Hogaboam A Novel Mechanism for CCR4 in the Regulation of Macrophage Activation in Bleomycin-Induced Pulmonary Fibrosis Am. J. Pathol., May 1, 2008; 172(5): 1209 - 1221. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Daley, C. Emson, C. Guignabert, R. de Waal Malefyt, J. Louten, V. P. Kurup, C. Hogaboam, L. Taraseviciene-Stewart, N. F. Voelkel, M. Rabinovitch, et al. Pulmonary arterial remodeling induced by a Th2 immune response J. Exp. Med., February 18, 2008; 205(2): 361 - 372. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. MacKinnon, S. L. Farnworth, P. S. Hodkinson, N. C. Henderson, K. M. Atkinson, H. Leffler, U. J. Nilsson, C. Haslett, S. J. Forbes, and T. Sethi Regulation of Alternative Macrophage Activation by Galectin-3 J. Immunol., February 15, 2008; 180(4): 2650 - 2658. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Scotton and R. C. Chambers Molecular Targets in Pulmonary Fibrosis: The Myofibroblast in Focus Chest, October 1, 2007; 132(4): 1311 - 1321. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Loke, I. Gallagher, M. G. Nair, X. Zang, F. Brombacher, M. Mohrs, J. P. Allison, and J. E. Allen Alternative Activation Is an Innate Response to Injury That Requires CD4+ T Cells to be Sustained during Chronic Infection J. Immunol., September 15, 2007; 179(6): 3926 - 3936. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. Swain, S. Han, A. Harmsen, K. Shampeny, and A. G. Harmsen Pulmonary Hypertension Can Be a Sequela of Prior Pneumocystis Pneumonia Am. J. Pathol., September 1, 2007; 171(3): 790 - 799. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mishra, M. Wang, J. Schlotman, N. M. Nikolaidis, C. W. DeBrosse, M. L. Karow, and M. E. Rothenberg Resistin-like molecule-beta is an allergen-induced cytokine with inflammatory and remodeling activity in the murine lung Am J Physiol Lung Cell Mol Physiol, August 1, 2007; 293(2): L305 - L313. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Homer Airway remodeling and RELM-beta Am J Physiol Lung Cell Mol Physiol, August 1, 2007; 293(2): L303 - L304. [Full Text] [PDF] |
||||
![]() |
A. Amatucci, T. Novobrantseva, K. Gilbride, M. Brickelmaier, P. Hochman, and A. Ibraghimov Recombinant ST2 boosts hepatic Th2 response in vivo J. Leukoc. Biol., July 1, 2007; 82(1): 124 - 132. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Chen, Y. Wei, G. C. Sharp, and H. Braley-Mullen Decreasing TNF-{alpha} results in less fibrosis and earlier resolution of granulomatous experimental autoimmune thyroiditis J. Leukoc. Biol., January 1, 2007; 81(1): 306 - 314. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Misson, F. Brombacher, M. Delos, D. Lison, and F. Huaux Type 2 immune response associated with silicosis is not instrumental in the development of the disease Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L107 - L113. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yamaji-Kegan, Q. Su, D. J. Angelini, H. C. Champion, and R. A. Johns Hypoxia-induced mitogenic factor has proangiogenic and proinflammatory effects in the lung via VEGF and VEGF receptor-2 Am J Physiol Lung Cell Mol Physiol, December 1, 2006; 291(6): L1159 - L1168. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Tong, L. Zheng, L. Lin, B. Li, D. Wang, and D. Li Hypoxia-Induced Mitogenic Factor Promotes Vascular Adhesion Molecule-1 Expression via the PI-3K/Akt-NF-{kappa}B Signaling Pathway Am. J. Respir. Cell Mol. Biol., October 1, 2006; 35(4): 444 - 456. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Nair, K. J. Guild, and D. Artis Novel Effector Molecules in Type 2 Inflammation: Lessons Drawn from Helminth Infection and Allergy J. Immunol., August 1, 2006; 177(3): 1393 - 1399. [Full Text] [PDF] |
||||
![]() |
J. H. Kim, H. Y. Kim, S. Kim, J.-H. Chung, W. S. Park, and D. H. Chung Natural Killer T (NKT) Cells Attenuate Bleomycin-Induced Pulmonary Fibrosis by Producing Interferon-{gamma} Am. J. Pathol., November 1, 2005; 167(5): 1231 - 1241. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |