|
|
||||||||

* Department of Molecular Cell Biology and Immunology, Vrije University Medical Center, Amsterdam, The Netherlands;
MRC Human Immunology Unit, Weatherall Institute for Molecular Medicine, John Radcliffe Hospital, Headington, Oxford, United Kingdom
| Abstract |
|---|
|
|
|---|
receptor. However, the steps involved in the development of lymph nodes (LNs) are less clear than those of PPs, and the characteristics of the organizing cells within the LN anlagen have yet to be documented. In this study, we show for the first time that the early anlage is bordered by an endothelial layer that retains a mixed lymphatic and blood vascular phenotype up to embryonic day 16.5. This in turn encompasses CD45+CD4+CD3 cells interspersed with ICAM-1/VCAM-1/mucosal addressin cell adhesion molecule-1, lymphotoxin-
receptor-positive, chemokine-producing cells analogous to the organizing population previously observed in PPs. Moreover, these LN organizers also express the TNF family member, TRANCE. Lastly, we show that the ICAM-1/VCAM-1/mucosal addressin cell adhesion molecule-1 cells present in peripheral and mesenteric LN form two discrete populations expressing either intermediate or high levels of these adhesion molecules but that the former population is specifically reduced in PLN. These findings provide a possible explanation for the well-known differences in developmental requirements for nodes at peripheral or mesenteric locations. | Introduction |
|---|
|
|
|---|
Formation of the various lymphoid organs occurs after development of the tissue lymphatics by the action of CD45+CD4+CD3 cells (13, 14) that express surface bound lymphotoxin-
1
2 (LT), which engages the lymphotoxin-
receptor (LT
-R) on stromal cells and provides the inductive signal for tissue remodeling (3, 15, 16).
These CD45+CD4+CD3 cells, which arise from a multipotent precursor in the fetal liver (17, 18), have been shown to induce Peyers patches (PPs) (7) and nasal-associated lymphoid tissue (19, 20), and therefore they have been assumed to play a similar role in the generation of lymph nodes (LNs). The cross talk between CD45+CD4+CD3 cells and local mesenchymal cells is considered to be the driving force behind PP formation. The understanding of the earliest developmental stages during PP genesis has been significantly increased by whole mount in situ hybridization studies (1, 2, 3, 4, 5). VCAM-1- and ICAM-1-positive cells have been shown to cluster on the intestinal wall as early as E15.5. These adhesion molecules are expressed on mesenchymal cells, and are induced in a LT-dependent manner by IL-7R
+CD45+CD4+CD3 cells accumulating in the PP anlagen (1, 2, 3, 4, 5). From E18.5, mature lymphocytes start to colonize the PPs. The VCAM-1/ICAM-1 double-positive cells, which express the LT
-R and produce both CCL19 (ELC) and CXCL13 (BLC; Ref.3), have been denoted PP organizers, while the IL-7R
+LT+CD4+CD3 cells have been termed PP inducers.
In contrast to PPs, the level of understanding of LN development is sketchy. The relative inaccessibility of developing LN anlagen has hampered investigation into the earliest stages of development, although recently, whole-mount in situ hybridization studies tracing expression of the LT
-R have provided a first indication of the events underlying the initiation of LN formation during embryogenesis (21). In addition, whole-mount immunohistochemical analyses have allowed these events to be visualized in more detail (6). More recent, the first immunohistochemical visualizations of embryonic LN anlagen were described (22). As a result, it has become clear that in LN, as in PP, IL-7R
+ cells accumulate in the LN anlagen leading to local, LT-dependent expression of VCAM-1 (6), while also ICAM-1-expressing cells were present in the anlagen (22).
Despite the apparent similarities in the development of LNs and PPs, conclusive data on the cellular make-up of the LN anlage is limited (22). It is also not clear whether LN anlagen contains a cell population functionally homologous to the mesenchymal PP organizers. Moreover, data from different gene-targeted mice suggest a previously unappreciated complexity within the developmental pathway of individual LNs. In several mouse models, like the LT
/ and the CXCL13/ or CXCR5/ mice, different requirements were observed for the presence of the mesenteric LNs (MLNs) vs the majority of peripheral LNs (PLNs; Refs.3 , 23 , and 24).
In this study, we describe in detail the cellular make-up of LN anlagen in murine embryos. We demonstrate for the first time that phenotypic and functional homologues to the PP organizers are indeed present in LNs, and present new evidence that differences in subpopulations of these cells in PLNs and MLNs may explain the observed dichotomy in development of these two LN systems.
| Materials and Methods |
|---|
|
|
|---|
C57BL/6 mice were purchased from Harlan (Horst, The Netherlands) and kept under routine laboratory conditions.
Timed pregnancies
Mice were mated overnight, and the day of vaginal-plug detection was marked as E0.5. Pregnant females were sacrificed at different time points, and embryos were harvested and either frozen directly in OCT compound for TRANCE visualization, or fixed in 4% formaldehyde for 3 h and transferred to a 20% (w/v) sucrose solution in PBS. The following day, animals were frozen in OCT compound.
Immunofluorescence microscopy
Six-micrometer cryosections were fixed in dehydrated acetone for 2 min and air-dried for an additional 15 min. Endogenous avidin was blocked with an avidin-biotin block (Vector Laboratories, Burlingame, CA) supplemented with 10% (v/v) mouse serum and 10% (v/v) goat serum. Sections were incubated with primary Ab for 1 h at room temperature followed by a 30 min incubation with Fluor-Alexa-labeled conjugate (Molecular Probes, Eugene, OR) when needed. Sections were embedded in Fluorstab (ICN Biomedicals, Aurora, OH) and analyzed on a Nikon Eclipse E800 microscope (Nikon Europe, Haarlem, The Netherlands).
Flow cytometry and cell sorting
LN rudiments were dissected using a stereomicroscope, and single cell suspensions were made by digestion with 0.5 mg/ml collagenase type IV (Sigma-Aldrich, St. Louis, MO) in PBS, 2% FBS for 30 min at 37°C with constant stirring. Flow cytometric analysis was performed on a FACSCalibur (BD Biosciences, San Jose, CA) and cell sorting was performed on a MoFlo (DakoCytomation, Glostrup, Denmark)
Antibodies
For immunohistology and flow cytometry, the following Abs were used: GK1.5 (anti-CD4); MECA-367 (anti-mucosal addressin cell adhesion molecule-1 (MAdCAM-1)); 6B2 (anti-B220); MP33 (anti-CD45); and anti-ICAM-1 (BD Pharmingen, San Diego, CA). All the Abs were affinity purified from hybridoma cell culture supernatants with protein G-Sepharose (Pharmacia, Uppsala, Sweden) and labeled with Alexa-Fluor 488 or Alexa-Fluor 594 (Molecular Probes). The mAbs A7R34 (anti-IL-7R
; eBioscience, San Diego, CA) and 429 (anti-VCAM-1, BD Pharmingen) were labeled with biotin, whereas MECA-32, 11D4.1 (anti-vascular endothelial-cadherin (VE-cadherin) and CD144; BD Pharmingen), 4H8Wh2 (anti-LT
-R; Alexis Biochemicals, Lausen, Switzerland), and IK22/5 (anti-TRANCE, e-Bioscience) were used without conjugation. The rabbit polyclonal Ab to human Lyve-1 has been described previously (25). For fluorescence microscopy, primary Abs were visualized with Alexa-Fluor 594-labeled Avidin, Alexa Fluor 594-labeled anti-rat IgG, Texas Red, or FITC-labeled anti-rabbit IgG as appropriate. To assure specificity of the used Abs, isotype control primary Abs, as well as conjugate-alone controls, were used. In the case of Lyve-1, total rabbit serum was used as the control (data not shown).
Real-time quantitative PCR
RNA was extracted from sorted MLN populations using TRIzol (Invitrogen Life Technologies, Gaithersburg, MD), and reverse transcribed with oligo(dT)1218 (Life Technologies) and random hexamer primers (Invitrogen Life Technologies) using standard protocols. Quantitative real-time PCR was performed on an ABI Prism 7900 Sequence Detection System (Applied Biosystems, Foster City, CA). The reaction mixture was composed of SYBR Green Mastermix, 300 nM of each primer, and cDNA in a total volume of 20 µl, according to the manufacturers instructions. Primers were designed using Primer Express software and guidelines (Applied Biosystems). The following sequences were used: CXCL13 forward, CATAGATCGGATTCAAGTTACGCC, and reverse, TCTTGGTCCAGATCACAACTTCA; CCL21 forward, GCTGCAAGAGAACTGAACAGACA, and reverse, CGTGAACCACCCAGCTTGA; CCL19 forward, ATGCGGAAGACTGCTGCC, and reverse, AGCGGAAGGCTTTCACGAT.
| Results |
|---|
|
|
|---|
To carry out a detailed immunohistochemical analysis of the developing murine LN anlagen and its constituent cell populations, we prepared serial transverse cryo-sections of whole embryos at E16.5, the stage at which development of most LNs is already initiated (15, 16, 22). At putative sites of LN development, cell clusters consisting of mainly CD4+ cells could be detected (Fig. 1A). These CD4+ cells were CD45+ and CD3 (data not shown), consistent with the absence of mature 
TCR+ T cells in the prenatal murine immune system, and were found in close association with cells expressing the mucosal addressin, MAdCAM-1 (Fig. 1B). In Fig. 1A, CD45+CD4+CD3 cells can be seen clustering near the aortic wall (visible on the left), a site of presumed sacral/iliac LN development. Fig. 1B shows a high power magnification of a LN anlage at a brachial LN location. Although abundant MAdCAM-1 staining was detected, careful morphological analysis failed to identify high endothelial venules at E16.5, suggesting that the initial migration of hemopoietic cells to the LN anlagen precedes the formation of these specialized structures.
|
+ cells emigrating from the fetal liver, which differentiate into CD45+CD4+CD3 cells (6, 17, 22). To study the spectrum of hemopoietic cells present within the developing LN, E16.5 LN anlagen were analyzed for expression of the IL-7R
chain, in combination with various lineage markers (Fig. 1, CE, shows an inguinal LN anlage, while Fig. 1F depicts a sacral/iliac LN anlage). As expected, the majority of IL-7R
+ cells in the early LN anlagen expressed the hemopoietic marker CD45 (Fig. 1C; Ref.22). CD45+CD4+CD3 cells would be predicted to form a large proportion of the hemopoietic cells at this time point, and indeed most of the IL-7R
+ cells coexpressed CD4, although an IL-7R
+CD4 population was also present (Fig. 1D). This remaining CD4 IL-7R
+ population likely contains IL-7R
+ fetal liver-derived precursors to CD45+CD4+CD3 cells. In addition, B220 expressing IL-7R
+ cells were also present in the LN anlagen, albeit in very low numbers (Fig. 1E). It remains to be determined whether these B220+ cells are B cells, or an additional precursor population. Finally, groups of both CD4+ and CD4 cells among the CD45+CD3 cell population also expressed the Ig superfamily adhesion molecule, ICAM-1 (Fig. 1F). As the latter may well be the immediate precursors to the CD45+CD4+CD3-inducer cell population, it is possible that the expression of ICAM-1 is involved in recruitment or retention of these precursors within the LN anlagen.
The LN anlagen are bordered by differentiating lymphatic endothelium
The lymphatic endothelium of embryonic LNs is generated from local blood vessel-endothelial cells that are induced to differentiate toward a lymphatic phenotype. In the E16.5 LN anlagen, both at mesenteric and peripheral locations (Figs. 2AH, and IJ, respectively), the most distal cell layer consists of cells expressing the lymphatic endothelium specific hyaluronan receptor Lyve-1 (Fig. 2, B and I; Refs.25 and 26). A large portion of this lymphatic endothelium coexpresses MAdCAM-1 (Fig. 2, B and I), while several cells also stain positive for the junctional adhesion molecule, VE-cadherin (Fig. 2, CE), which is expressed on both blood vessel- and lymphatic endothelium (27). However, in contrast to the situation in adult animals, lymphatic endothelium at E16.5 also shows expression of the blood vessel endothelial restricted marker MECA-32 (Figs. 2, FH and J; Ref.28). These data demonstrate that at E16.5, the endothelial cells which line the PLN as well as MLN anlagen, are undergoing phenotypic changes, converting from blood vessel endothelium to lymphatic endothelial cells.
|
Previous studies of fetal intestines identified a population of VCAM-1/ICAM-1/MAdCAM-1-positive cells that was proposed to act as PP organizers by expressing adhesion molecules and homeostatic chemokines upon LT
-R triggering (2, 3, 4, 6). In search of a similar population in developing LNs, we assessed the expression of adhesion molecules in E16.5 LN anlagen. Fig. 3, A and B, show a representative example of a MLN anlage, while Fig. 3, C and D, display an anlage at a peripheral location, situated adjacent to one of the large vessels (left side of picture). The MAdCAM-1+ cells within the LN anlagen showed coexpression of VCAM-1 (Fig. 3, A and C) as well as ICAM-1 (Fig. 3, B and D), thus identifying these cells as the LN equivalent of the PP organizing cells in fetal intestine (1, 3, 4). ICAM-1+VCAM-1+MAdCAM-1+ (IVM+) cells were concentrated in a polarized fashion in the outer regions of the LN anlagen (Fig. 3, A, B, D, and E). In addition, VCAM-1+ICAM-1+MAdCAM-1 cells were present in the deeper regions of the LN anlagen. These VCAM-1+ LN-organizer cells also expressed the TNF family member, TRANCE (Fig. 3, EG). In fact, throughout the embryo, TRANCE expression was only observed in the developing LNs and bones (data not shown). TRANCE was previously implied in regulating the number of CD45+CD4+CD3 cells in developing LN-nodes (29), and the fact that we now show abundant expression of TRANCE within the LN anlagen, would suggest a role for this molecule in local differentiation of CD45+CD4+CD3 cells.
|
ICAM-1/VCAM-1/MAdCAM-1 triple-positive cells in the developing PPs exert their function through the production of chemokines upon ligation of the LT
-R (3). To determine whether similar functions could be fulfilled by the IVM+ putative LN organizers, MLN anlagen were dissected at E16.5 and at day of birth, and analyzed by flow cytometry (Fig. 4). Based upon expression of ICAM-1, VCAM-1, and MAdCAM-1, two different populations of IVM+ cells could be observed, both at E16.5 and day of birth (Fig. 4, A and D). The largest population expresses all three adhesion molecules at intermediate levels (IVMint; Fig. 4, A, B, D, and E, R2). An additional, clearly distinct, smaller population expresses high levels of IVM (IVMhigh) (Fig. 4, A, B, D, and E, R3), and this population resembles the previously described organizing population in the PPs (3, 30). Furthermore, both populations displayed expression of the LT
-R, further supporting the likelihood that they represent LN organizers analogous to those present in developing PPs. However, surprisingly, the IVMint population expressed higher levels of LT
-R than the IVMhigh cells (Fig. 4, C and F).
|
-actin (or cyclophilin, data not shown) both the IVMhigh and IVMint populations in the MLN anlagen produced mRNA for the homeostatic chemokines CXCL13, CCL21, and CCL19. However, IVMhigh cells clearly contained higher levels of chemokine mRNA. As a control, the IVM, LT
-R-negative population did not produce any of the homeostatic chemokines (data not shown). These data identify the IVMhigh and IVMint populations as functional LN organizers.
|
Different requirements exist for the generation of PLNs and MLNs. Several gene-targeted mice lack one or more PLNs, while MLN formation is unaffected. Because the mechanism underlying this difference is unknown, we set out to analyze the LN organizers in both PLNs and MLNs at day of birth. Both sets of LNs were found to contain the IVMint and IVMhigh populations of LN organizers (Fig. 6A), with highest levels of MAdCAM-1 on the IVMhigh cells (Fig. 6B). Strikingly however, the IVMint population was severely diminished in PLNs compared with MLNs (
10-fold reduction) while the IVMhigh population showed only a slight decrease. As a result, the ratio of IVMhigh/IVMint cells, which in the MLN ranged from 0.1 to 0.4, was in the PLN completely opposite, ranging from 1 to 1.9.
|
-R was analyzed. In line with MLN organizers, IVMint and IVMhigh cells from PLNs expressed the LT
-R (Fig. 6C). Levels of LT
-R were again highest in the IVMint population, indicating that comparable populations of organizers are present in the PLNs and MLNs.
As the IVMint population in MLNs is by far the most prevalent in terms of absolute cell numbers (on average 10-fold more cells then the IVMhigh, data not shown), and because these express the highest levels of LT
-R, their virtual absence from PLN may well explain why these particular nodes have different signaling requirements to MLN during embryonic development.
| Discussion |
|---|
|
|
|---|
Inward from the layer of VCAM-1/ICAM-1/MAdCAM-1 triple-positive cells, mostly VCAM-1 and ICAM-1 single-positive cells were found to extend into the deeper regions of the developing LN. A fraction of the single ICAM-1+ cells are CD45+CD4+CD3 cells, and the expression of ICAM-1 on these cells may well have a function in the clustering of these cells in the LN anlage. However, because LN development is normal in mice that lack the ICAM-1 ligand, LFA-1 (31), it is likely that there is redundancy among the adhesion molecules that fulfill this function.
Our studies also show that CD45+CD4+CD3 cells in the LN anlage express the IL-7R
chain (32). However, not all IL-7R
+ cells expressed CD4, indicative of the fact that the direct precursor to CD45+CD4+CD3 cells, an IL-7R
+ population derived from the fetal liver (17, 18), might also lodge in these LN anlagen. One of the factors responsible for the accumulation of CD45+CD4+CD3 cells in the LN anlagen is TRANCE, because mice with deficient TRANCE-signaling have severely diminished numbers of CD45+CD4+CD3 cells in these anlagen (6, 22, 29). In this study, we show that expression of TRANCE is restricted to the LN anlagen, suggesting that TRANCE acts locally to either recruit, mediate survival, or induce differentiation of CD45+CD4+CD3 cells. TRANCE was previously shown to be present on CD45+CD4+CD3 cells, while the TRANCE-R is expressed by both CD45+CD4+CD3 and CD45+CD4CD3 cells (29), but now we show that TRANCE is also expressed on VCAM-1+ LN-organizing cells within the LN anlagen. This nonhemopoietic expression of TRANCE could thus further explain the inability to completely rescue the phenotype of the TRANCE/ mice by hemopoietic cell-specific transgenic TRANCE overexpression (29).
Dissection of PLN and MLN from newborn and embryonic animals provided us with the opportunity to study the properties of the IVM+ cells constituting the presumptive LN organizers. Flow cytometric analysis of both MLNs and PLNs revealed the presence of two populations of IVM cells: IVMint and IVMhigh cells. Both populations expressed the LT
-R, and are, therefore, phenotypically homologous to the previously described PP organizers. The IVMint and IVMhigh cells produced mRNA for CXCL13, CCL21, and CCL19, confirming that these are the functional counterparts of PP organizing cells (3).
The development of LNs at either peripheral or mesenteric sites is known to be regulated by distinct signals. For example, targeted deletion of either LT
, components of the IL-7R signaling complex, or the CXCL13/CXCR5 pair disrupts development of PLNs but has little or no effect on the development of MLNs (3, 23, 24). The cellular basis for such differences has until now remained unclear. However, our finding in this manuscript that PLN anlagen differ markedly from MLN anlagen in the relative abundance of IVMint cells may provide an explanation for this discrepancy. Because IVMint cells are the organizing population that expresses the highest levels of LT
-R, the decrease of these cells in PLNs could proof to be a limiting factor for PLN development in case of suboptimal LT
-R stimulation, for instance in the absence of LT
, IL-7R triggering, or CXCR5 triggering. In LT
/ mice, a role was postulated for LT
-R triggering via LT
and homologous to lymphotoxins, exhibits inducible expression, and competes with HSV glycoprotein D, for HVEM, a receptor expressed by T lymphocytes (LIGHT) (33). However, this is likely to be a less potent signal then LT, reducing the level of LT
-R triggering. Furthermore, in the absence of IL-7R ligation, TRANCE-R signaling is still able to induce surface LT on inducer cells (6). However, if a reduction in LT-inducing signals leads to a lower number of cells that initiate expression of LT, again LT
-R levels could become limited. The same, of course, holds true for the CXCL13/CXCR5 signaling pathway, which controls the accumulation of LT-expressing inducer cells at sites of LN development (3, 13, 32).
In summary, developing LN anlagen contain two distinct populations of organizing cells that express the LT
-R, adhesion molecules ICAM-1, VCAM-1, and MAdCAM-1, and produce CXCL13, CCL21, and CCL19. In PLNs, the number of organizing cells is greatly diminished, with the LT
-RhighIVMint population being most severely reduced. This leads to distinct stromal microenvironments in PLN and MLN anlagen, providing an explanation for the divergent developmental requirements observed for these two LN systems.
| Footnotes |
|---|
1 T.C. and M.F.R.V. were financially supported by The Netherlands Organization for Scientific Research. ![]()
2 T.C. and M.F.R.V. contributed equally to this manuscript. ![]()
3 Address correspondence and reprint requests to Dr. Reina E. Mebius, Vrije University Medical Center, Faculty of Medicine, P.O. Box 7057, 1007 MB Amsterdam, The Netherlands. E-mail address: r.mebius{at}vumc.nl ![]()
4 Abbreviations used in this paper used: E, embryonic day; Lyve-1, lymphatic endothelium-restricted hyaluronan receptor-1; LT, lymphotoxin-
1
2; PP, Peyers patch; LN, lymph node; PLN, peripheral LN; MLN, mesenteric LN; LT
-R, lymphotoxin-
receptor; MAdCAM-1, mucosal addressin cell adhesion molecule-1; IVM+, ICAM-1+VCAM-1+MAdCAM-1+; VE-cadherin, vascular endothelial-cadherin. ![]()
Received for publication January 21, 2004. Accepted for publication June 18, 2004.
| References |
|---|
|
|
|---|
+ CD3 cells in the embryonic intestine induces the organizing center of Peyers patches. Int. Immunol. 11:643.
in the formation of Peyers patch anlage. Int. Immunol. 10:1.
on IL-7 receptor-
cells that differentially engender lymph nodes and Peyers patches. Immunity 17:823.[Medline]
4
1 integrin activation by CXCR5. Immunity 17:363.[Medline]
+ cells that can differentiate to APC, NK cells, and follicular cells but not T or B cells. Immunity 7:493.[Medline]
/
complex is required for the development of peripheral lymphoid organs. J. Exp. Med. 184:1999.
receptor. Immunity 9:71.[Medline]
4
7 integrin defines a distinct pathway of lymphoid progenitors committed to T cells, fetal intestinal lymphotoxin producer, NK, and dendritic cells. J. Immunol. 167:2511.
(LT
) and retinoic acid receptor-related orphan receptor-
, but the organization of NALT is LT
dependent. J. Immunol. 168:986.
R, and NIK signaling pathways but requires the Id2 gene and CD3CD4+CD45+ cells. Immunity 17:31.[Medline]
and lymphotoxin-
receptor expression in mouse embryos. J. Immunol. 168:5079.
(t) in the generation of fetal lymphoid tissue inducer cells. Nat. Immunol. 5:64.[Medline]
and
revealed in lymphotoxin
-deficient mice. Immunity 6:491.[Medline]
, and CCR7 ligands in lymph node development. J. Exp. Med. 197:1191.
in mesenteric lymph node genesis. J. Exp. Med. 195:1613.This article has been cited by other articles:
![]() |
M. F. R. Vondenhoff, G. E. Desanti, T. Cupedo, J. Y. Bertrand, A. Cumano, G. Kraal, R. E. Mebius, and R. Golub Separation of splenic red and white pulp occurs before birth in a LT{alpha}{beta}-independent manner J. Leukoc. Biol., July 1, 2008; 84(1): 152 - 161. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. White, D. Carragher, S. Parnell, A. Msaki, N. Perkins, P. Lane, E. Jenkinson, G. Anderson, and J. H. Caamano Lymphotoxin a-dependent and -independent signals regulate stromal organizer cell homeostasis during lymph node organogenesis Blood, September 15, 2007; 110(6): 1950 - 1959. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Okuda, A. Togawa, H. Wada, and S.-i. Nishikawa Distinct Activities of Stromal Cells Involved in the Organogenesis of Lymph Nodes and Peyer's Patches J. Immunol., July 15, 2007; 179(2): 804 - 811. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. T. Taylor, S. R. Patel, E. Lin, B. R. Butler, J. G. Lake, R. D. Newberry, and I. R. Williams Lymphotoxin-Independent Expression of TNF-Related Activation-Induced Cytokine by Stromal Cells in Cryptopatches, Isolated Lymphoid Follicles, and Peyer's Patches J. Immunol., May 1, 2007; 178(9): 5659 - 5667. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Coles, H. Veiga-Fernandes, K. E. Foster, T. Norton, S. N. Pagakis, B. Seddon, and D. Kioussis Role of T and NK cells and IL7/IL7r interactions during neonatal maturation of lymph nodes PNAS, September 5, 2006; 103(36): 13457 - 13462. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kanemitsu, Y. Ebisuno, T. Tanaka, K. Otani, H. Hayasaka, T. Kaisho, S. Akira, K. Katagiri, T. Kinashi, N. Fujita, et al. CXCL13 is an arrest chemokine for B cells in high endothelial venules Blood, October 15, 2005; 106(8): 2613 - 2618. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Cupedo and R. E. Mebius Cellular Interactions in Lymph Node Development J. Immunol., January 1, 2005; 174(1): 21 - 25. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |