The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cupedo, T.
Right arrow Articles by Mebius, R. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cupedo, T.
Right arrow Articles by Mebius, R. E.
The Journal of Immunology, 2004, 173: 2968-2975.
Copyright © 2004 by The American Association of Immunologists

Presumptive Lymph Node Organizers are Differentially Represented in Developing Mesenteric and Peripheral Nodes1

Tom Cupedo2,*, Mark F. R. Vondenhoff2,*, Edwin J. Heeregrave*, Anna E. de Weerd*, Wendy Jansen*, David G. Jackson{dagger}, Georg Kraal* and Reina E. Mebius3,*

* Department of Molecular Cell Biology and Immunology, Vrije University Medical Center, Amsterdam, The Netherlands; {dagger} MRC Human Immunology Unit, Weatherall Institute for Molecular Medicine, John Radcliffe Hospital, Headington, Oxford, United Kingdom


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
During murine embryogenesis, the formation of Peyer’s patches (PPs) is initiated by CD45+CD4+CD3 lymphoid tissue inducers that trigger adhesion molecule expression and specific chemokine production from an organizing stromal cell population through ligation of the lymphotoxin-{beta} receptor. However, the steps involved in the development of lymph nodes (LNs) are less clear than those of PPs, and the characteristics of the organizing cells within the LN anlagen have yet to be documented. In this study, we show for the first time that the early anlage is bordered by an endothelial layer that retains a mixed lymphatic and blood vascular phenotype up to embryonic day 16.5. This in turn encompasses CD45+CD4+CD3 cells interspersed with ICAM-1/VCAM-1/mucosal addressin cell adhesion molecule-1, lymphotoxin-{beta} receptor-positive, chemokine-producing cells analogous to the organizing population previously observed in PPs. Moreover, these LN organizers also express the TNF family member, TRANCE. Lastly, we show that the ICAM-1/VCAM-1/mucosal addressin cell adhesion molecule-1 cells present in peripheral and mesenteric LN form two discrete populations expressing either intermediate or high levels of these adhesion molecules but that the former population is specifically reduced in PLN. These findings provide a possible explanation for the well-known differences in developmental requirements for nodes at peripheral or mesenteric locations.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The correct generation of secondary lymphoid organs requires a high degree of cross-talk between local mesenchymal cells and circulating hemopoietic cells (1, 2, 3, 4, 5, 6, 7). Formation of the tissue lymphatic vasculature during murine embryogenesis is initiated at embryonic day 10.5 (E10.5)4 by budding from the larger veins, establishing a primordial lymph sac (8, 9, 10, 11). Among the first markers to be expressed on the developing lymphatic endothelium are the homeobox gene Prox-1 (11, 12) and the lymphatic endothelium-restricted hyaluronan receptor Lyve-1, both of which become restricted to the lymphatics by E15.5.

Formation of the various lymphoid organs occurs after development of the tissue lymphatics by the action of CD45+CD4+CD3 cells (13, 14) that express surface bound lymphotoxin-{alpha}1{beta}2 (LT), which engages the lymphotoxin-{beta} receptor (LT{beta}-R) on stromal cells and provides the inductive signal for tissue remodeling (3, 15, 16).

These CD45+CD4+CD3 cells, which arise from a multipotent precursor in the fetal liver (17, 18), have been shown to induce Peyer’s patches (PPs) (7) and nasal-associated lymphoid tissue (19, 20), and therefore they have been assumed to play a similar role in the generation of lymph nodes (LNs). The cross talk between CD45+CD4+CD3 cells and local mesenchymal cells is considered to be the driving force behind PP formation. The understanding of the earliest developmental stages during PP genesis has been significantly increased by whole mount in situ hybridization studies (1, 2, 3, 4, 5). VCAM-1- and ICAM-1-positive cells have been shown to cluster on the intestinal wall as early as E15.5. These adhesion molecules are expressed on mesenchymal cells, and are induced in a LT-dependent manner by IL-7R{alpha}+CD45+CD4+CD3 cells accumulating in the PP anlagen (1, 2, 3, 4, 5). From E18.5, mature lymphocytes start to colonize the PPs. The VCAM-1/ICAM-1 double-positive cells, which express the LT{beta}-R and produce both CCL19 (ELC) and CXCL13 (BLC; Ref.3), have been denoted PP organizers, while the IL-7R{alpha}+LT+CD4+CD3 cells have been termed PP inducers.

In contrast to PPs, the level of understanding of LN development is sketchy. The relative inaccessibility of developing LN anlagen has hampered investigation into the earliest stages of development, although recently, whole-mount in situ hybridization studies tracing expression of the LT{beta}-R have provided a first indication of the events underlying the initiation of LN formation during embryogenesis (21). In addition, whole-mount immunohistochemical analyses have allowed these events to be visualized in more detail (6). More recent, the first immunohistochemical visualizations of embryonic LN anlagen were described (22). As a result, it has become clear that in LN, as in PP, IL-7R{alpha}+ cells accumulate in the LN anlagen leading to local, LT-dependent expression of VCAM-1 (6), while also ICAM-1-expressing cells were present in the anlagen (22).

Despite the apparent similarities in the development of LNs and PPs, conclusive data on the cellular make-up of the LN anlage is limited (22). It is also not clear whether LN anlagen contains a cell population functionally homologous to the mesenchymal PP organizers. Moreover, data from different gene-targeted mice suggest a previously unappreciated complexity within the developmental pathway of individual LNs. In several mouse models, like the LT{beta}–/– and the CXCL13–/– or CXCR5–/– mice, different requirements were observed for the presence of the mesenteric LNs (MLNs) vs the majority of peripheral LNs (PLNs; Refs.3 , 23 , and 24).

In this study, we describe in detail the cellular make-up of LN anlagen in murine embryos. We demonstrate for the first time that phenotypic and functional homologues to the PP organizers are indeed present in LNs, and present new evidence that differences in subpopulations of these cells in PLNs and MLNs may explain the observed dichotomy in development of these two LN systems.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

C57BL/6 mice were purchased from Harlan (Horst, The Netherlands) and kept under routine laboratory conditions.

Timed pregnancies

Mice were mated overnight, and the day of vaginal-plug detection was marked as E0.5. Pregnant females were sacrificed at different time points, and embryos were harvested and either frozen directly in OCT compound for TRANCE visualization, or fixed in 4% formaldehyde for 3 h and transferred to a 20% (w/v) sucrose solution in PBS. The following day, animals were frozen in OCT compound.

Immunofluorescence microscopy

Six-micrometer cryosections were fixed in dehydrated acetone for 2 min and air-dried for an additional 15 min. Endogenous avidin was blocked with an avidin-biotin block (Vector Laboratories, Burlingame, CA) supplemented with 10% (v/v) mouse serum and 10% (v/v) goat serum. Sections were incubated with primary Ab for 1 h at room temperature followed by a 30 min incubation with Fluor-Alexa-labeled conjugate (Molecular Probes, Eugene, OR) when needed. Sections were embedded in Fluorstab (ICN Biomedicals, Aurora, OH) and analyzed on a Nikon Eclipse E800 microscope (Nikon Europe, Haarlem, The Netherlands).

Flow cytometry and cell sorting

LN rudiments were dissected using a stereomicroscope, and single cell suspensions were made by digestion with 0.5 mg/ml collagenase type IV (Sigma-Aldrich, St. Louis, MO) in PBS, 2% FBS for 30 min at 37°C with constant stirring. Flow cytometric analysis was performed on a FACSCalibur (BD Biosciences, San Jose, CA) and cell sorting was performed on a MoFlo (DakoCytomation, Glostrup, Denmark)

Antibodies

For immunohistology and flow cytometry, the following Abs were used: GK1.5 (anti-CD4); MECA-367 (anti-mucosal addressin cell adhesion molecule-1 (MAdCAM-1)); 6B2 (anti-B220); MP33 (anti-CD45); and anti-ICAM-1 (BD Pharmingen, San Diego, CA). All the Abs were affinity purified from hybridoma cell culture supernatants with protein G-Sepharose (Pharmacia, Uppsala, Sweden) and labeled with Alexa-Fluor 488 or Alexa-Fluor 594 (Molecular Probes). The mAbs A7R34 (anti-IL-7R{alpha}; eBioscience, San Diego, CA) and 429 (anti-VCAM-1, BD Pharmingen) were labeled with biotin, whereas MECA-32, 11D4.1 (anti-vascular endothelial-cadherin (VE-cadherin) and CD144; BD Pharmingen), 4H8Wh2 (anti-LT{beta}-R; Alexis Biochemicals, Lausen, Switzerland), and IK22/5 (anti-TRANCE, e-Bioscience) were used without conjugation. The rabbit polyclonal Ab to human Lyve-1 has been described previously (25). For fluorescence microscopy, primary Abs were visualized with Alexa-Fluor 594-labeled Avidin, Alexa Fluor 594-labeled anti-rat IgG, Texas Red, or FITC-labeled anti-rabbit IgG as appropriate. To assure specificity of the used Abs, isotype control primary Abs, as well as conjugate-alone controls, were used. In the case of Lyve-1, total rabbit serum was used as the control (data not shown).

Real-time quantitative PCR

RNA was extracted from sorted MLN populations using TRIzol (Invitrogen Life Technologies, Gaithersburg, MD), and reverse transcribed with oligo(dT)12–18 (Life Technologies) and random hexamer primers (Invitrogen Life Technologies) using standard protocols. Quantitative real-time PCR was performed on an ABI Prism 7900 Sequence Detection System (Applied Biosystems, Foster City, CA). The reaction mixture was composed of SYBR Green Mastermix, 300 nM of each primer, and cDNA in a total volume of 20 µl, according to the manufacturer’s instructions. Primers were designed using Primer Express software and guidelines (Applied Biosystems). The following sequences were used: CXCL13 forward, CATAGATCGGATTCAAGTTACGCC, and reverse, TCTTGGTCCAGATCACAACTTCA; CCL21 forward, GCTGCAAGAGAACTGAACAGACA, and reverse, CGTGAACCACCCAGCTTGA; CCL19 forward, ATGCGGAAGACTGCTGCC, and reverse, AGCGGAAGGCTTTCACGAT.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of LN anlagen

To carry out a detailed immunohistochemical analysis of the developing murine LN anlagen and its constituent cell populations, we prepared serial transverse cryo-sections of whole embryos at E16.5, the stage at which development of most LNs is already initiated (15, 16, 22). At putative sites of LN development, cell clusters consisting of mainly CD4+ cells could be detected (Fig. 1A). These CD4+ cells were CD45+ and CD3 (data not shown), consistent with the absence of mature {alpha}{beta}TCR+ T cells in the prenatal murine immune system, and were found in close association with cells expressing the mucosal addressin, MAdCAM-1 (Fig. 1B). In Fig. 1A, CD45+CD4+CD3 cells can be seen clustering near the aortic wall (visible on the left), a site of presumed sacral/iliac LN development. Fig. 1B shows a high power magnification of a LN anlage at a brachial LN location. Although abundant MAdCAM-1 staining was detected, careful morphological analysis failed to identify high endothelial venules at E16.5, suggesting that the initial migration of hemopoietic cells to the LN anlagen precedes the formation of these specialized structures.



View larger version (99K):
[in this window]
[in a new window]
 
FIGURE 1. Identification of LN anlagen in E16.5 embryos. A, E16.5 LN anlage at a sacral/iliac location, consisting of MAdCAM-1+ stromal cells and a cluster of CD4+ cells (MAdCAM-1 in red, CD4 in green). B, High-power magnification of an E16.5 LN anlage at a brachial location showing the close interaction between MAdCAM-1+ stromal cells and CD4+ cells (MAdCAM-1 in red, and CD4 in green). C, E16.5 LN anlage at an inguinal location. The majority of hemopoietic cells in the LN anlage expressed the IL-7R{alpha} chain (CD45 in green, and IL-7R{alpha} in red). D, CD4+ cells in the LN anlage also expressed IL7R{alpha} (CD4 in green, and IL-7R{alpha} in red), while in E, a small IL-7R{alpha}+B220+ population could also be detected (B220 in green, and IL-7R{alpha} in red). F, CD4+ cells in the embryonic anlage expressed ICAM-1 (CD4 in green, and ICAM-1 in red). DF, LN anlagen at a sacral/iliac location, representative of at least 10 different LN anlagen throughout the embryo.

 
The earliest cells to enter the LN or PP anlagen are expected to be IL-7R{alpha}+ cells emigrating from the fetal liver, which differentiate into CD45+CD4+CD3 cells (6, 17, 22). To study the spectrum of hemopoietic cells present within the developing LN, E16.5 LN anlagen were analyzed for expression of the IL-7R{alpha} chain, in combination with various lineage markers (Fig. 1, CE, shows an inguinal LN anlage, while Fig. 1F depicts a sacral/iliac LN anlage). As expected, the majority of IL-7R{alpha}+ cells in the early LN anlagen expressed the hemopoietic marker CD45 (Fig. 1C; Ref.22). CD45+CD4+CD3 cells would be predicted to form a large proportion of the hemopoietic cells at this time point, and indeed most of the IL-7R{alpha}+ cells coexpressed CD4, although an IL-7R{alpha}+CD4 population was also present (Fig. 1D). This remaining CD4 IL-7R{alpha}+ population likely contains IL-7R{alpha}+ fetal liver-derived precursors to CD45+CD4+CD3 cells. In addition, B220 expressing IL-7R{alpha}+ cells were also present in the LN anlagen, albeit in very low numbers (Fig. 1E). It remains to be determined whether these B220+ cells are B cells, or an additional precursor population.

Finally, groups of both CD4+ and CD4 cells among the CD45+CD3 cell population also expressed the Ig superfamily adhesion molecule, ICAM-1 (Fig. 1F). As the latter may well be the immediate precursors to the CD45+CD4+CD3-inducer cell population, it is possible that the expression of ICAM-1 is involved in recruitment or retention of these precursors within the LN anlagen.

The LN anlagen are bordered by differentiating lymphatic endothelium

The lymphatic endothelium of embryonic LNs is generated from local blood vessel-endothelial cells that are induced to differentiate toward a lymphatic phenotype. In the E16.5 LN anlagen, both at mesenteric and peripheral locations (Figs. 2AH, and IJ, respectively), the most distal cell layer consists of cells expressing the lymphatic endothelium specific hyaluronan receptor Lyve-1 (Fig. 2, B and I; Refs.25 and 26). A large portion of this lymphatic endothelium coexpresses MAdCAM-1 (Fig. 2, B and I), while several cells also stain positive for the junctional adhesion molecule, VE-cadherin (Fig. 2, CE), which is expressed on both blood vessel- and lymphatic endothelium (27). However, in contrast to the situation in adult animals, lymphatic endothelium at E16.5 also shows expression of the blood vessel endothelial restricted marker MECA-32 (Figs. 2, FH and J; Ref.28). These data demonstrate that at E16.5, the endothelial cells which line the PLN as well as MLN anlagen, are undergoing phenotypic changes, converting from blood vessel endothelium to lymphatic endothelial cells.



View larger version (78K):
[in this window]
[in a new window]
 
FIGURE 2. LN anlagen are ensheathed by differentiating endothelium. Endothelial cells expressing the lymphatic endothelium-restricted hyaluronan receptor, Lyve-1, bordered both MLNs (B) and PLNs (I; renal node; A, MAdCAM-1 in green, CD4 in red; B and I, Lyve-1 in green, MAdCAM-1 in red). CE, The Lyve-1+ endothelial cells coexpressed junctional adhesion molecule VE-cadherin (Lyve-1 in green, and VE-cadherin in red). FH and J, A proportion of the PLN and MLN anlagen also expressed the blood vessel-restricted marker, MECA-32, indicating that the cells were still differentiating toward their lymphatic fate (Lyve-1 in green, and MECA-32 in red). These stainings are representative for at least five different LN anlagen.

 
Presence of a LN homologue to the PP organizer

Previous studies of fetal intestines identified a population of VCAM-1/ICAM-1/MAdCAM-1-positive cells that was proposed to act as PP organizers by expressing adhesion molecules and homeostatic chemokines upon LT{beta}-R triggering (2, 3, 4, 6). In search of a similar population in developing LNs, we assessed the expression of adhesion molecules in E16.5 LN anlagen. Fig. 3, A and B, show a representative example of a MLN anlage, while Fig. 3, C and D, display an anlage at a peripheral location, situated adjacent to one of the large vessels (left side of picture). The MAdCAM-1+ cells within the LN anlagen showed coexpression of VCAM-1 (Fig. 3, A and C) as well as ICAM-1 (Fig. 3, B and D), thus identifying these cells as the LN equivalent of the PP organizing cells in fetal intestine (1, 3, 4). ICAM-1+VCAM-1+MAdCAM-1+ (IVM+) cells were concentrated in a polarized fashion in the outer regions of the LN anlagen (Fig. 3, A, B, D, and E). In addition, VCAM-1+ICAM-1+MAdCAM-1 cells were present in the deeper regions of the LN anlagen. These VCAM-1+ LN-organizer cells also expressed the TNF family member, TRANCE (Fig. 3, EG). In fact, throughout the embryo, TRANCE expression was only observed in the developing LNs and bones (data not shown). TRANCE was previously implied in regulating the number of CD45+CD4+CD3 cells in developing LN-nodes (29), and the fact that we now show abundant expression of TRANCE within the LN anlagen, would suggest a role for this molecule in local differentiation of CD45+CD4+CD3 cells.



View larger version (99K):
[in this window]
[in a new window]
 
FIGURE 3. Putative LN organizers are present in the LN anlagen. A and C, MAdCAM-1 and VCAM-1 double-positive cells can be seen to localize in the outer edge of the anlagen, while cells expressing lower levels of MAdCAM-1 and VCAM-1 have a more central location (MAdCAM-1 in green, and VCAM-1 in red). B and D, These MAdCAM-1+ cells also expressed ICAM-1, showing the presence and location of IVM+ cells (MAdCAM-1 in green, and ICAM-1 in red). This staining pattern was observed in at least 10 different LN anlagen). E and F, VCAM-1+ cells in the LN anlagen expressed TRANCE (VCAM-1 in red, and TRANCE in green; representative results of at least three different LN anlagen).

 
Different populations of functional LN organizers

ICAM-1/VCAM-1/MAdCAM-1 triple-positive cells in the developing PPs exert their function through the production of chemokines upon ligation of the LT{beta}-R (3). To determine whether similar functions could be fulfilled by the IVM+ putative LN organizers, MLN anlagen were dissected at E16.5 and at day of birth, and analyzed by flow cytometry (Fig. 4). Based upon expression of ICAM-1, VCAM-1, and MAdCAM-1, two different populations of IVM+ cells could be observed, both at E16.5 and day of birth (Fig. 4, A and D). The largest population expresses all three adhesion molecules at intermediate levels (IVMint; Fig. 4, A, B, D, and E, R2). An additional, clearly distinct, smaller population expresses high levels of IVM (IVMhigh) (Fig. 4, A, B, D, and E, R3), and this population resembles the previously described organizing population in the PPs (3, 30). Furthermore, both populations displayed expression of the LT{beta}-R, further supporting the likelihood that they represent LN organizers analogous to those present in developing PPs. However, surprisingly, the IVMint population expressed higher levels of LT{beta}-R than the IVMhigh cells (Fig. 4, C and F).



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 4. Two populations of LN organizers in the LN anlagen. A and D, In both E16.5 and day 0, MLNs, ICAM-1/VCAM-1high (R3), and ICAM-1/VCAM-1int (R2) populations are present. B and E, The IVhigh population also expressed high levels of MAdCAM-1 (IVMhigh), while the IVint population expressed MAdCAM-1 at low to intermediate levels (IVMint), both at E16.5 and day of birth. C and F, Both the IVMhigh (light line) and IVMint (dark line) population express LT{beta}-R. Highest level of LT{beta}-R was expressed by the IVMint population. As a negative control the CD45+ cells within R1 are shown (filled histogram; representative results of at least four different flow cytometric analyses).

 
The production of homeostatic chemokines is recognized as one of the defining properties of the PP organizers. Hence, we assessed production of the chemokine mRNA in both the IVMhigh and IVMint populations sorted to purity from E18.5 MLN anlagen by real-time quantitative PCR. As shown in Fig. 5, after normalization to {beta}-actin (or cyclophilin, data not shown) both the IVMhigh and IVMint populations in the MLN anlagen produced mRNA for the homeostatic chemokines CXCL13, CCL21, and CCL19. However, IVMhigh cells clearly contained higher levels of chemokine mRNA. As a control, the IVM, LT{beta}-R-negative population did not produce any of the homeostatic chemokines (data not shown). These data identify the IVMhigh and IVMint populations as functional LN organizers.



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 5. Production of homeostatic chemokines by LN organizers. To determine the functionality of the IVMhigh and IVMint populations in the developing LN, both populations were sorted from MLN anlagen at E18.5 and analyzed for the expression of chemokine mRNA by quantitative real-time PCR. Both populations produced mRNA for CXCL13, CCL21, and CCL19. When normalized to {beta}-actin, IVMhigh cells produced higher amounts of mRNA for all three homeostatic chemokines. Representative result of three independent quantitative PCR is shown.

 
PLNs and MLNs contain different organizing populations

Different requirements exist for the generation of PLNs and MLNs. Several gene-targeted mice lack one or more PLNs, while MLN formation is unaffected. Because the mechanism underlying this difference is unknown, we set out to analyze the LN organizers in both PLNs and MLNs at day of birth. Both sets of LNs were found to contain the IVMint and IVMhigh populations of LN organizers (Fig. 6A), with highest levels of MAdCAM-1 on the IVMhigh cells (Fig. 6B). Strikingly however, the IVMint population was severely diminished in PLNs compared with MLNs (~10-fold reduction) while the IVMhigh population showed only a slight decrease. As a result, the ratio of IVMhigh/IVMint cells, which in the MLN ranged from 0.1 to 0.4, was in the PLN completely opposite, ranging from 1 to 1.9.



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 6. Differential presence of LN organizers in PLNs and MLNs. Both PLNs (inguinal) as well as MLNs were analyzed for the presence of IVMhigh and IVMint populations at one day after birth. A, In PLNs, both populations were reduced when compared with MLNs, with the IVMint population being severely diminished (23.9 to 2.2%) while the IVMhigh was less affected (reduced from 8.9 to 4.2%). B, Similarly to MLNs, PLN IVMint cells expressed lower levels of MAdCAM-1 when compared with the IVMhigh population. C, Both populations of organizers in the PLNs express the LT{beta}-R. Representative analysis of at least three independent experiments is shown.

 
To further compare the organizing populations from MLNs and PLNs, expression of the LT{beta}-R was analyzed. In line with MLN organizers, IVMint and IVMhigh cells from PLNs expressed the LT{beta}-R (Fig. 6C). Levels of LT{beta}-R were again highest in the IVMint population, indicating that comparable populations of organizers are present in the PLNs and MLNs.

As the IVMint population in MLNs is by far the most prevalent in terms of absolute cell numbers (on average 10-fold more cells then the IVMhigh, data not shown), and because these express the highest levels of LT{beta}-R, their virtual absence from PLN may well explain why these particular nodes have different signaling requirements to MLN during embryonic development.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we have identified two distinct LN-organizing populations in developing LN anlagen. These anlagen were characterized by the accumulation of CD45+CD4+CD3 cells, which were found to be in close proximity to MAdCAM-1, VCAM-1, and ICAM-1 expressing cells. A layer of Lyve-1-expressing lymphatic endothelium, which forms the most distal part of the LN anlage, ensheathes these IVM+ cells. The coexpression of the lymphatic endothelial marker, Lyve-1, and the blood vascular marker, MECA-32, by the endothelial cells within the LN anlagen reflects the fact that these cells have recently sprouted from the large veins, and are still undergoing transition from a vascular to a lymphatic phenotype. This "bipolar" endothelial cell layer, which has not previously been reported, eventually differentiates to form the subcapsular sinus of the LN.

Inward from the layer of VCAM-1/ICAM-1/MAdCAM-1 triple-positive cells, mostly VCAM-1 and ICAM-1 single-positive cells were found to extend into the deeper regions of the developing LN. A fraction of the single ICAM-1+ cells are CD45+CD4+CD3 cells, and the expression of ICAM-1 on these cells may well have a function in the clustering of these cells in the LN anlage. However, because LN development is normal in mice that lack the ICAM-1 ligand, LFA-1 (31), it is likely that there is redundancy among the adhesion molecules that fulfill this function.

Our studies also show that CD45+CD4+CD3 cells in the LN anlage express the IL-7R{alpha} chain (32). However, not all IL-7R{alpha}+ cells expressed CD4, indicative of the fact that the direct precursor to CD45+CD4+CD3 cells, an IL-7R{alpha}+ population derived from the fetal liver (17, 18), might also lodge in these LN anlagen. One of the factors responsible for the accumulation of CD45+CD4+CD3 cells in the LN anlagen is TRANCE, because mice with deficient TRANCE-signaling have severely diminished numbers of CD45+CD4+CD3 cells in these anlagen (6, 22, 29). In this study, we show that expression of TRANCE is restricted to the LN anlagen, suggesting that TRANCE acts locally to either recruit, mediate survival, or induce differentiation of CD45+CD4+CD3 cells. TRANCE was previously shown to be present on CD45+CD4+CD3 cells, while the TRANCE-R is expressed by both CD45+CD4+CD3 and CD45+CD4CD3 cells (29), but now we show that TRANCE is also expressed on VCAM-1+ LN-organizing cells within the LN anlagen. This nonhemopoietic expression of TRANCE could thus further explain the inability to completely rescue the phenotype of the TRANCE–/– mice by hemopoietic cell-specific transgenic TRANCE overexpression (29).

Dissection of PLN and MLN from newborn and embryonic animals provided us with the opportunity to study the properties of the IVM+ cells constituting the presumptive LN organizers. Flow cytometric analysis of both MLNs and PLNs revealed the presence of two populations of IVM cells: IVMint and IVMhigh cells. Both populations expressed the LT{beta}-R, and are, therefore, phenotypically homologous to the previously described PP organizers. The IVMint and IVMhigh cells produced mRNA for CXCL13, CCL21, and CCL19, confirming that these are the functional counterparts of PP organizing cells (3).

The development of LNs at either peripheral or mesenteric sites is known to be regulated by distinct signals. For example, targeted deletion of either LT{beta}, components of the IL-7R signaling complex, or the CXCL13/CXCR5 pair disrupts development of PLNs but has little or no effect on the development of MLNs (3, 23, 24). The cellular basis for such differences has until now remained unclear. However, our finding in this manuscript that PLN anlagen differ markedly from MLN anlagen in the relative abundance of IVMint cells may provide an explanation for this discrepancy. Because IVMint cells are the organizing population that expresses the highest levels of LT{beta}-R, the decrease of these cells in PLNs could proof to be a limiting factor for PLN development in case of suboptimal LT{beta}-R stimulation, for instance in the absence of LT{beta}, IL-7R triggering, or CXCR5 triggering. In LT{beta}–/– mice, a role was postulated for LT{beta}-R triggering via LT{alpha} and homologous to lymphotoxins, exhibits inducible expression, and competes with HSV glycoprotein D, for HVEM, a receptor expressed by T lymphocytes (LIGHT) (33). However, this is likely to be a less potent signal then LT, reducing the level of LT{beta}-R triggering. Furthermore, in the absence of IL-7R ligation, TRANCE-R signaling is still able to induce surface LT on inducer cells (6). However, if a reduction in LT-inducing signals leads to a lower number of cells that initiate expression of LT, again LT{beta}-R levels could become limited. The same, of course, holds true for the CXCL13/CXCR5 signaling pathway, which controls the accumulation of LT-expressing inducer cells at sites of LN development (3, 13, 32).

In summary, developing LN anlagen contain two distinct populations of organizing cells that express the LT{beta}-R, adhesion molecules ICAM-1, VCAM-1, and MAdCAM-1, and produce CXCL13, CCL21, and CCL19. In PLNs, the number of organizing cells is greatly diminished, with the LT{beta}-RhighIVMint population being most severely reduced. This leads to distinct stromal microenvironments in PLN and MLN anlagen, providing an explanation for the divergent developmental requirements observed for these two LN systems.


    Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 T.C. and M.F.R.V. were financially supported by The Netherlands Organization for Scientific Research. Back

2 T.C. and M.F.R.V. contributed equally to this manuscript. Back

3 Address correspondence and reprint requests to Dr. Reina E. Mebius, Vrije University Medical Center, Faculty of Medicine, P.O. Box 7057, 1007 MB Amsterdam, The Netherlands. E-mail address: r.mebius{at}vumc.nl Back

4 Abbreviations used in this paper used: E, embryonic day; Lyve-1, lymphatic endothelium-restricted hyaluronan receptor-1; LT, lymphotoxin-{alpha}1{beta}2; PP, Peyer’s patch; LN, lymph node; PLN, peripheral LN; MLN, mesenteric LN; LT{beta}-R, lymphotoxin-{beta} receptor; MAdCAM-1, mucosal addressin cell adhesion molecule-1; IVM+, ICAM-1+VCAM-1+MAdCAM-1+; VE-cadherin, vascular endothelial-cadherin. Back

Received for publication January 21, 2004. Accepted for publication June 18, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Adachi, S., H. Yoshida, H. Kataoka, S. Nishikawa. 1997. Three distinctive steps in Peyer’s patch formation of murine embryo. Int. Immunol. 9:507.[Abstract/Free Full Text]
  2. Hashi, H., H. Yoshida, K. Honda, S. Fraser, H. Kubo, M. Awane, A. Takabayashi, H. Nakano, Y. Yamaoka, S. I. Nishikawa. 2001. Compartmentalization of Peyer’s patch anlagen before lymphocyte entry. J. Immunol. 166:3702.[Abstract/Free Full Text]
  3. Honda, K., H. Nakano, H. Yoshida, S. Nishikawa, P. Rennert, K. Ikuta, M. Tamechika, K. Yamaguchi, T. Fukumoto, T. Chiba, S. I. Nishikawa. 2001. Molecular basis for hematopoietic/mesenchymal interaction during initiation of Peyer’s patch organogenesis. J. Exp. Med. 193:621.[Abstract/Free Full Text]
  4. Yoshida, H., K. Honda, R. Shinkura, S. Adachi, S. Nishikawa, K. Maki, K. Ikuta, S. I. Nishikawa. 1999. IL-7 receptor {alpha}+ CD3 cells in the embryonic intestine induces the organizing center of Peyer’s patches. Int. Immunol. 11:643.[Abstract/Free Full Text]
  5. Adachi, S., H. Yoshida, K. Honda, K. Maki, K. Saijo, K. Ikuta, T. Saito, S. I. Nishikawa. 1998. Essential role of IL-7 receptor {alpha} in the formation of Peyer’s patch anlage. Int. Immunol. 10:1.[Abstract/Free Full Text]
  6. Yoshida, H., A. Naito, J. Inoue, M. Satoh, S. M. Santee-Cooper, C. F. Ware, A. Togawa, S. Nishikawa. 2002. Different cytokines induce surface lymphotoxin-{alpha}{beta} on IL-7 receptor-{alpha} cells that differentially engender lymph nodes and Peyer’s patches. Immunity 17:823.[Medline]
  7. Finke, D., H. Acha-Orbea, A. Mattis, M. Lipp, J. Kraehenbuhl. 2002. CD4+CD3 cells induce Peyer’s patch development: role of {alpha}4{beta}1 integrin activation by CXCR5. Immunity 17:363.[Medline]
  8. Sabin, F. R.. 1904. On the development of the superficial lymphatics in the skin of the pig. Am. J. Anat. 3:183.
  9. Sabin, F. R.. 1908. Further evidence on the origin of the lymphatic endothelium from the endothelium of the blood vascular system. Anat. Rec. 2:46.
  10. Sabin, F. R.. 1909. The lymphatic system in human embryos, with a consideration of the morphology of the system as a whole. Am. J. Anat. 9:43.
  11. Wigle, J. T., G. Oliver. 1999. Prox1 function is required for the development of the murine lymphatic system. Cell 98:769.[Medline]
  12. Oliver, G., B. Sosa-Pineda, S. Geisendorf, E. P. Spana, C. Q. Doe, P. Gruss. 1993. Prox 1, a prospero-related homeobox gene expressed during mouse development. Mech. Dev. 44:3.[Medline]
  13. Mebius, R. E., P. Rennert, I. L. Weissman. 1997. Developing lymph nodes collect CD4+CD3LT{beta}+ cells that can differentiate to APC, NK cells, and follicular cells but not T or B cells. Immunity 7:493.[Medline]
  14. Cupedo, T., G. Kraal, R. E. Mebius. 2002. The role of CD45+CD4+CD3 cells in lymphoid organ development. Immunol. Rev. 189:41.[Medline]
  15. Rennert, P. D., J. L. Browning, R. Mebius, F. Mackay, P. S. Hochman. 1996. Surface lymphotoxin {alpha}/{beta} complex is required for the development of peripheral lymphoid organs. J. Exp. Med. 184:1999.[Abstract/Free Full Text]
  16. Rennert, P. D., D. James, F. Mackay, J. L. Browning, P. S. Hochman. 1998. Lymph node genesis is induced by signaling through the lymphotoxin {beta} receptor. Immunity 9:71.[Medline]
  17. Mebius, R. E., T. Miyamoto, J. Christensen, J. Domen, T. Cupedo, I. L. Weissman, K. Akashi. 2001. The fetal liver counterpart of adult common lymphoid progenitors gives rise to all lymphoid lineages, CD45+CD4+CD3 cells, as well as macrophages. J. Immunol. 166:6593.[Abstract/Free Full Text]
  18. Yoshida, H., H. Kawamoto, S. M. Santee, H. Hashi, K. Honda, S. Nishikawa, C. F. Ware, Y. Katsura, S. I. Nishikawa. 2001. Expression of {alpha}4{beta}7 integrin defines a distinct pathway of lymphoid progenitors committed to T cells, fetal intestinal lymphotoxin producer, NK, and dendritic cells. J. Immunol. 167:2511.[Abstract/Free Full Text]
  19. Harmsen, A., K. Kusser, L. Hartson, M. Tighe, M. J. Sunshine, J. D. Sedgwick, Y. Choi, D. R. Littman, T. D. Randall. 2002. Cutting edge: organogenesis of nasal-associated lymphoid tissue (NALT) occurs independently of lymphotoxin-{alpha} (LT{alpha}) and retinoic acid receptor-related orphan receptor-{gamma}, but the organization of NALT is LT{alpha} dependent. J. Immunol. 168:986.[Abstract/Free Full Text]
  20. Fukuyama, S., T. Hiroi, Y. Yokota, P. D. Rennert, M. Yanagita, N. Kinoshita, S. Terawaki, T. Shikina, M. Yamamoto, Y. Kurono, H. Kiyono. 2002. Initiation of NALT organogenesis is independent of the IL-7R, LT{beta}R, and NIK signaling pathways but requires the Id2 gene and CD3CD4+CD45+ cells. Immunity 17:31.[Medline]
  21. Browning, J. L., L. E. French. 2002. Visualization of lymphotoxin-{beta} and lymphotoxin-{beta} receptor expression in mouse embryos. J. Immunol. 168:5079.[Abstract/Free Full Text]
  22. Eberl, G., S. Marmon, M. J. Sunshine, P. D. Rennert, Y. Choi, D. R. Littman. 2004. An essential function for the nuclear receptor ROR{gamma}(t) in the generation of fetal lymphoid tissue inducer cells. Nat. Immunol. 5:64.[Medline]
  23. Koni, P. A., R. Sacca, P. Lawton, J. L. Browning, N. H. Ruddle, R. A. Flavell. 1997. Distinct roles in lymphoid organogenesis for lymphotoxins {alpha} and {beta} revealed in lymphotoxin {beta}-deficient mice. Immunity 6:491.[Medline]
  24. Forster, R., A. E. Mattis, E. Kremmer, E. Wolf, G. Brem, M. Lipp. 1996. A putative chemokine receptor, BLR1, directs B cell migration to defined lymphoid organs and specific anatomic compartments of the spleen. Cell 87:1037.[Medline]
  25. Prevo, R., S. Banerji, D. J. Ferguson, S. Clasper, D. G. Jackson. 2001. Mouse LYVE-1 is an endocytic receptor for hyaluronan in lymphatic endothelium. J. Biol. Chem. 276:19420.[Abstract/Free Full Text]
  26. Jackson, D. G.. 2003. The lymphatics revisited: new perspectives from the hyaluronan receptor LYVE-1. Trends Cardiovasc. Med. 13:1.[Medline]
  27. Kriehuber, E., S. Breiteneder-Geleff, M. Groeger, A. Soleiman, S. F. Schoppmann, G. Stingl, D. Kerjaschki, D. Maurer. 2001. Isolation and characterization of dermal lymphatic and blood endothelial cells reveal stable and functionally specialized cell lineages. J. Exp. Med. 194:797.[Abstract/Free Full Text]
  28. Hallmann, R., D. N. Mayer, E. L. Berg, R. Broermann, E. C. Butcher. 1995. Novel mouse endothelial cell surface marker is suppressed during differentiation of the blood brain barrier. Dev. Dyn. 202:325.[Medline]
  29. Kim, D., R. E. Mebius, J. D. MacMicking, S. Jung, T. Cupedo, Y. Castellanos, J. Rho, B. R. Wong, R. Josien, N. Kim, et al 2000. Regulation of peripheral lymph node genesis by the tumor necrosis factor family member TRANCE. J. Exp. Med. 192:1467.[Abstract/Free Full Text]
  30. Nishikawa, S.-I., K. Honda, P. Vieira, H. Yoshida. 2003. Organogenesis of peripheral lymphoid organs. Immunol. Rev. 195:72.[Medline]
  31. Berlin-Rufenach, C., F. Otto, M. Mathies, J. Westermann, M. J. Owen, A. Hamann, N. Hogg. 1999. Lymphocyte migration in lymphocyte function-associated antigen (LFA)-1-deficient mice. J. Exp. Med. 189:1467.[Abstract/Free Full Text]
  32. Luther, S. A., K. M. Ansel, J. G. Cyster. 2003. Overlapping roles of CXCL13, Interleukin 7 receptor {alpha}, and CCR7 ligands in lymph node development. J. Exp. Med. 197:1191.[Abstract/Free Full Text]
  33. Scheu, S., J. Alferink, T. Potzel, W. Barchet, U. Kalinke, K. Pfeffer. 2002. Targeted disruption of LIGHT causes defects in costimulatory T cell activation and reveals cooperation with lymphotoxin {beta} in mesenteric lymph node genesis. J. Exp. Med. 195:1613.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
N. H. Ruddle and E. M. Akirav
Secondary Lymphoid Organs: Responding to Genetic and Environmental Cues in Ontogeny and the Immune Response
J. Immunol., August 15, 2009; 183(4): 2205 - 2212.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. F. Vondenhoff, M. Greuter, G. Goverse, D. Elewaut, P. Dewint, C. F. Ware, K. Hoorweg, G. Kraal, and R. E. Mebius
LT{beta}R Signaling Induces Cytokine Expression and Up-Regulates Lymphangiogenic Factors in Lymph Node Anlagen
J. Immunol., May 1, 2009; 182(9): 5439 - 5445.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
M. F. Vondenhoff, S. A. van de Pavert, M. E. Dillard, M. Greuter, G. Goverse, G. Oliver, and R. E. Mebius
Lymph sacs are not required for the initiation of lymph node formation
Development, January 1, 2009; 136(1): 29 - 34.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Katakai, H. Suto, M. Sugai, H. Gonda, A. Togawa, S. Suematsu, Y. Ebisuno, K. Katagiri, T. Kinashi, and A. Shimizu
Organizer-Like Reticular Stromal Cell Layer Common to Adult Secondary Lymphoid Organs
J. Immunol., November 1, 2008; 181(9): 6189 - 6200.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. F. R. Vondenhoff, G. E. Desanti, T. Cupedo, J. Y. Bertrand, A. Cumano, G. Kraal, R. E. Mebius, and R. Golub
Separation of splenic red and white pulp occurs before birth in a LT{alpha}{beta}-independent manner
J. Leukoc. Biol., July 1, 2008; 84(1): 152 - 161.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. White, D. Carragher, S. Parnell, A. Msaki, N. Perkins, P. Lane, E. Jenkinson, G. Anderson, and J. H. Caamano
Lymphotoxin a-dependent and -independent signals regulate stromal organizer cell homeostasis during lymph node organogenesis
Blood, September 15, 2007; 110(6): 1950 - 1959.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Okuda, A. Togawa, H. Wada, and S.-i. Nishikawa
Distinct Activities of Stromal Cells Involved in the Organogenesis of Lymph Nodes and Peyer's Patches
J. Immunol., July 15, 2007; 179(2): 804 - 811.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. T. Taylor, S. R. Patel, E. Lin, B. R. Butler, J. G. Lake, R. D. Newberry, and I. R. Williams
Lymphotoxin-Independent Expression of TNF-Related Activation-Induced Cytokine by Stromal Cells in Cryptopatches, Isolated Lymphoid Follicles, and Peyer's Patches
J. Immunol., May 1, 2007; 178(9): 5659 - 5667.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. C. Coles, H. Veiga-Fernandes, K. E. Foster, T. Norton, S. N. Pagakis, B. Seddon, and D. Kioussis
Role of T and NK cells and IL7/IL7r interactions during neonatal maturation of lymph nodes
PNAS, September 5, 2006; 103(36): 13457 - 13462.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. Kanemitsu, Y. Ebisuno, T. Tanaka, K. Otani, H. Hayasaka, T. Kaisho, S. Akira, K. Katagiri, T. Kinashi, N. Fujita, et al.
CXCL13 is an arrest chemokine for B cells in high endothelial venules
Blood, October 15, 2005; 106(8): 2613 - 2618.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Cupedo and R. E. Mebius
Cellular Interactions in Lymph Node Development
J. Immunol., January 1, 2005; 174(1): 21 - 25.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cupedo, T.
Right arrow Articles by Mebius, R. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cupedo, T.
Right arrow Articles by Mebius, R. E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS