| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Chain Inhibits TCR
Gene Rearrangements without Altering the Frequency of TCR
Lineage Cells1
* Howard Hughes Medical Institute, Institute of Physical and Chemical Research/Neuroscience Research Center, The Picower Center for Learning and Memory, Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02139; and
Unité du Développement des Lymphocytes, Centre National de la Recherche Scientifique, Unité de Recherche Associée 1961, Institut Pasteur, Paris, France
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and a pre-TCR on 
/ lineage commitment, we have forced expression of functionally rearranged TCR, TCR, and TCR chains by means of transgenes. Mice transgenic for the three TCR chains contain numbers of thymocytes comparable to those of mice transgenic for both TCR and TCR chains, and numbers of thymocytes similar to those found in mice solely transgenic for a rearranged TCR chain gene. T cells from the triple transgenic mice express the transgenic TCR chain, but do not express a TCR chain, and, by a number of phenotypic and molecular parameters, appear to be bona fide thymocytes. Our results reveal a remarkable degree of independence in the generation of and lineage cells from progenitor cells that, in theory, could simultaneously express a TCR and a pre-TCR. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
or TCR heterodimers originate from a common precursor, which is contained within a CD4–CD8– (double-negative (DN))3 thymic population that does not express the CD3-TCR complex. This triple-negative population can be further subdivided, based on the cell surface expression of CD25 and CD44 molecules, into four subsets that correlate with different developmental stages (1). The CD25–CD44+ subset contains, among other cells, the thymic lymphoid precursors, which are further identified by expression of the stem cell factor receptor (c-kit). In addition to their T cell potential, these precursors are capable of generating NK cells and dendritic cells (2). The CD25–CD44+c-kit+ cells develop into the CD25+CD44+c-kit+ subset (pro-T cells), which differentiate into CD25+CD44–c-kit– cells (pre-T cells) and finally into CD25–CD44–c-kit– cells. This latter subset contains the immediate precursors of mature thymocytes and of CD4+CD8+ (double-positive (DP)) thymocytes, which represent cells developing along the pathway (3, 4). Although commitment to the and lineages must occur at some point between the pro-T cell stage and the CD25–CD44– stage, the exact time at which commitment occurs and its mechanism remains unknown.
Rearrangements of the TCR, TCR, and TCR genes start at the pro-T cell stage and are terminated at the pre-T cell stage (5, 6, 7). However, complete V-J or V-(D)-J rearrangements can be found in pro-T cells, whereas complete V-(D)-J rearrangements are only detectable in pre-T cells (6, 7), indicating that T cell differentiation can divert from T cell differentiation at the pro-T cell stage. Further development of lineage cells requires the expression of a pre-TCR chain (pT), which associates with a functional TCR chain to form a pre-TCR (8). Only thymocytes that express a functional pre-TCR can efficiently mature to the CD25–CD44– stage, a developmental checkpoint usually referred to as -selection (9). Pre-TCR+ cells subsequently differentiate into DP immature thymocytes in a process that involves extensive proliferation (10), and finally rearrange the TCR genes, express TCR that are the targets of positive and negative selection events, and further differentiate into CD4+ and CD8+ mature single-positive (SP) T cells. In contrast, differentiation along the pathway appears to require both chains because no surrogate - or -chains have been identified, and involves much less proliferation than development of lineage cells (11, 12). Furthermore, developing thymocytes do not go through a DP stage, indicating that the two differentiation pathways diverge before this developmental stage. In fact, cell surface TCR-negative, intracellular TCR-positive cells, which are believed to be the immediate precursors of the T cells, have been observed among the CD25–CD44– thymocyte subset (4).
Models of and lineage commitment vary in the extent to which the TCR and the pre-TCR are proposed to influence cell determination or cell fate (13, 14, 15, 16, 17, 18). Instructive models propose that the TCR and the pre-TCR provide distinct signals in uncommitted precursors, resulting in their differentiation into or lineage cells, respectively. Selective models, in contrast, propose that lineage determination is initially TCR independent, and that TCR signals ensure the appropriate differentiation of already committed cells. There is clear evidence that rearrangements of and genes in T cell progenitors and rearrangements of genes in T cell progenitors are not neutral events, although the exact mechanisms by which these rearrangements exert the observed effects are still a matter of debate. Thus, most and to some extent rearrangements found in DP cells are nonfunctional, suggesting that expression of a TCR influences cell fate away from the lineage (19). Likewise, there are a number of observations that have suggested a determinant role of the pre-TCR in committing T cell precursors to the lineage (20, 21). First, early expression of a functionally rearranged TCR chain profoundly inhibited T cell development (20, 22, 23). Second, pT-deficient mice harbor an increased number of T cells when compared with wild-type (WT) littermates (24, 25). Third, T cells from pT-deficient mice proceed much further in TCR rearrangements than T cells from WT mice (26). Moreover, a greater frequency of in-frame TCR alleles was found in T cells from pT-deficient mice (26). Taken together, these data were interpreted to imply that signals through the pre-TCR commit developing T cells to the lineage by an instructive mechanism (16, 26).
However, conflicting data have been obtained from analysis of TCR rearrangements in different populations of T cells. Although some such studies concluded that TCR rearrangements were predominantly functional in T cells (9, 19, 27), others reported a nearly random frequency of functional rearrangements (28, 29, 30). These two kinds of data were interpreted to indicate that there is either maximal selection or no selection, respectively, for T cells that have successfully rearranged TCR chains. The reason for these discrepancies remains unclear, although the use of different techniques, the sampling of a limited set of V-J combinations analyzed, and the analyses of different populations may be at the basis of these apparently contradictory results.
To reanalyze the effects of signaling through the pre-TCR on the development of T cells, we have produced mice containing rearranged TCR, TCR, and TCR chains in the precursor cells and examined the effects of those trangenes on the development of and lineage cells. Our results show a remarkable degree of independence in the generation of and lineage cells from progenitor cells that, in theory, could simultaneously express a TCR and a pre-TCR.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
C57BL/6 (B6) were obtained from Iffa-Credo (L’Abresle, France). B6 mice transgenic (Tg) for rearranged V1J4C4 and V6D2J1 chains (Tg-) (31) and mice Tg for a rearranged TCR chain (Tg-) (32) were maintained in our animal facilities. Mice containing functionally rearranged -, -, and -chains (Tg- x ) were obtained by mating Tg- and Tg- mice. All animals were used between 4 and 12 wk of age, unless otherwise indicated.
Cell preparations
DN thymocytes were prepared by complement-mediated lysis, as described (33). blasts were obtained by culturing DN thymocytes in RPMI 1640 with Glutamax-I medium (Invitrogen Life Technologies, Gaithersburg, MD) supplemented with sodium pyruvate, 5 x 10–5 M 2-ME, nonessential amino acids, HEPES, antibiotics (all from Invitrogen Life Technologies), and 10% FCS (Boehringer Mannheim, Mannheim, Germany), in plates previously coated with anti- mAbs (10 µg/ml). Growing T cell blasts were >95% pure and contained <5% T cells. Mouse rIL-2 was added at a final concentration of 100 U/ml.
Abs and flow cytometric analyses
Anti-CD4 (RL.174), anti-CD8 (HO-2.2), anti-C (H57-597), anti-C (clones 3A10 or 76.14), anti-TCR clonotype (clone 1.9), and anti-V1 (2.11) were prepared and used, as described (33). FITC-, PE-, biotin-, or allophycocyanin-labeled anti-CD25, anti-CD44, anti-heat-stable Ag (CD24), anti-CD3
, anti-C (GL3), anti-TCR, anti-NK1.1, anti-CD4, anti-CD8, anti-Mac-1, anti-Gr-1, anti-CD19, anti-NK1.1, anti-V2, anti-V8, and anti-V11 mAbs and streptavidin-PE-Cy7 were purchased from BD Pharmingen (San Diego, CA). Cell surface mAb labeling was performed, as described (33). Cells were analyzed in a FACSCalibur or in an LSR cytometer (BD Biosciences, Franklin Lakes, NJ) and sorted with a MoFlow cell sorter (Cytometrix, Fort Collins, CO). Intracytoplasmatic detection of TCR chains was performed, essentially as described (34). Briefly, cells were incubated with the desired mAbs for surface staining in the presence of 20 µg/ml unlabeled anti-TCR mAbs, washed twice, and fixed and permeabilized in 100 µl of Cytofix/Cytoperm (BD Pharmingen) for 30 min. After another two washes with Perm/Wash buffer (BD Pharmingen), the cells were incubated with PE-labeled anti-TCR mAbs for 20 min, washed twice with the same buffer, and analyzed, as above. DNA staining was performed by incubating the cells (106 cells/ml) at 37°C in complete medium supplemented with 40 µg/ml Hoechst dye (Sigma-Aldrich, St. Louis, MO) for 1 h. After one wash, the cells were surface stained with labeled Abs, as described (33), and analyzed in an LSR cytometer (BD Biosciences) excluding doublets.
Nucleic acid preparation, semiquantitative PCR, and real-time PCR
Total cellular RNA from sorted populations was extracted with RNA-B (Bioprobe Systems, Montreuil, France). cDNA was synthesized with oligo(dT) (Pharmacia, Peapack, NJ) using superscript reverse transcriptase (Invitrogen Life Technologies), according to the manufacturer’s instructions. Semiquantitative analyses of TCR rearrangements were performed by PCR amplification of serial dilutions of DNA isolated from blasts from normal, Tg-, and Tg-( x ) mice with primers located between the 
J and the first J gene segment (forward, CATGACTGTCATGTGACTGG and reverse, TGAACACTGCCAGGCTCAGC). Amplification of the same DNA dilution with 2-microglobulin-specific primers (forward, TGGCTCACACTGAATTCAC and reverse, GATGCTTGATCACATGTCTCG) was used for normalization. PCR was performed using a GeneAmp PCR system 9700 (PerkinElmer/Cetus, Norwalk, CT). Each cycle consists of incubations at 92°C for 20 s, followed by 55°C for 30 s and 72°C for 30 s. Before the first cycle, a 2-min 94°C denaturation step was included, and after the thirty-fifth cycle the extension at 72°C was prolonged for 4 min. Amplification products were separated in a 2% agarose gel and stained with ethidium bromide, and the intensity of the bands was quantified with an Image Station 440 CF (Kodak Digital Science, Rochester, NY) using the Kodak Digital Science 1D image analysis software.
Real-time PCRs were performed in a GeneAmp 5700 Sequence Detection System (Applied Biosystems, Warrington, U.K.) using SYBR Green PCR Master Mix (Applied Biosystems) and 10 pmol of each primer, in a final volume of 25 µl, according to the manufacturer’s instructions. PCR cycles were as follows: 1 cycle of 94°C for 10 min; 45 cycles of 94°C for 15 s, 60°C for 30 s, and 72°C for 1 min. A dissociation protocol was performed at the end of the last cycle to control each sample. Serial dilutions of the experimental cDNA samples were analyzed on the same plate for both hypoxanthine phosphoribosyltransferase (HPRT) (as a control; primers GACTGAAAGACTTGCTCGAG and CCAGCAAGCTTGCAACCTTAACCA) and the V1J4C4 transgene (primers VG1, CCGGCAAAAAGCAAAAAAGTT and panCG, CTTATGGAGATTTGTTTCAGC). Serial dilutions of a plasmid containing one copy of a rearranged V1-J4C4 chain and one copy of the HPRT gene were amplified with the same primers and used to construct the standard curves. This plasmid was produced by cloning into a TOPO TA cloning pCR 2.1 vector (Invitrogen Life Technologies) the products of PCR amplifications of cDNA from T cells with the same primers. The insert from the HPRT-containing plasmid was isolated by digestion with restriction enzymes, purified, and ligated by its cohesive ends to the linearized V1-containing plasmid by overnight incubation at 14°C in the presence of T4 ligase. All restriction enzymes and T4 ligase were purchased from Roche/Boehringer (Mannheim, Germany).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and Tg-( x ) mice display normal numbers of immature and mature lineage cells and a 5-fold increase in the number of thymocytes
Young adult Tg- mice displayed numbers of DP and SP thymocytes comparable to those found in non-Tg littermates (Fig. 1 and Table I). In contrast, expression of the functionally rearranged and transgenes resulted in a 5-fold increase in the number of thymocytes when compared with non-Tg littermates. In adult mice, 80–90% of these cells expressed the chains encoded by the and the transgenes, as evidenced by their staining with an anti-clonotypic Ab (31) (data not shown).
|
|
chain from a male-specific, cytotoxic T cell clone (hereafter referred to as Tg- mice) (32) showed a 
10-fold reduction in the number of thymocytes when compared with non-Tg littermates (Fig. 1 and Table I). Such blockade in the generation of T cells results from a profound inhibition of V to J rearrangements (20, 22, 23), possibly due to the unusually early expression of the TCR transgene in this Tg line (32), and to the ability of the Tg TCR chain to signal in the absence of the pT chain (23). Compared with WT mice, adult Tg- mice display a 2-fold reduction in DP cells (Fig. 1 and Table I) mostly due to the relative inability of a single TCR chain to produce a selectable repertoire of TCR and to the accelerated involution of the thymus in the Tg- mice (data not shown). Introduction of functionally rearranged and genes into the Tg- mice restores the thymocyte population to levels comparable with those found in Tg- mice, while maintaining a similar number of DP cells as that found in Tg- mice (Fig. 1 and Table I). These results indicate that lineage cells can develop normally from precursor cells expressing a functionally rearranged TCR chain, provided that these precursor cells also contain functionally rearranged TCR and TCR chains capable of forming a TCR.
T cells in Tg- and in Tg-( x ) mice are bona fide T cells
Abnormal expression of TCR transgenes in cells of the wrong lineage has been documented (35, 36, 37). It was, therefore, important to ascertain that the cells expressing the transgene in Tg- and Tg-( x ) mice were in fact lineage cells. Although, with the exception of the TCR itself, no specific marker can unambiguously distinguish and lineage cells, a combination of phenotypic and molecular criteria has been used in the past to define whether a cell exhibits properties of or lineage cells (35, 37). Unlike most thymocytes, but similar to most thymocytes isolated from normal animals, thymocytes obtained from Tg- and Tg-( x ) mice do not express either the CD4 or the CD8 coreceptors, and express high levels of CD24 (Fig. 2A). Also consistent with their lineage specificity, most T cells isolated from Tg- and Tg-( x ) mice have TCR loci in germline configuration (Fig. 2B). Furthermore, T cells are evident in day 15 fetal thymuses of Tg- and Tg-( x ) mice, before T cells develop (Fig. 2C). Finally, T cells in Tg animals can also be distinguished from a population of mature DN T cells usually referred to as the T NK population by their low frequency of cells expressing the NK1.1 marker (Fig. 2A). Taken together, these experiments strongly suggest that cells bearing the transgenes at the cell surface in Tg- and Tg-( x ) mice are bona fide lineage cells.
|
T cells in Tg-( x ) mice express the TCR transgene
The data presented above indicated that the presence of a functional TCR chain has no evident effect on the development of lineage cells provided that the TCR-containing precursors can rearrange their and genes. However, T cells in Tg-( x ) mice could be the progeny of cells that had lost the TCR transgene or down-regulated its expression, in such a way that no possible competition between the TCR and the pre-TCR would have occurred in the progenitor cells. To analyze this issue, we studied transgenic TCR chain expression in the cytoplasm of thymocytes from Tg-( x ) and Tg- mice. As shown in Fig. 3A, virtually all thymocytes from Tg-( x ) mice stained brightly with an anti- mAb, contrasting with the 11% of the thymocytes that express a functional TCR chain in Tg- mice. This latter fraction is slightly lower than that previously found in thymocytes and splenocytes of normal mice (26, 34).
|
chains at the surface of thymocytes from Tg-( x ) mice (Fig. 3B). Their level of TCR staining was similar to that found in CD3–CD4–CD8– thymocytes present in Tg- animals (Fig. 3B), which was previously shown to represent expression of TCR homodimers (38). Consistent with this possibility, thymocytes (Fig. 3D) or splenocytes (data not shown) from Tg-( x ) mice do not stain with a panel of available anti-V mAbs that react with 25% of the SP cells in the same mice (Fig. 3C), as it could be predicted from the germline configuration of their TCR loci (Fig. 2B). These data demonstrate that T cells in Tg-( x ) mice express the TCR transgene. Given the very early expression of the TCR transgene in virtually all T cell precursors, it is likely that these thymocytes originate from cells expressing a functional TCR chain before or at the same time that they express the TCR and TCR chains.
Elevated numbers of T cells in Tg- and Tg-( x ) mice result from increased differentiation of lineage cells
Elevated numbers of T cells in Tg- and Tg-( x ) mice could result from a more extensive proliferation of T cells instead of from a more efficient differentiation of T cell progenitors. To directly test this possibility, we analyzed cell cycle status of -positive thymocytes in WT and in the different Tg mice. As shown in Fig. 4A, the fraction of T cells with greater than 2n DNA content (and therefore in S/G2/M phases of the cell cycle) was comparable in all mice, demonstrating that a more efficient differentiation rather than proliferation was responsible for the increased number of thymocytes in Tg- and Tg-( x ) mice. Interestingly, the fraction of cycling thymocytes was not increased in Tg- mice, despite their greatly reduced numbers of thymocytes (Table I), suggesting the absence of homeostatic mechanisms regulating T cell numbers in the thymus.
|
and TCR transgenes results in a more efficient differentiation of lineage cells without an evident alteration of lineage cell differentiation. It was possible, however, that expression of these transgenes could result in a reduction of lineage progenitor cells, but that such effect would be compensated by a stronger proliferation of these progenitor cells in Tg- mice, resulting in numbers of DP and SP cells similar to those found in normal mice. To test this possibility, we analyzed the proliferation status of early progenitor cells, separated on the basis of their expression of c-kit and CD25 Ags (Fig. 4B), in WT and in the different Tg mice (Fig. 4C). Consistent with previous results (10), most dividing cells in WT mice were found in the c-kit–CD25– population consequent to -selection (9) and in the pro-T cell popoulation due to their IL-7-dependent proliferation. WT and Tg- mice contained comparable numbers of dividing progenitors, indicating that proliferation rates of early progenitors are not grossly altered by the TCR and TCR transgenes. Tg- mice displayed a faster down-modulation of CD25 at the pre-T cell stage and contained a higher fraction of cells dividing at this stage, consequent to their more efficient selection due to the expression of the transgenic TCR chain. Interestingly, the same phenotype was also evident in Tg-( x ) mice. These experiments indicate that the proliferation and death rates of early T cell precursors in the thymus are not grossly altered by the TCR and TCR transgenes.
Developmentally regulated transcription of the TCR transgene in Tg- mice
An important difference between and T cells resides in the fact that rearranged TCR genes are not transcribed in cells. This is believed to be the consequence of the activity in lineage cells of a transcriptional silencer located in the 3' region of the C gene segments (39). The molecular identity of the TCR silencer is not known, but its activity is evident already in CD4–CD8+ immature cells that are the immediate precursors of the DP cells (40, 41). To ascertain that the functionally rearranged V1J4C4 transgene contained the regulatory elements required for its cell-specific transcription, we analyzed, by quantitative RT-PCR, transgenic mRNA levels in sorted and thymocyte populations and in peripheral B cells isolated from Tg- mice and in V1+ thymocytes isolated from normal mice (Fig. 5A). Compared with a normal V1+ thymocte population, the V1+ Tg thymocyte population expressed a 2-fold increase in the levels of V1C4 mRNA (Fig. 5B), which correlates well with the estimated number (2, 3) of integrated copies of the transgene in this Tg line (data not shown). In contrast, the transgene mRNA levels observed in DP thymocytes, or peripheral T and B cells were 100- to 1000-fold lower than those observed in Tg T cells. Because the transgene could be amplified from DNA isolated from the same sorted populations (data not shown), these data indicate that transcription of the V1C4 transgene is regulated in a cell and developmentally specific fashion that resembles that of endogenous TCR genes.
|
transgene in Tg- mice allows the analysis of its expression during early T cell development (Fig. 5B). In WT mice, transcription of rearranged V1C4 genes is first detected at the pro-T cell stage and increases 50-fold at the pre-T cell stage, in which it represents about one-tenth of the transcript levels found in sorted V1+ cells. These levels correlate with the extent of V1-J4 rearrangements found in the different developmental stages (6, 7) (data not shown). In Tg- mice, in contrast, low levels of V1C4 transgene mRNA were already detectable in the earliest thymic progenitors and increased 40-fold at the pro-T cell stage, whereby keeping roughly constant throughout differentiation. Interestingly, mRNA levels found in T cell progenitors were at least 20-fold lower than those found in trangenic + thymocytes. These data could indicate that transcription of the V1C4 transgene is activated concomitantly with differentiation along the lineage. However, the correlation between mRNA levels and V1-J4 rearrangements in different developmental stages in WT mice rather suggests that only a small fraction (5%) of pro-T and pre-T cells in Tg- mice expresses high levels of the transgene. Consistent with this interpretation is the fact that about one-half of the + thymocytes present in Tg- mice express c-kit at the cell surface, indicating that a large fraction of them develop into T cells at stages in which this marker is constitutively expressed, most likely at the pro-T cell stage, a possibility that has been previously suggested in normal mice (6, 7). |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and lineage cells from progenitor cells that could in theory simultaneously express a TCR and a pre-TCR. Such independence could result either from different outcomes of similar signals in individual progenitor cells or by the predominant, if not exclusive, expression of one or another receptor in different precursor cells. Regardless of the mechanism, our data imply a heterogeneity of progenitor cells that must be individually biased, if not committed, to developing into or lineage cells independently of the nature of the functional TCR chains that they may express and, therefore, of the type of receptor that they may express at the cell surface.
The fact that Tg- and Tg-( x ) mice contain similar number of thymocytes and Tg- and Tg-( x ) mice contain comparable numbers of DP and mature SP cells appears, at first sight, most compatible with models in which commitment to either lineage is initiated independently of TCR expression (42, 43). Moreover, these data also reveal a lack of dominance of one receptor over the other in developing cells that may potentially express simultaneously a TCR and a pre-TCR. This could imply that developing cells do not differentiate between signals mediated by either of the two receptors, a possibility that is also suggested by the fact that the TCR can substitute for the TCR in the development of lineage cells (35, 37) and, conversely, that the TCR can promote differentiation of cells along the pathway, albeit inefficiently (42, 44, 45). However, the relative inefficiency of the TCR to promote full differentiation along the lineage rather suggests that the TCR and the pre-TCR have different signaling capacities, as it has been suggested by the constitutive expression of the pre-TCR, but not of the TCR, in lipid rafts (46).
Alternatively, lack of evident competition between the TCR and the pre-TCR may reflect the fact that most T cell progenitors do not express simultaneously both receptors at the cell surface. One possible way to achieve this exclusion is through regulation of the transcription of TCR genes and/or the pT gene. Thus, it is well established that rearranged TCR genes are not transcribed in T cells (39). Although TCR-silencer activity has been shown in CD4–CD8+ immature cells that are the immediate precursors of the DP cells (40, 41), there is evidence suggesting that transcription of TCR genes is developmentally regulated at earlier stages of T cell development, at least in TCR or TCR Tg mice. Thus, we have shown in this study that most pro-T and pre-T cells in Tg- mice do not transcribe the TCR transgene or they do so at very low levels. Furthermore, the generation of DP cells mediated by the artificial formation of a TCR/pT complex in TCR transgenic mice only occurs in the absence of the regulatory elements containing the putative TCR silencer (47), suggesting that repression of TCR gene expression may already take place before or concomitant to TCR selection.
Although repression of the TCR transgene at early developmental stages in Tg- mice most likely contributes to the apparently normal development of T cells in these mice, it is unlikely that TCR genes are constitutively silent in putative lineage-committed T cell progenitors (39). Thus, the repeatedly observed selection against productive TCR and TCR genes in DP cells (6, 7, 19, 48, 49) necessarily implies that the products of both genes were expressed in earlier progenitor cells. Why, then, are TCR genes repressed in pro-T and pre-T cells in Tg- mice, but not in WT mice? One possibility would be that there is a strong selection for progenitor cells that have lost expression of the transgene in a silencer-independent manner. This possibility is rather unlikely because: 1) the TCR and TCR trangenes are expressed in most T cells developing in the same thymus; 2) there is no evidence for a higher rate of proliferation of progenitor cells in Tg- mice, which could be expected if development along the pathway would depend on the selection and expansion of rare cells; and 3) pro-T cells and pre-T cells isolated from adult thymi of Tg- mice can efficiently develop into T cells in vitro (data not shown). An attractive possibility would be that the transcription of the TCR (trans)genes is regulated by cellular or environmental factors that differ between WT and Tg- mice, an obvious candidate being the thymocytes themselves. Additional experiments will attempt to test this possibility.
Lack of competition between the TCR and the pre-TCR may also be due to the regulation of the expression of the pTa gene. Thus, it has been shown recently that expression of pT is heterogeneous at early stages of T cell development (50), and a correlation between expression levels of the pre-TCR at the cell surface in pre-T cells and development along the lineage pathway has been reported (51). However, the simple idea that pT is only expressed in cells committed to the lineage (13) has been excluded by recent experiments showing that pT-expressing T cell progenitors were able to generate both and T cells (50). Nevertheless, it remains possible that pT and TCR genes are regulated in such a way that most T cell progenitors only express one of the two at defined developmental time points.
Our data are not readily compatible with a role of the pre-TCR in committing cells to the lineage pathway of differentiation (16, 21, 26). It rather suggests that the previously observed effects of the pre-TCR in blocking T cell differentiation are mostly due to its ability to inhibit rearrangements at the TCR loci in precursor cells. Thus, the absence of T cells in TCR Tg mice (20, 22, 23) as well as the fact that T cells from normal mice are depleted of functional TCR rearrangements when compared with T cells from pT-deficient mice (26) could easily be explained if signaling through the pre-TCR not only induces changes inchromatin accessibility at the TCR locus, but also contributes to the termination of recombination at the TCR and/or TCR loci. This could be achieved either by specific changes in accessibility of these loci or by the down-regulation of the expression of the Rag genes upon pre-TCR signaling. Furthermore, alternative mechanisms may explain the fact that pT-deficient mice contain an increased number of thymocytes (24, 25). Thus, we (52) and others (53) have previously reported that mice lacking normal numbers of NK T cells or CD8+ cells, as is the case in pT-deficient mice (8, 54), harbor elevated numbers of a particular subset of thymocytes usually referred to as the Thy-1dull thymocyte population (33). The size of this population results from an extensive expansion of cells originating in the fetal or newborn thymus and is independent of the new generation of thymocytes (55). Although the existence of Thy-1dull thymocytes in pT-deficient mice has not been directly addressed, the fact that a fraction of thymocytes found in pT-deficient mice coexpresses CD4, a hallmark of Thy-1dull thymocytes (33), together with the presence of increased numbers of these cells in other mutant strains lacking T cells, makes this possibility very likely.
|
Footnotes |
|---|
1 This work was supported by institutional grants and by grants from the Association pour la Recherche sur le Cancer. 
2 Address correspondence and reprint requests to Dr. Pablo Pereira, Unité du Développement des Lymphocytes, Institut Pasteur, 25 Rue du Dr. Roux, 75724 Paris Cedex 15, France. E-mail address: ppereira{at}pasteur.fr
3 Abbreviations used in this paper: DN, double negative; DP, double positive; HPRT, hypoxanthine phosphoribosyltransferase; pT, pre-TCR chain; SP, single positive; Tg, transgenic; WT, wild type.
Received for publication December 1, 2003. Accepted for publication June 9, 2004.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
or - lineages can occur just prior to the onset of CD4 and CD8 expression among immature thymocytes. Eur. J. Immunol. 22:2185.[Medline]
and TCR proteins during adult thymus development. Int. Immunol. 11:1641. gene rearrangement and role of TCR- expression during CD3–CD4–CD8– thymocyte differentiation. J. Immunol. 152:4783.[Abstract]
, , and rearrangements during adult thymic development: T cell receptor rearrangements are present in CD44+CD25+ pro-T thymocytes. Proc. Natl. Acad. Sci. USA 95:12522. gene in the development of but not T cells. Nature 375:795.[Medline]
chain gene rearrangement and selection during thymocyte development in adult mice. Immunity 1:83.[Medline]
selection events in cell development. Immunity 7:83.[Medline]
expression. Immunity 8:427.[Medline]
/ lineage commitment in the thymus of normal and genetically manipulated animals. Adv. Immunol. 71:1.
/ versus / T cell lineage commitment. Semin. Immunol. 11:239.[Medline]
TCR+ and TCR+ T cells from a common precursor. Semin. Immunol. 9:171.[Medline]
selection, TCR allelic exclusion and versus lineage commitment. Immunol. Rev. 165:111.[Medline]
versus T-cell lineage choice. Curr. Opin. Immunol. 10:181.[Medline]
/ lineage commitment: clues from intracellular TCR staining. Immunol. Rev. 165:87.[Medline]
and T cells can share a late common precursor. Curr. Biol. 5:659.[Medline]
