The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wong, S. B. J.
Right arrow Articles by Siliciano, R. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wong, S. B. J.
Right arrow Articles by Siliciano, R. F.
The Journal of Immunology, 2004, 173: 3073-3083.
Copyright © 2004 by The American Association of Immunologists

An Evaluation of Enforced Rapid Proteasomal Degradation as a Means of Enhancing Vaccine-Induced CTL Responses1

S. B. Justin Wong2,*, Christopher B. Buck2,*, Xuefei Shen2,{dagger} and Robert F. Siliciano3,{ddagger}

* Program in Cellular and Molecular Medicine, {dagger} Program in Biochemistry, Cellular and Molecular Biology, {ddagger} Graduate Program in Immunology, Department of Medicine, and Howard Hughes Medical Institute, Johns Hopkins University School of Medicine, Baltimore, MD 21205


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The HIV-1 Gag protein is an attractive target for CTL-based vaccine strategies because it shows less sequence variability than other HIV-1 proteins. In an attempt to increase the immunogenicity of HIV-1 Gag, we created Gag variants that were targeted to the proteasomal pathway for rapid degradation. This enhanced rate of degradation was associated with increased presentation of MHC class I-associated antigenic peptides on the cell surface. Despite this, immunizing mice with either plasmid DNA or recombinant vaccinia vectors expressing unstable Gag failed to produce significant increases in bulk CTL responses or Ag-specific production of IFN-{gamma} by CD8+ T cells compared with mice immunized with stable forms of Gag. Production of IFN-{gamma} by CD4+ T cells was also impaired, and we speculate that the abrogation of CD4+ T cell help was responsible for the impaired CTL response. These results suggest that vaccine strategies designed to increase the density of peptide-MHC class I complexes on the surfaces of APC may not necessarily enhance immunogenicity with respect to CTL responses.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
There is now considerable interest in vaccine strategies that enhance the induction of Ag-specific CTL (for a review, see Ref.1). These approaches are dependent upon rapidly advancing basic knowledge of Ag-processing pathways (for reviews, see Refs.2 and 3). One potential strategy involves targeting of vaccine Ags directly into the MHC class I Ag-processing pathway, with the goal of providing a higher density of peptide/MHC class I complexes on the surfaces of APCs involved in the induction of CTL responses (4, 5, 6, 7, 8, 9, 10, 11). The presumption has been that higher Ag densities might stimulate stronger CTL responses. Enhanced presentation of rapidly degraded Ags was initially observed by Townsend et al. (10), who showed that targeting of Ags for rapid proteasomal degradation could enhance their processing and presentation in association with MHC class I. Rapid proteasomal degradation was subsequently used by other groups to enhance CTL responses to various model Ags (7, 8, 9, 12, 13). Enhanced CTL responses have also been observed when the entire processing reaction is bypassed by expression of minimal CTL epitopes targeted to the endoplasmic reticulum by a signal sequence (6). The enhancement of CTL responses observed in these experimental systems supports the idea that targeting Ags to undergo rapid cytoplasmic degradation might be a useful vaccine strategy in cases in which the induction of CD8+ CTL is the desired outcome.

Additional recent studies have raised questions about the utility of this approach. The importance of ubiquitin-dependent protein degradation in class I processing has been questioned (14, 15), and it is unclear whether the enhancement of CTL responses observed in in vitro assays of cytolytic function is of sufficient magnitude to warrant incorporation of this strategy into vaccines. It has been reported that targeting the hepatitis C virus core Ag for proteasomal degradation via the ubiquitin pathway does not enhance the Ag-specific CTL response (16). Recent studies suggest that while increasing epitope density generally primes a larger primary CTL response, excessive epitope density may not confer any additional benefit (17, 18). Careful studies by Bullock et al. (19) have uncovered a complex relationship between epitope density and the magnitude and avidity of primary, memory, and recall CTL responses. Importantly, they demonstrated that the induction of high avidity effectors was facilitated by priming with dendritic cells loaded with intermediate amounts of antigenic peptide. There is the additional concern that targeting an Ag into the class I pathway might reduce class II-restricted presentation and the provision of T cell help for the CTL response (20, 21, 22).

To evaluate the utility of degradation targeting strategies for enhancing vaccine-induced CTL responses, we have analyzed several different approaches for directing the HIV-1 Gag protein into the MHC class I Ag-processing pathway. Gag is an Ag of great interest because of its relatively high degree of conservation among HIV-1 isolates. Our results demonstrate that even when such strategies successfully increase the density of antigenic peptide-MHC complexes on the cell surface, the induction of enhanced CTL responses in vivo is not guaranteed and responses may in fact be blunted.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Plasmid construction

The ubiquitin fusion vector pUbMgag was constructed by amplifying ubiquitin from murine genomic DNA using the primers CCTGGTACCGCCACCATGCAGATCTTCGTGAAAACC and GACGCTCGAGCCATACCACCGCGGAGACGCAGGACCAGGTGCAG. The resulting PCR product was digested with Acc65I and XhoI, then cloned into pGag (23) prepared by digestion with Acc65I and XhoI. The ubiquitin open reading frame (ORF)4 was then appended with a linker segment derived from the bacterial LacI gene. This linker segment, termed eK, encodes exposed lysine residues suitable for ubiquitin side-chain conjugation (24, 25). The methionine-eK segment was amplified by PCR from DNA derived from Escherichia coli strain XL1-blue (Stratagene, La Jolla, CA) using the primers (reading from 5' to 3') GACGCTCGAGCACCCATTCGGGAAACCTGTCGTGCC and GTCTCCGCGGTGGTATGCACGGCTCCGGCGCCTGGCTGTTGCCCGTCTCACTGGTG. The resulting Ub-M-eK-gag ORF was digested with Acc65I, blunted with T4 DNA polymerase (NEB, Beverly, MA), then digested with XbaI. The trimmed insert was ligated into vaccinia thymidine kinase transfer vector pSC11MCS1 that had been prepared by digestion with SmaI and NheI. The gag ORF of the resulting vector, pvMeK, was then appended with SIINFEKL epitope by PCR using primers CAGTAGCAACCCTCTATTGTGTG and GAAGGCCTCACAGTTTTTCAAAGTTGATGATACTCTCCAGCTGCTCCAGTTGGCTAGAGGGGTCG. The resulting PCR product was ligated into pvMeK using AvrII and StuI to create the vector pvUbMgag.

Ubiquitin fusion vector pUbRgag was created by fusing Ub to a Gag mutant carrying a destabilizing deletion of residues 42–56 (26). This Gag mutant was generated by PCR using the primers ATTTGTCTACATAGCTCCCTGCTTGCCCATAC and ACCATGGGTGCTCGAGCGTCAG. The resulting PCR product was digested with XhoI and AccI, then cloned into pBgag (a pBluescript Gag shuttle (23) prepared by digestion with XhoI, followed by partial digestion with AccI). The mutagenized sequence was transferred into pCIgag using Acc65I and SphI. The arginine-eK linker sequence in vector pUbRgag was generated using the primer GTCTCCGCGGTGGTAGACACGGCTCCGGCGCCTGGCTGTTGCCCGTCTCACTGGTG. The resulting Ub-R-eK-mutant gag ORF was transferred into pSC11MCS1, as described above, and appended with SIINFEKL epitope, as described above.

pvShuf, a vaccinia transfer vector that encodes a shuffled series of gag fragments, was generated by PCR amplification of the gag gene of HIV-1 HXB2. A segment encoding Gag aa 16–47 was amplified using the primers ACGTTCTAGATGGGAAAAAATTCGGTT and AGCATAGCTAGCATTAACTGCGAATCGTTCTAG. DNA encoding Gag aa 68–103 was amplified using the primers AGTCTCTAGACTTCAGACAGGATCAGAAGAA and ACGATAGCTAGCCTTGTCTAAAGCTTCCTTGGT. DNA encoding Gag aa 136–285 appended with a His tag and stop codon was amplified using the primers ACGTAATCTAGACAGAACATCCAGGGGCAAATGG and ACGATAGCTAGCCTAGTGATGGTGGTGATGGTGGTGGTG TATGTCCAGAATGCTGGTAGGG. DNA encoding an initiator methionine codon followed by DNA encoding Gag aa 286–500 was amplified using the primers ATGCTCTAGACACACCATGAGACAAGGACCAAAGGAACCC and CATGATGCTAGCTTGGCTAGAGGGGTCGTTGC. All of the 5' primers contain an XbaI site, and the 3' primers contain NheI site. The PCR products were cut with both restriction enzymes and gel purified. The gel-purified fragments were ligated in a successive series of cloning steps into the XbaI site of pCI-PRE. The final shuffled construct encodes a series of fragments encoding Gag aa 286–500, 68–103, 16–47, and 136–285. An XbaI to StuI restriction fragment carrying the shuffled ORF was transferred into vaccinia shuttle vector pSC11MCS3 prepared by digestion with SpeI and StuI. The shuffled ORF of the resulting vector was appended with the SIINFEKL epitope by PCR amplification using the primers CAGTAGCAACCCTCTATTGTGTG and ATAGGCCTCACAGTTTTTCAAAGTTGATGATACTCTCCAGCTGCTCCAGAATGCTGGTAGGG. The resulting PCR product was reintroduced to the vector using restriction enzymes NsiI and StuI.

Each of the finished SIINFEKL-appended ORFs was transferred into the pCI-PRE vector backbone (23) by transferring an NheI-StuI fragment of each vaccinia transfer vector into pCIgag prepared by digestion with XbaI, blunting with T4 DNA polymerase, then digestion with NheI. A vector encoding wild-type Gag appended with SIINFEKL epitope was constructed by ligating an NheI-SphI fragment of pIgag into pUbRgag prepared by digestion with NheI and SphI.

The vector pVGE encodes a Gag-EGFP (enhanced GFP) fusion protein. To remove the native gag stop codon, pGAG was modified by PCR mutagenesis using the primers ATCGCCTAGGAAAAAGGGCTGT and GCTCTAGAGCCGGATCCAGTTGGCTAGAGGGGTCGTT. The resulting PCR product was ligated into pGAG using restriction enzymes AvrII and XbaI. An NheI-XbaI fragment of pEGFP-N1 (BD Clontech, Palo Alto, CA) was ligated into the XbaI site of the stop codon-deleted gag vector. A fragment encoding the gag-EGFP ORF was prepared by partial digestion with BglII, blunted using T4 DNA polymerase, followed by digestion with ClaI. The resulting fragment was then ligated into pRetro-Off (BD Clontech) prepared by digestion with XhoI, treatment with T4 DNA polymerase, and digestion with AccI.

Cell lines

The H-2d mastocytoma line P815 was a gift from M. Soloski (Johns Hopkins School of Medicine, Baltimore, MD). The C57BL/6 fibrosarcoma line MC57G was provided by D. Pardoll (Johns Hopkins School of Medicine). Both lines were maintained in RPMI 1640 (Invitrogen Life Technologies, Carlsbad, CA) supplemented with penicillin/streptomycin (Invitrogen Life Technologies) and 10% FCS (RPMI-10). Construction of the stable line PVGE was accomplished by transfecting P815 cells with plasmid pVGE using Lipofectamine Plus (Invitrogen Life Technologies). The transfected cells were selected and maintained in 1 µg/ml puromycin. Clones were screened for expression of Gag-EGFP fusion protein by FACS and anti-Gag Western blot (data not shown).

Pulse-chase experiments

Pulse-chase experiments were conducted, as previously described (23). Briefly, MC57G cells were infected with the indicated vaccinia expression vectors for 16 h at 37°C. Infected cells were then labeled with [35S]Cys-Met mixture for 20 min at 37°C, then chased with an excess of unlabeled Cys and Met for 0, 30, 60, or 120 min. Labeled cells were subjected to immunoprecipitation using a polyclonal anti-HIV Gag Ab. The t1/2 of the relevant protein species was calculated by PhosphorImager analysis (Molecular Devices, Sunnyvale, CA).

Vaccinia viruses

Vaccinia expression vectors were constructed using a standard homologous recombination procedure, followed by three rounds of plaque purification (27). Vaccinia vectors were titered on CV-1 cells by standard procedures (27).

Mice

Six-week-old female BALB/c and C57BL/6 mice were obtained from the National Cancer Institute. All animal work was performed in accordance with protocols approved by the Animal Care and Use Committee of the Johns Hopkins School of Medicine. Three mice were used for each vaccination condition. For analysis of primary responses, mice were challenged by tail vein injection with 1 x 107 PFU of vaccinia virus diluted in 100 µl of HBSS (Invitrogen Life Technologies). Six days postvaccination, the mice were sacrificed, and their splenocytes were harvested. Spleens were homogenized by passage through a 70-µm mesh filter (Falcon). The resulting splenocyte suspension was washed and resuspended in RBC lysis buffer (150 mM NH4Cl, 10 mM KHCO3, 0.1 mM EDTA, pH 7.2), then washed twice and resuspended in RPMI-10. In DNA prime-vaccinia boost experiments, the mice were primed by i.m. immunization in each lower limb with 50 µg of plasmid DNA prepared using Endofree Plasmid Mega Kits (Qiagen, Valencia, CA) and diluted in a final volume of 50 µl of PBS. Two to 4 wk later, mice were challenged i.v. with 3 x 106 PFUs of the relevant vaccinia virus. Three days after vaccinia challenge, splenocytes were harvested, as described above.

Peptides

The well-characterized H-2Kb-restricted OVA peptide SIINFEKL (28) was a generous gift from J. Schneck (Johns Hopkins School of Medicine). The H-2Kd-restricted gag peptide P7G (AMQMLKETI) (29) was synthesized by the Biosynthesis & Sequencing Laboratory, Johns Hopkins University.

Chromium release assays

Target P815 or MC57G cells were dislodged by treatment with PBS containing 0.5 mM EDTA. Cells were washed in RPMI-10 and then labeled with 100 µCi of 51Cr (Amersham Biosciences, Piscataway, NJ) with or without 10 µg/ml antigenic peptide at 37°C for 2 h. Radiolabeled targets were washed three times, diluted to 2.5 x 104 cells/ml in RPMI-10, and plated at 100 µl/well in 96-well V-bottom plates. Freshly harvested effector splenocytes from vaccinated mice were added to quadruplicate wells at the indicated E:T ratios. Plates were spun for 5 min at 200 x g, and incubated for 12 h (primary response) or for 4 h (secondary response) at 37°C in a humidified incubator with 5% CO2. A total of 50 µl of supernatant was removed from each well and assayed on a Lumaplate using a TopCount solid-state scintillation counter (Packard Instrument, Meriden, CT). Percent specific lysis was calculated using the formula 100 x ((experimental lysis –medium lysis)/(Nonidet P-40 lysis –medium lysis)). The figures show net specific lysis in which background lysis of parental P815 or MC57G cells has been subtracted from the lysis of Ag-expressing targets.

Flow cytometry

Surface staining of vaccinia-infected MC57G cells for H-2Kb/SIINFEKL complexes was accomplished using mAb 25-D1.16, a kind gift from R. Germain (National Institutes of Health, Bethesda, MD) (28). The cells were infected with vaccinia vectors encoding EGFP, Gag-SIINFEKL Ags, or the control vaccinia vector vSC8 at a multiplicity of infection of 3 for the times shown in Fig. 3. The infected cells were then incubated with 50 µl of 25-D1.16 hybridoma supernatant for 1 h on ice, washed, and stained with FITC-conjugated goat anti-mouse IgG (Caltag Laboratories, Burlingame, CA) for 30 min. For intracellular staining assays, 5 million splenocytes were stimulated by incubation with 10 µg/ml peptide or 5 µg/ml rHIV-1 Gag p24 capsid protein (Protein Sciences, Meriden, CT) in RPMI-10 supplemented with 55 µM 2-ME (Invitrogen Life Technologies) at 37°C in a humidified incubator with 5% CO2. Peptide stimulation was performed for 4 h in the presence of Golgistop reagent, after which the cells were fixed and permeabilized using the Cytofix/Cytoperm kit (BD Pharmingen, San Diego, CA), according to the manufacturer’s instructions. Permeabilized splenocytes were stained with FITC-conjugated rat anti-mouse IFN-{gamma} (BD Pharmingen; clone XMG1.2), PE-conjugated rat anti-mouse CD8a (BD Pharmingen; clone 53-6.7), and PerCP-conjugated Armenian hamster anti-mouse CD3e (BD Pharmingen; clone 145-2C11). Stimulation with HIV-1 p24 was performed overnight, after which Golgistop was added for an additional 3 h. The splenocytes were then fixed, permeabilized, and stained with FITC-conjugated rat anti-mouse IFN-{gamma} together with PE-conjugated rat anti-mouse CD4 (BD Pharmingen; clone GK1.5). Stained cells were analyzed using a FACSCalibur and CellQuest software (BD Biosciences, San Jose, CA).



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 3. The response of T cells to SIINFEKL/H-2Kb complexes on the cell surface. OT-I mice on a Rag1–/– background were used to generate naive or activated splenocytes by immunization with control vaccinia vSC8 or recombinant vaccinia expressing the SIINFEKL epitope as a minigene, respectively. MC57G target cells were infected with vSC8 or the indicated recombinant vaccinia expressing either stable or unstable Gag-SIINFEKL fusion proteins for 8 h. Target cells were subsequently added to OT-I effectors for an additional 4 h at an E:T ratio of 10:1. The cells were then fixed, permeabilized, stained, and analyzed by flow cytometry. The analysis was conducted on cells gated for expression of both CD3e and CD8a. The percentages reflect CD3+CD8+ cells, which are also IFN-{gamma}+. Similar results were obtained using unimmunized mice to generate naive splenocytes. Data represent one of two similar experiments.

 
Cytokine ELISA

Five million splenocytes were stimulated by overnight incubation with 5 µg/ml control baculovirus protein or rHIV-1 p24 (Protein Sciences) in RPMI-10 supplemented with 55 µM 2-ME. Supernatant samples were collected and assayed for secreted IFN-{gamma} in triplicate using a mouse IFN-{gamma} ELISA kit, according to the manufacturer’s instructions (Pierce, Rockford, IL).

Detection of H-2Kb/SIINFEKL complexes by SIINFEKL-specific T cells

OT-I mice on a Rag1–/– background were kindly provided by T. Shin (Pardoll lab, Johns Hopkins School of Medicine). These mice were immunized i.v. with 1 x 107 PFU of either recombinant vaccinia vector expressing the SIINFEKL epitope as a minigene (provided by J. Yewdell, National Institutes of Health), or control vaccinia vSC8. Three days later, the mice were sacrificed, and effector splenocytes were obtained, as described above. MC57G target cells were infected for 8 h at a multiplicity of infection of 10 with recombinant vaccinia vectors expressing the various Gag-SIINFEKL fusion proteins or with the control vaccinia vSC8. For intracellular staining of IFN-{gamma}, 3 x 105 target cells were mixed with 3 x 106 effectors in a flat-bottom 96-well microtiter plate for 4 h in the presence of Golgistop. The cells were fixed and permeabilized, then stained with FITC-conjugated rat anti-mouse IFN-{gamma} (BD Pharmingen), PE-conjugated rat anti-mouse CD8a (BD Pharmingen), and PerCP-conjugated Armenian hamster anti-mouse CD3e (BD Pharmingen), and analyzed by flow cytometry.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Construction of rapidly degraded forms of HIV-1 Pr55gag

Our initial attempts at destabilizing Gag showed that the protein is remarkably resistant to a variety of degradation signals, including a PEST sequence (30), the p53 degradation box (31), the yeast cup9 ORF (32), fusion to a signal sequence minus form of HIV-1 Env protein (33), and destabilizing mutations in the matrix domain and nucleocapsid domains (26, 34) (data not shown). We found that the matrix mutant with a deletion in residues 42–56 had a t1/2 of ~2 h (Table I), which we deemed too long to be suitable for our studies.


View this table:
[in this window]
[in a new window]
 
Table I. Turnover rates of Gag constructs

 
Cellular ubiquitin C-terminal hydrolases (UCHs) are proteases that cleave polyubiquitin precursor proteins into individual ubiquitin fragments. Some proteins have displayed dramatically reduced t1/2 when expressed as fusion proteins with ubiquitin mutants resistant to UCH activity (25). However, ubiquitin-Gag fusion proteins rendered noncleavable by either ubiquitin G76A or {Delta}74–76 mutations failed to demonstrate significantly reduced intracellular t1/2 (Table I).

We also investigated the possibility of targeting Pr55gag for rapid intracellular degradation using the N-end rule pathway, which was first described by Varshavsky and colleagues (35, 36). It was observed that proteins with certain destabilizing amino acids at the N termini were targeted for rapid proteasomal destruction. Exposure of destabilizing N-terminal residues can be accomplished by making use of UCHs, which cleave immediately following the C-terminal Arg-Gly-Gly motif of ubiquitin, regardless of the identity of the amino acid that follows the motif (with the exception of proline, which is cleaved slowly). This feature of the UCHs is useful for exposing destabilizing N-terminal amino acids, such as arginine. We found that ubiquitin-arginine wild-type Gag that is cleaved by UCHs to reveal a destabilizing arginine residue at the N terminus of Gag did not have a significantly reduced t1/2 (Table I). For some proteins, a short leader encoding exposed lysine residues (eK) is required for efficient degradation by the N-end rule pathway, presumably by providing suitable substrates for ubiquitin isopeptide side-chain attachment (35, 36). Addition of such a Ub-R-eK leader reduced the t1/2 of Pr55gag to ~2 h (Table I). A combined strategy of placing the Ub-R-eK leader onto the {Delta}42–56 matrix mutant (see above) resulted in a protein with a t1/2 of 10 min (Fig. 1).



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 1. Pulse-chase analysis of Gag stability in cells infected with vaccinia vectors expressing various forms of Gag. MC57G cells were infected with the indicated vaccinia vectors for 16 h. Infected cells were labeled with [35S]Cys-Met mixture for 20 min, then chased with an excess of unlabeled Cys and Met for 0, 30, 60, or 120 min. Labeled cells were subjected to immunoprecipitation using a polyclonal anti-HIV-1 Gag Ab. The t1/2 of each protein species (in minutes) was calculated by densitometric analysis (Molecular Devices).

 
The Ub-dependent pathway plays an important role in degrading damaged, misfolded proteins (37, 38, 39). We reasoned that if the normal secondary structure of Pr55gag were disrupted, the resulting protein might be recognized as defective and targeted for rapid degradation. To accomplish this disruption, we rearranged the order of four fragments of the Pr55gag ORF to construct a novel shuffled gag ORF predicted to encode a 51-kDa protein. The selected fragments of Pr55gag preserved segments of the protein that are rich in known human MHC class I and II epitopes (40). In pulse-chase experiments, the protein encoded by the shuffled gag ORF had a t1/2 of 20 min, whereas wild-type Pr55gag has a t1/2 of ~6 h (Fig. 1). Use of the proteasome inhibitor lactacystin prevented rapid degradation of the shuffled Gag protein, suggesting that the shuffled protein was degraded via the proteasomal pathway (data not shown).

MHC class I processing of stable and unstable Gag proteins

To test whether the rapid degradation of Gag protein increased the rate or amount of presentation of peptide epitopes by MHC class I, we appended each of the constructs shown in Fig. 1 with the H-2Kb-restricted SIINFEKL epitope derived from chicken OVA. Germain and colleagues (28) have generated a mAb with a high affinity for the complex of SIINFEKL with H-2Kb. We used this Ab to track the appearance of H-2Kb/SIINFEKL complexes on the cell surface, as an indicator of the rate and degree of MHC class I-restricted processing of the degradation-targeted constructs. FACS analysis of murine MC57G cells infected for various times with vaccinia vectors encoding SIINFEKL-tagged Gag proteins showed that the appearance of H-2Kb/SIINFEKL complexes proceeded with faster kinetics and reached higher steady state levels in cells infected with the unstable Gag constructs (Fig. 2, right panel). Using GFP as a reporter, the kinetics of insert protein synthesis by the vaccinia vector is demonstrated in the left panel of Fig. 2. The results we obtained are consistent with the concept that targeting Gag for rapid degradation increases the rate at which it is processed for MHC class I presentation.



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 2. Flow cytometric analysis of H-2Kb/SIINFEKL staining of MC57G cells infected with vaccinia vectors expressing various forms of Gag. Left panel, Fluorescence of MC57G cells infected with EGFP-expressing vaccinia over the indicated time course. Right panel, MC57G cells were infected with the indicated recombinant vaccinia vectors expressing various forms of Gag appended with SIINFEKL. At various time points, infected cells were probed for surface SIINFEKL/H-2Kb complexes using the mAb 25-D1.16 and FITC-conjugated goat anti-mouse IgG. For both panels, net fluorescence intensity at each time point was calculated by subtracting the fluorescence of cells infected with the control vaccinia vector vSC8. Data from one of two independent experiments are shown.

 
We wanted to demonstrate that this increase in the presentation of H-2Kb/SIINFEKL complexes on the cell surface could be distinguished by T cells. T cells from OT-I mice are transgenic for a TCR specific for H-2Kb/SIINFEKL complexes. We assayed the response of OT-I splenocytes to MC57G targets infected with recombinant vaccinia vectors expressing wild-type or rapidly degraded Gag tagged with the SIINFEKL epitope. By 10 h after infection with vaccinia vectors, levels of H-2Kb/SIINFEKL complexes on the surface of MC57G cells have reached a plateau (Fig. 2). We found that the IFN-{gamma} response of naive OT-I splenocytes correlated directly with the amount of cell surface H-2Kb/SIINFEKL as assayed by staining with Ab (compare Figs. 2 and 3, upper panel). The increased amount of H-2Kb/SIINFEKL complexes generated on the cell surface by rapidly degraded Gag constructs tagged with SIINFEKL was associated with an increase in the proportion of IFN-{gamma}-producing naive OT-I CD3+ CD8+ splenocytes in this assay. No such correlation was observed when the assay was repeated using activated H-2Kb/SIINFEKL-specific effectors derived from OT-I mice that had been previously immunized with recombinant vaccinia expressing the SIINFEKL epitope as a minigene (Fig. 3, lower panel). Taken together, these results demonstrate that the increased level of epitope expression resulting from enforced proteasomal degradation improves responses of naive CD8+ T cells, while activated T cells, which have a lower triggering threshold, do not exhibit increased responses in vitro.

Primary CTL responses to stable and unstable Gag proteins

The faster kinetics and higher overall levels of MHC class I processing of rapidly degraded Gag Ags might lead to an enhanced induction of CTL responses in mice vaccinated with vShuf or vUbRgag. To address this question, we examined the primary CTL responses of mice vaccinated i.v. with these vaccinia vectors. BALB/c mice were vaccinated with 3 x 106 PFUs of vGag, vShuf, vUbMgag, vUbRgag, or the control vaccinia vector vSC8. Six days after this vaccination, splenocytes were prepared for use in 51Cr release assays. By using relatively high E:T ratios and long (10- to 12-h) incubation periods, the induction of CTL in a primary immune response can be directly measured without an in vitro stimulation (6). Fig. 4 shows the net specific lysis of cells pulsed with an immunodominant Gag peptide, P7G. A similar pattern was observed when PVGE, an H-2Kd cell line that stably expresses a Gag-EGFP fusion protein, was used as a target. Mice vaccinated with vaccinia expressing unstable Gag, vUbRgag, exhibited anti-Gag CTL activity very similar to that seen in mice vaccinated with the stable Gag vaccinia vector vUbMgag. Likewise, vShuf-vaccinated mice exhibited CTL responses that were similar to responses seen in mice vaccinated with vGag. The data suggest that in the setting of a single vaccination, rapidly degraded forms of Gag do not dramatically enhance the induction of a primary anti-Gag CTL response.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 4. Primary CTL responses of BALB/c mice. Mice were immunized with 1 x 107 PFU of vSC8 or recombinant vaccinia encoding stable or unstable Gag. Six days later, splenocytes were isolated and used directly in a 12-h ex vivo chromium release assay for cytolytic activity without restimulation. The percent specific lysis of 51Cr-labeled P815 target cells pulsed with the P7G Gag peptide is shown.

 
Anti-Gag memory responses in a DNA prime/vaccinia challenge model

There is a great deal of current interest in AIDS vaccine strategies involving a plasmid DNA prime, followed by a live virus boost (41). We used a DNA prime/vaccinia challenge system to further investigate the impact of Gag t1/2 on the stimulation of CTL responses. Mice were vaccinated i.m. with 100 µg of a plasmid construct expressing wild-type Pr55gag, allowed to rest for 3 wk, then challenged i.v. with 3 x 106 PFUs of vaccinia vectors expressing stable or unstable Gag. Three days after the vaccinia challenge, splenocytes were isolated and analyzed for Ag-specific cytolytic activity or subjected to intracellular staining for Ag-induced IFN-{gamma} production.

Unexpectedly, mice challenged with vaccinia vectors expressing unstable forms of Gag (vShuf and vUbRgag) exhibited lower Gag P7G peptide-specific CTL responses than mice challenged with stable Gag vaccinia vectors (vGag or vUbMgag) in a standard 4-h 51Cr release assay (Fig. 5A). Similar results were obtained using CTL targets stably expressing Gag-GFP (data not shown). Splenocytes stimulated with P7G peptide and assayed for intracellular IFN-{gamma} also demonstrated a reduced response in mice challenged with recombinant vaccinia expressing unstable forms of Gag (Fig. 5B).



View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 5. Memory responses of BALB/c mice primed with plasmid pGag, then challenged with various vaccinia constructs. Mice were primed with plasmid DNA expressing stable Gag and allowed to rest for 2–5 wk, and the memory response was assessed 3 days following challenge with vSC8 or recombinant vaccinia expressing stable or unstable forms of Gag using ex vivo assays without further effector cell restimulation. A, Standard 4-h 51Cr release assay using P7G-loaded P815 cells as targets. The background lysis of P815 targets has been subtracted. B, Intracellular staining for IFN-{gamma} production in splenocytes stimulated for 4 h with P7G peptide. Cells were gated for expression of both CD3e and CD8a. The percentages refer to CD3+CD8+ cells, which are also IFN-{gamma}+. C, Intracellular staining for IFN-{gamma} production in splenocytes stimulated overnight in the presence of rHIV-1 p24. The percentages refer to CD4+ cells, which are also IFN-{gamma}+. Data from one of two independent experiments are shown.

 
Unstable forms of Gag might be present at much lower steady state levels than stable forms of Gag, and less Ag might be available for MHC class II processing. To address this question, we stimulated splenocytes from pGag DNA-primed/vaccinia-boosted mice with rGag p24 (the capsid domain of Pr55gag), stained the cells for CD4 and intracellular IFN-{gamma}, and subjected them to FACS analysis. As seen in the bottom panel of Fig. 5C, the p24-specific CD4+ responses of mice primed with pGag and boosted with vaccinia vectors expressing stable forms of Gag (vGag and vUbMgag) were higher than the responses seen in mice boosted with vaccinia vectors expressing unstable forms of Gag (vShuf and vUbRgag). The result is consistent with the concept that constitutive degradation of Gag results in blunted CD4+ T cell responses to the Ag.

We also used a plasmid DNA prime/vaccinia challenge strategy to examine the memory responses of C57BL/6 mice to the H-2Kb-binding SIINFEKL peptide appended to the C terminus of each of the Gag species. As shown in Fig. 2, this peptide is processed for MHC class I presentation with faster kinetics when appended to the unstable Gag species encoded by vShuf and vUbRgag. Despite the faster processing kinetics, CTL responses to the SIINFEKL epitope were blunted in mice challenged with the vaccinia viruses vShuf or vUbRgag (Fig. 6A). The same result was obtained when splenocytes were stimulated with SIINFEKL peptide and analyzed for IFN-{gamma} production by CD3+CD8+ cells (Fig. 6B). Thus, the failure of enforced rapid degradation to enhance Gag-specific CTL responses was observed with different epitopes, including one for which enhanced processing was directly demonstrated in vitro. It is interesting to note that the Gag construct with the shortest t1/2, UbRgag, also exhibited the most drastic reduction in SIINFEKL-specific CTL activity and IFN-{gamma} production (compare Figs. 1 and 6, A or B). This was associated with a decrease in the CD4+ response to rGag p24 (Fig. 6C).



View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 6. Memory responses of C57BL/6 mice primed with pGag, then challenged with various vaccinia constructs. Mice were primed with plasmid DNA expressing stable Gag and allowed to rest for 2–5 wk, and the memory response was assessed 3 days following challenge with vSC8 or recombinant vaccinia expressing stable or unstable forms of Gag-SIINFEKL fusion proteins using ex vivo assays without further restimulation of effectors. A, Standard 4-h 51Cr release assay using SIINFEKL-loaded MC57G cells as targets. The background lysis of MC57G targets has been subtracted. B, Intracellular staining for IFN-{gamma} production in splenocytes stimulated for 4 h in the presence of SIINFEKL peptide. Cells were gated for expression of both CD3e and CD8a. The percentages refer to CD3+CD8+ cells, which are also IFN-{gamma}+. C, Intracellular staining for IFN-{gamma} production in splenocytes stimulated overnight in the presence of rHIV-1 p24. The percentages refer to CD4+ cells, which are also IFN-{gamma}+. Data from one of two independent experiments are depicted.

 
Finally, we examined the efficiency of CTL priming in mice vaccinated with plasmid constructs encoding stable or unstable forms of Gag. For these experiments, BALB/c mice were first vaccinated with plasmids pUbMgag, pUbRgag, or a plasmid encoding irrelevant Ag (pCAT). The mice were then challenged i.v. with 3 x 106 PFUs of a vaccinia vector expressing a stable form of Gag (vGag). Mice primed with plasmid DNA expressing an unstable form of Gag (pUbRgag) generated much less Gag-specific CTL activity than mice primed with a stable form of Gag (Fig. 7A). Similar results were obtained when P7G peptide was used to stimulate splenocytes that were then assayed for IFN-{gamma} production by flow cytometry (Fig. 7B). We also analyzed the production of IFN-{gamma} by CD4+ splenocytes stimulated with HIV-1 p24 and obtained much weaker Ag-specific responses in mice primed with plasmid expressing unstable Gag (data not shown). Because the frequency of CD4+ IFN-{gamma}+ cells was low, particularly in mice primed with pUbRgag, we decided to assay the culture supernatant of p24-stimulated splenocytes for IFN-{gamma} by ELISA. Splenocytes from mice primed with unstable Gag secreted less IFN-{gamma} than cells from mice primed with stable Gag (Fig. 7C). Thus, the decreased response to unstable Gag was observed both at the initial priming stage as well as the subsequent memory phase of the response.



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 7. Memory responses of BALB/c mice primed with plasmid DNA expressing stable or unstable Gag. Mice were primed with pUbMgag, pUbRgag, or plasmid DNA encoding irrelevant Ag (pCAT) and allowed to rest for 2–5 wk, and the memory response was assessed 3 days following challenge with recombinant vaccinia expressing stable Gag (vGag) using ex vivo assays without further restimulation of effectors. A, Standard 4-h 51Cr release assay using P815 cells stably expressing Gag-EGFP fusion protein as targets. The background lysis of P815 targets has been subtracted. B, Intracellular staining for IFN-{gamma} production in splenocytes stimulated for 4 h with P7G peptide. Cells were gated for expression of both CD3e and CD8a. The percentages refer to CD3+CD8+ cells, which are also IFN-{gamma}+. C, ELISA for IFN-{gamma} in the supernatant of splenocytes cultured overnight in the presence of rHIV-1 p24 or control baculovirus protein. The error bars indicate values for ±1 SD. Data representative of three independent experiments are depicted.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Successful attempts to increase the induction of Ag-specific CTL by forcing rapid degradation of the vaccine Ag have been reported by several groups (4, 5, 6, 7, 8, 9, 10, 11, 12). We show in this study that even when enhanced processing and presentation of a vaccine Ag can be directly demonstrated, this does not necessarily result in increased immunogenicity. Two different rapidly degraded forms of the HIV-1 Gag protein failed to show significantly increased immunogenicity in mice following delivery by DNA vaccination or by vaccinia vectors. The degradation targeting strategies used in this study clearly increased the rate of appearance and steady state levels of antigenic peptide/MHC class I complexes on the surfaces of APCs. The failure of these strategies to enhance CTL induction in vivo provides an important caveat to this approach for enhancing immunity.

We have considered several potential explanations for the failure of enforced rapid degradation to enhance Gag-specific CTL responses in vivo. Recent studies have suggested that defective ribosomal initiation products (DriPs) may be a major source of antigenic peptides presented in association with MHC class I (3, 42, 43). One prediction of the proposition that DRiPs are a principal source of antigenic MHC class I peptides is that the targeting of fully translated proteins to the MHC class I processing pathway should result in only modest increases in the levels of antigenic peptide. However, when mature Gag-SIINFEKL fusion protein was targeted for rapid intracellular destruction, we observed substantial increases in the levels of MHC class I/SIINFEKL complexes on the surface of cells expressing the Ag (Fig. 2). Although details concerning the biogenesis of DRiPs remain unclear, it is assumed that they arise when translation fails to produce a full-length, correctly folded protein, producing instead a defective protein product that is subject to rapid destruction by the proteasome. It is generally thought that the majority of ribosomes scan from the 5' cap of a given mRNA, then translate a single ORF. It is thus conceivable that DRiP activity is focused around reading frames nearer the 5' end of an mRNA. Because the SIINFEKL epitope we have studied in this work was appended to the extreme C terminus of Gag, it is possible that the epitope resides in a portion of the mRNA that is relatively free from DRiP activity. It would thus be interesting to examine the MHC class I processing of epitopes located closer to the 5' end of rapidly degraded Ags.

During the primary response, the priming of CTLs has been demonstrated to proceed in a graded fashion with increasing levels of epitope density (17, 18, 44). However, excessive levels of epitope may not prime larger numbers of functional Ag-specific CTLs as measured by bulk CTL activity or by intracellular staining for IFN-{gamma} at the peak of the primary response ~1 wk after immunization (17, 18). In agreement with these previous findings, the immunization of mice with recombinant vaccinia expressing unstable Gag constructs that gave rise to higher levels of peptide-MHC class I complexes on the cell surface failed to generate larger primary CTL responses than control vaccinia expressing stable Gag (compare Figs. 2 and 4). The priming of naive T cells with supraoptimal epitope levels also appears to have consequences for the resultant memory cells. Bullock et al. (19) reported that priming with excessive levels of epitope generated memory CTLs of lower avidity. Furthermore, Wherry et al. (45) demonstrated that priming T cells in the presence of excessive levels of epitope subsequently led to a gradual reduction in numbers of functional antigenic-specific memory cells. This result was obtained using a model of vaccinia immunization that controls for the dose of total Ag available to other components of the immune system. We did not evaluate the long-term effects of immunizing mice with vaccinia expressing unstable Gag. However, it is interesting to note that in mice previously primed with plasmid DNA encoding stable Gag, eliciting a memory response by boosting with vaccinia expressing unstable Gag giving higher than normal levels of surface peptide-MHC class I complexes also led to a reduction in functional CTL activity (Figs. 5 and 6).

The poor CD8+ responses to rapidly degraded forms of Gag may be due to their failure to elicit strong CD4+ T cell responses. It is possible that targeting Ags to the MHC class I pathway may reduce the availability of the Ag for endosomal MHC class II processing and presentation to CD4+ T cells. CD4+ T cells provide help for CTLs by secreting cytokines such as IL-2 (46) and by delivering maturational signals in the form of CD40L-CD40 interactions to APCs that enable them to prime CTLs autonomously (47, 48, 49). It has also been shown that activated CD8+ T cells express CD40, permitting direct interactions with CD4+ T cells (50). Three recent papers have now clarified the role played by CD4+ T cell help in the generation of an effective memory CTL response (20, 21, 22). Cytokine secretion and cytolytic activity of CD8+ T cells during the primary response appear to be comparable irrespective of the presence or absence of CD4+ T cell help. During the memory response, however, the reactivation and proliferation of CD8+ CTLs as well as their ability to secrete effector cytokines such as IFN-{gamma} are critically dependent upon CD4+ T cell help previously delivered during the primary response. Thus, deficiencies in the MHC class II processing of rapidly degraded forms of Gag might explain their poor ability to subsequently generate robust memory CTL responses, particularly when unstable Gag is delivered in the form of a plasmid DNA prime bereft of T cell help directed at vaccinia-specific Ags (Fig. 7). Furthermore, this lack of help may compound the functional defect of memory CD8+ T cells primed in the presence of excessive levels of epitope described earlier, and explain why mice initially primed with plasmid DNA encoding unstable Gag exhibited such profound unresponsiveness when we attempted to elicit memory responses.

The susceptibility of APC to CTL killing during the development of an immune response is controversial, but might explain why challenging mice with vaccinia expressing rapidly degraded Gag led to poor memory responses. Some studies have suggested that the survival of APCs can be enhanced by the interaction of CD40 and CD40L (51), perhaps due to the acquisition of resistance to CTL-mediated killing (52). Other studies have demonstrated rapid in vivo clearance of APCs by CTLs, and postulate a role for this in the feedback regulation of an immune response (53, 54). In this second scenario, the faster appearance of Gag-derived peptides on surface class I molecules could have led to a more rapid clearance of cells infected with vaccinia expressing rapidly degraded forms of Gag. In other words, the rapid destruction of APCs infected with vShuf or vUbRgag in mice already primed by DNA vaccination against Gag (Figs. 5 and 6) might have resulted in diminished viral spread or reduced numbers of APCs for eliciting memory responses.

An additional consideration in assessing the utility of the degradation targeting strategy is the nature of the APC. A substantial body of evidence suggests that bone marrow-derived APCs are critical for the induction of CTL responses in vivo following DNA vaccination (55, 56) and viral infection (57). Ags that are initially expressed in cells lacking appropriate T cell costimulatory function can induce a CTL response through a cross-priming mechanism in which some form of the Ag is transferred to professional APCs (57). The mechanism of transfer is unclear, but in the case of virally infected cells it might involve uptake of Ag residing in apoptotic debris following the death of the infected cell (58). The degradation targeting strategies described in this work would be expected to be most effective in situations in which the cell that initially expressed the Ag is the same cell that presents Ag to CTL. If intact Ag has to be transferred, then forcing rapid degradation may actually be counterproductive. We and others have recently used a novel experimental approach for distinguishing direct priming from cross-priming in vivo (59, 60). This approach uses the human CMV proteins US2 and US11 to inhibit MHC class I-restricted Ag presentation in cells initially infected with recombinant vaccinia viruses carrying these genes, thereby functionally blocking direct priming, but not cross-priming. With this approach, we have shown that both direct and cross-priming are involved in the induction of vaccinia virus-specific CTL responses in vivo. Interestingly, the relative contribution of these two pathways depends on the site of infection. In i.p. infections, direct presentation predominated over cross-priming mechanisms. In light of these results, we have used i.p. infections in some of the experiments tested in this study. However, even with i.p. infections, we did not see a dramatic enhancement of CTL induction with rapidly degraded constructs.

Finally, it is possible that some difference in the overall kinetics of the response to rapidly degraded Ag prevented us from observing an enhancement in immunogenicity. However, within a period of 2–5 wk following initial priming with plasmid DNA, no differences in the relative memory responses to stable or unstable Gag were observed after challenge with recombinant vaccinia vectors in any of the experiments depicted in Figs. 5–7.

In summary, we have explored the utility of enforced rapid degradation strategies for inducing CTL responses to HIV-1 Gag. Although the strategies tested did increase the presentation of antigenic epitopes on the cell surface, and this increase was discernible by naive CD8+ T cells in vitro, immunization with unstable Gag constructs was not associated with a significant increase in the induction of CTL responses in vivo. These results highlight the complexities involved in the use of Ag-targeting strategies in vaccine design.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by Grant AI28108 from the National Institutes of Health. Back

2 S.B.J.W., C.B.B., and X.S. contributed equally to this work. Back

3 Address correspondence and reprint requests to Dr. Robert F. Siliciano, Department of Medicine, 871 BRB, Johns Hopkins University School of Medicine, 733 North Broadway Street, Baltimore, MD 21205. E-mail address: rsiliciano{at}jhmi.edu Back

4 Abbreviations used in this paper: ORF, open reading frame; DriP, defective ribosomal initiation product; EGFP, enhanced GFP; UCH, ubiquitin C-terminal hydrolase. Back

Received for publication July 9, 2003. Accepted for publication June 7, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Rodriguez, F., J. L. Whitton. 2000. Enhancing DNA immunization. Virology 268:233.[Medline]
  2. Rock, K. L., A. L. Goldberg. 1999. Degradation of cell proteins and the generation of MHC class I-presented peptides. Annu. Rev. Immunol. 17:739.[Medline]
  3. Yewdell, J. W.. 2001. Not such a dismal science: the economics of protein synthesis, folding, degradation and antigen processing. Trends Cell Biol. 11:294.[Medline]
  4. Bacik, I., J. H. Cox, R. Anderson, J. W. Yewdell, J. R. Bennink. 1994. TAP (transporter associated with antigen processing)-independent presentation of endogenously synthesized peptides is enhanced by endoplasmic reticulum insertion sequences located at the amino- but not carboxyl-terminus of the peptide. J. Immunol. 152:381.[Abstract]
  5. Leachman, S. A., M. Shylankevich, M. D. Slade, D. Levine, K. Sundaram, W. Xiao, M. Bryan, D. Zelterman, R. E. Tiegelaar, J. L. Brandsma. 2002. Ubiquitin-fused and/or multiple early genes from cottontail rabbit papillomavirus as DNA vaccines. J. Virol. 76:7616.[Abstract/Free Full Text]
  6. Restifo, N. P., I. Bacik, K. R. Irvine, J. W. Yewdell, B. J. McCabe, R. W. Anderson, L. C. Eisenlohr, S. A. Rosenberg, J. R. Bennink. 1995. Antigen processing in vivo and the elicitation of primary CTL responses. J. Immunol. 154:4414.[Abstract]
  7. Rodriguez, F., J. Zhang, J. L. Whitton. 1997. DNA immunization: ubiquitinization of a viral protein enhances cytotoxic T-lymphocyte induction and antiviral protection but abrogates antibody formation. J. Virol. 71:8497.[Abstract]
  8. Sykes, K. F., S. A. Johnston. 1999. Genetic live vaccines mimic the antigenicity but not pathogenicity of live viruses. DNA Cell Biol. 18:521.[Medline]
  9. Tobery, T., R. F. Siliciano. 1997. Targeting of HIV-1 antigens for rapid intracellular degradation enhances CTL recognition and the induction of de novo CTL responses in vivo following immunization. J. Exp. Med. 185:909.[Abstract/Free Full Text]
  10. Townsend, A., J. Bastin, K. Gould, G. Brownlee, M. Andrew, B. Coupar, D. Boyle, S. Chan, G. Smith. 1988. Defective presentation to class I-restricted cytotoxic T lymphocytes in vaccinia-infected cells is overcome by enhanced degradation of antigen. J. Exp. Med. 168:1211.[Abstract/Free Full Text]
  11. Wu, Y., T. J. Kipps. 1997. Deoxyribonucleic acid vaccines encoding antigens with rapid proteasome-dependent degradation are highly efficient inducers of cytolytic T lymphocytes. J. Immunol. 159:6037.[Abstract]
  12. Bu, Z., L. Ye, R. W. Compans, C. Yang. 2003. Enhanced cellular immune response against SIV Gag induced by immunization with DNA vaccines expressing assembly and release-defective SIV Gag proteins. Virology 309:272.[Medline]
  13. Michalek, M. T., E. P. Grant, K. L. Rock. 1994. Ubiquitin dependent and independent proteolytic pathways for MHC class I-restricted presentation of ovalbumin. FASEB J. 8:A747.
  14. Goth, S., V. Nguyen, N. Shastri. 1996. Generation of naturally processed peptide/MHC class I complexes is independent of the stability of endogenously synthesized precursors. J. Immunol. 157:1894.[Abstract]
  15. Kundu, S. K., T. C. Merigan. 1992. Equivalent recognition of HIV proteins, Env, Gag and Pol, by CD4+ and CD8+ cytotoxic T-lymphocytes. AIDS 6:643.[Medline]
  16. Vidalin, O., E. Tanaka, U. Spengler, C. Trepo, G. Inchauspe. 1999. Targeting of hepatitis C virus core protein for MHC I or MHC II presentation does not enhance induction of immune responses to DNA vaccination. DNA Cell Biol. 18:611.[Medline]
  17. Bullock, T. N. J., T. A. Colella, V. H. Engelhard. 2000. The density of peptides displayed by dendritic cells affects immune responses to human tyrosinase and gp100 in HLA-A2 transgenic mice. J. Immunol. 164:2354.[Abstract/Free Full Text]
  18. Wherry, E. J., K. A. Puorro, A. Porgador, L. C. Eisenlohr. 1999. The induction of virus-specific CTL as a function of increasing epitope expression: responses rise steadily until excessively high levels of epitope are attained. J. Immunol. 163:3735.[Abstract/Free Full Text]
  19. Bullock, T. N. J., D. W. Mullins, V. H. Engelhard. 2003. Antigen density presented by dendritic cells in vivo differentially affects the number and avidity of primary, memory, and recall CD8+ T cells. J. Immunol. 170:1822.[Abstract/Free Full Text]
  20. Janssen, E. M., E. E. Lemmens, T. Wolfe, U. Christen, M. G. von Herrath, S. P. Schoenberger. 2003. CD4+ T cells are required for secondary expansion and memory in CD8+ T lymphocytes. Nature 421:852.[Medline]
  21. Shedlock, D. J., H. Shen. 2003. Requirement for CD4 T cell help in generating functional CD8 T cell memory. Science 300:337.[Abstract/Free Full Text]
  22. Sun, J. C., M. J. Bevan. 2003. Defective CD8 T cell memory following acute infection without CD4 T cell help. Science 300:339.[Abstract/Free Full Text]
  23. Buck, C. B., X. Shen, M. A. Egan, T. C. Pierson, C. M. Walker, R. F. Siliciano. 2001. The human immunodeficiency virus type 1 gag gene encodes an internal ribosome entry site. J. Virol. 75:181.[Abstract/Free Full Text]
  24. Bachmair, A., A. Varshavsky. 1989. The degradation signal in a short-lived protein. Cell 56:1019.[Medline]
  25. Johnson, E. S., B. Bartel, W. Seufert, A. Varshavsky. 1992. Ubiquitin as a degradation signal. EMBO J. 11:497.[Medline]
  26. Yu, X., X. Yuan, Z. Matsuda, T.-H. Lee, M. Essex. 1992. The matrix protein of human immunodeficiency virus type 1 is required for incorporation of viral envelope protein into mature virions. J. Virol. 66:4966.[Abstract/Free Full Text]
  27. Moss, B., P. L. Earl. 1991. Expression of proteins in mammalian cells using vaccinia viral vectors. F. M. Ausubel, and R. Brent, and R. E. Kingston, and D. M. Moore, and J. G. Seidman, and J. A. Smith, and K. Struhl, eds. Current Protocols in Molecular Biology 16.15.1.-16.16.7. Wiley Interscience, New York.
  28. Porgador, A., J. W. Yewdell, Y. Deng, J. R. Bennink, R. N. Germain. 1997. Localization, quantitation, and in situ detection of specific peptide-MHC class I complexes using a monoclonal antibody. Immunity 6:715.[Medline]
  29. Mata, M., P. J. Travers, Q. Liu, F. R. Frankel, Y. Paterson. 1998. The MHC class I-restricted immune response to HIV-gag in BALB/c mice selects a single epitope that does not have a predictable MHC-binding motif and binds to Kd through interactions between a glutamine at P3 and pocket D. J. Immunol. 161:2985.[Abstract/Free Full Text]
  30. Li, X., X. Zhao, Y. Fang, X. Jiang, T. Duong, C. Fan, C. C. Huang, S. R. Kain. 1998. Generation of destabilized green fluorescent protein as a transcription reporter. J. Biol. Chem. 273:34970.[Abstract/Free Full Text]
  31. Scheffner, M., B. A. Werness, J. M. Huibregtse, A. J. Levine, P. M. Howley. 1990. The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell 63:1129.[Medline]
  32. Byrd, C., G. C. Turner, A. Varshavsky. 1998. The N-end rule pathway controls the import of peptides through degradation of a transcriptional repressor. EMBO J. 17:269.[Medline]
  33. Ferris, R. L., C. Buck, S. A. Hammond, A. S. Woods, R. J. Cotter, M. Takiguchi, Y. Igarashi, Y. Ichikawa, R. F. Siliciano. 1996. Class I-restricted presentation of an HIV-1 gp41 epitope containing an N-linked glycosylation site: implications for the mechanism of processing of viral envelope proteins. J. Immunol. 156:834.[Abstract]
  34. Freed, E. O., J. M. Orenstein, A. J. Buckler-White, M. A. Martin. 1994. Single amino acid changes in the human immunodeficiency virus type 1 matrix protein block virus particle production. J. Virol. 68:5311.[Abstract/Free Full Text]
  35. Bachmair, A., D. Finley, A. Varshavsky. 1986. In vivo half-life of a protein is a function of its amino-terminal residue. Science 234:179.[Abstract/Free Full Text]
  36. Varshavsky, A.. 1992. The N-end rule. Cell 69:725.[Medline]
  37. Dahlmann, B., M. Rutschmann, L. Kuehn, H. Reinauer. 1985. Activation of the multicatalytic proteinase from rat skeletal muscle by fatty acids or sodium dodecyl sulphate. Biochem. J. 228:171.[Medline]
  38. Hershko, A., E. Eytan, A. Ciechanover, A. L. Haas. 1982. Immunochemical analysis of the turnover of ubiquitin-protein conjugates in intact cells: relationship to the breakdown of abnormal proteins. J. Biol. Chem. 257:13964.[Abstract/Free Full Text]
  39. Wilkinson, K. D.. 1995. Roles of ubiquitinylation in proteolysis and cellular regulation. Annu. Rev. Nutr. 15:161.[Medline]
  40. Brander, C., B. D. Walker. 1995. HIV Molecular Immunology Database IV-1. Los Alamos National Laboratory, Los Alamos.
  41. Robinson, H. L.. 2002. New hope for an AIDS vaccine. Nat. Rev. Immunol. 2:239.[Medline]
  42. Princiotta, M. F., D. Finzi, S. B. Qian, J. Gibbs, S. Schuchmann, F. Buttgereit, J. R. Bennink, J. W. Yewdell. 2003. Quantitating protein synthesis, degradation, and endogenous antigen processing. Immunity 18:343.[Medline]
  43. Yewdell, J. W., L. C. Anton, J. R. Bennink. 1996. Defective ribosomal products (DRiPs): a major source of antigenic peptides for MHC class I molecules?. J. Immunol. 157:1823.[Abstract]
  44. Alexander, M. A., C. A. Damico, K. M. Wieties, T. H. Hansen, J. M. Connolly. 1991. Correlation between CD8 dependency and determinant density using peptide-induced, Ld-restricted cytotoxic T lymphocytes. J. Exp. Med. 173:849.[Abstract/Free Full Text]
  45. Wherry, E. J., M. J. McElhaugh, L. C. Eisenlohr. 2002. Generation of CD8+ T cell memory in response to low, high, and excessive levels of epitope. J. Immunol. 168:4455.[Abstract/Free Full Text]
  46. Keene, J. A., J. Forman. 1982. Helper activity is required for the in vivo generation of cytotoxic T lymphocytes. J. Exp. Med. 155:768.[Abstract/Free Full Text]
  47. Bennett, S. R., F. R. Carbone, F. Karamalis, R. A. Flavell, J. F. Miller, W. R. Heath. 1998. Help for cytotoxic-T-cell responses is mediated by CD40 signalling. Nature 393:478.[Medline]
  48. Ridge, J. P., F. Di Rosa, P. Matzinger. 1998. A conditioned dendritic cell can be a temporal bridge between a CD4+ T-helper and a T-killer cell. Nature 393:474.[Medline]
  49. Schoenberger, S. P., R. E. Toes, E. I. van der Voort, R. Offringa, C. J. Melief. 1998. T-cell help for cytotoxic T lymphocytes is mediated by CD40-CD40L interactions. Nature 393:480.[Medline]
  50. Bourgeois, C., B. Rocha, C. Tanchot. 2002. A role for CD40 expression on CD8+ T cells in the generation of CD8+ T cell memory. Science 297:2060.[Abstract/Free Full Text]
  51. Miga, A. J., S. R. Masters, B. G. Durell, M. Gonzalez, M. K. Jenkins, C. Maliszewski, H. Kikutani, W. F. Wade, R. J. Noelle. 2001. Dendritic cell longevity and T cell persistence is controlled by CD154-CD40 interactions. Eur. J. Immunol. 31:959.[Medline]
  52. Medema, J. P., D. H. Schuurhuis, D. Rea, J. van Tongeren, J. de Jong, S. A. Bres, S. Laban, R. E. Toes, M. Toebes, T. N. Schumacher, et al 2001. Expression of the serpin serine protease inhibitor 6 protects dendritic cells from cytotoxic T lymphocyte-induced apoptosis: differential modulation by T helper type 1 and type 2 cells. J. Exp. Med. 194:657.[Abstract/Free Full Text]
  53. Hermans, I. F., D. S. Ritchie, J. Yang, J. M. Roberts, F. Ronchese. 2000. CD8+ T cell-dependent elimination of dendritic cells in vivo limits the induction of antitumor immunity. J. Immunol. 164:3095.[Abstract/Free Full Text]
  54. Wong, P., E. G. Pamer. 2003. Feedback regulation of pathogen-specific T cell priming. Immunity 18:499.[Medline]
  55. Doe, B., M. Selby, S. Barnett, J. Baenziger, C. M. Walker. 1996. Induction of cytotoxic T lymphocytes by intramuscular immunization with plasmid DNA is facilitated by bone marrow-derived cells. Proc. Natl. Acad. Sci. USA 93:8578.[Abstract/Free Full Text]
  56. Pardoll, D. M., A. M. Beckerleg. 1995. Exposing the immunology of naked DNA vaccines. Immunity 3:165.[Medline]
  57. Sigal, L. J., S. Crotty, R. Andino, K. L. Rock. 1999. Cytotoxic T-cell immunity to virus-infected non-haematopoietic cells requires presentation of exogenous antigen. Nature 398:77.[Medline]
  58. Albert, M. L., B. Sauter, N. Bhardwaj. 1998. Dendritic cells acquire antigen from apoptotic cells and induce class I-restricted CTL. Nature 392:86.[Medline]
  59. Basta, S., W. Chen, J. R. Bennink, J. W. Yewdell. 2002. Inhibitory effects of cytomegalovirus proteins US2 and US11 point to contributions from direct priming and cross-priming in induction of vaccinia virus-specific CD8+ T cells. J. Immunol. 168:5403.[Abstract/Free Full Text]
  60. Shen, X., S. B. Wong, C. B. Buck, J. Zhang, R. F. Siliciano. 2002. Direct priming and cross-priming contribute differentially to the induction of CD8+ CTL following exposure to vaccinia virus via different routes. J. Immunol. 169:4222.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
A. Goldwich, S. S. C. Hahn, S. Schreiber, S. Meier, E. Kampgen, R. Wagner, M. B. Lutz, and U. Schubert
Targeting HIV-1 Gag into the Defective Ribosomal Product Pathway Enhances MHC Class I Antigen Presentation and CD8+ T Cell Activation
J. Immunol., January 1, 2008; 180(1): 372 - 382.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. N. Golovina, S. E. Morrison, and L. C. Eisenlohr
The Impact of Misfolding versus Targeted Degradation on the Efficiency of the MHC Class I-Restricted Antigen Processing
J. Immunol., March 1, 2005; 174(5): 2763 - 2769.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. B. J. Wong and R. F. Siliciano
Contribution of Virus-Like Particles to the Immunogenicity of Human Immunodeficiency Virus Type 1 Gag-Derived Vaccines in Mice
J. Virol., February 1, 2005; 79(3): 1701 - 1712.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wong, S. B. J.
Right arrow Articles by Siliciano, R. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wong, S. B. J.
Right arrow Articles by Siliciano, R. F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS