The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hata, K.
Right arrow Articles by Mizuguchi, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hata, K.
Right arrow Articles by Mizuguchi, J.
The Journal of Immunology, 2004, 173: 2453-2461.
Copyright © 2004 by The American Association of Immunologists

CD40 Ligand Rescues Inhibitor of Differentiation 3-Mediated G1 Arrest Induced by Anti-IgM in WEHI-231 B Lymphoma Cells1

Kikumi Hata*,{dagger}, Takayuki Yoshimoto{dagger} and Junichiro Mizuguchi2,*,{dagger}

* Department of Immunology and {dagger} Intractable Immune System Disease Research Center, Tokyo Medical University, Tokyo, Japan


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The engagement of membrane-bound Igs (mIgs) results in growth arrest, accompanied by apoptosis, in the WEHI-231 murine B lymphoma cells, a cell line model representative of primary immature B cells. Inhibitor of differentiation (Id) proteins, members of the helix-loop-helix protein family, functions in proliferation, differentiation, and apoptosis in a variety of cell types. In this study, we analyzed the involvement of Id protein in mIg-induced growth arrest and apoptosis in WEHI-231 cells. Following stimulation with anti-IgM, expression of Id3 was up-regulated at both the mRNA and protein levels; this up-regulation could be reversed by CD40L treatment. Retrovirus-mediated transduction of the Id3 gene into WEHI-231 cells resulted in an accumulation of the cells in G1 phase, but did not induce apoptosis. E box-binding activity decreased in response to anti-IgM administration, but increased after stimulation with either CD40L alone or anti-IgM plus CD40L, suggesting that E box-binding activity correlates with cell cycle progression. WEHI-231 cells overexpressing Id3 accumulated in G1 phase, which was accompanied by reduced levels of cyclin D2, cyclin E, and cyclin A, and a reciprocal up-regulation of p27Kip1. Both the helix-loop-helix and the C-terminal regions of Id3 were required for growth-suppressive activity. These data suggest that Id3 mimics mIg-mediated G1 arrest in WEHI-231 cells.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The elimination of high affinity self-reactive T and/or B cells most likely contributes to self-tolerance, an unresponsiveness to self Ags (1). Although self-reactive immature B cells are eliminated by interactions of the BCR with self Ags, mature B cells initiate immune responses through the interaction of BCR with foreign Ags (2, 3, 4). The molecular mechanism(s) that enables signaling through the same pathways to mediate distinct responses has remained largely unresolved. B lymphoma cell lines, such as WEHI-231 and CH31, serve as models of primary immature B cells to analyze the molecular mechanisms underlying BCR-mediated signaling resulting in G1 arrest, followed by apoptotic cell death (5, 6, 7, 8). Growth arrest and/or apoptosis in WEHI-231 cells following engagement of membrane-bound Ig (mIg)3 could be prevented by interaction with T cells, T cell-derived products, including CD40L, or anti-CD40 mAb (9, 10, 11, 12, 13). Thus, these tumor cell lines provide a valuable model for analysis of B cell tolerance and the breakdown of tolerance by autoreactive T cells.

The basic helix-loop-helix (bHLH) family of transcription factors plays a critical role in cell differentiation, proliferation, and apoptosis in a variety of cell types, including lymphocytes (14, 15, 16, 17). Recent gene-targeting experiments have demonstrated that E2A, a bHLH protein subfamily, is critical for lymphocyte development (17, 18, 19). The E protein subset of bHLH proteins contains a highly conserved HLH dimerization domain and a DNA-binding basic region that binds a conserved E box motif (20). Of the ubiquitously expressed proteins, the E2A proteins include E2-2, HEB, and the E2A gene products E12 and E47. Another category of E protein, the inhibitor of differentiation (Id) family, possesses four mammalian members: Id1–Id4 (14, 21). Although Id proteins have highly homologous HLH domains, they function as negative regulators of other bHLH transcription factors: as these proteins lack a DNA binding domain, the formation of dimers with other bHLH protein prevents transcriptional activation in a dominant-negative fashion. Id proteins appear to promote cell cycle progression from G1 to S phase, while inhibiting differentiation (15, 22). Mature B cells from Id3-deficient mice demonstrate impaired proliferative responses to anti-IgM (23). The stimulation of fibroblasts with serum or growth factors induces the transcription of Id1, Id2, and Id3 (24, 25, 26). In contrast, E2A proteins promote cell differentiation, while inhibiting cell growth (14, 27, 28). E2A proteins are required for early lymphocyte development and isotype switching, a late event in B cell maturation (17, 29). Contrary to the current notion that E2A inhibits G1 progression, Zhao et al. (30) recently demonstrated that E2A can promote cell cycle progression in a subset of cell types. Thus, activities of E2A and/or Ids may be dependent on cell type and activation status.

The progression from G1 to S phase in mammalian cells, including B cells, is strictly controlled by a set of cyclin-dependent kinases (CDKs) and their regulatory partners, cyclins (31, 32, 33, 34). The D-type cyclins (cyclin D1, D2, and D3) are required for passage through the restriction point in late G1, the point at which cells become committed to division irrespective of the mitogenic stimuli. Cyclins E and A are required for the initiation of S phase. Although cyclins E/A bind CDK2, the D-type cyclins bind and activate CDK4 and CDK6. The retinoblastoma gene product is the target of the G1-specific CDK/cyclin complexes (35). CDK activity is regulated by CDK inhibitors (CKIs), including the Cip/Kip proteins (p21Cip1, p27Kip1, and p57Kip2) (32). These Cip/Kip proteins inhibit both D cyclin-CDK4/6 and A/E cyclin-CDK2 complexes. The down-regulation of cyclins, accompanied by an up-regulation of p27Kip1, follows mIg engagement in WEHI-231 cells (33, 34).

In this study, we examined the involvement of E2A/Id3 transcription factors in mIg-mediated growth arrest and apoptosis in WEHI-231 cells. Surprisingly, treatment with anti-IgM induces an immediate and sustained increase in Id3 expression at both the mRNA and protein levels, which most likely promotes cell cycle progression. WEHI-231 cell lines overexpressing Id3 accumulate in G1 phase, probably mediated by the down-regulation of several cyclins, including cyclin D2, with an up-regulation of p27Kip1. Our observations provide insight into the molecular mechanisms underlying mIg-mediated activation or inactivation of B lymphocytes through Ag receptor signaling.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cell culture

WEHI-231 cells were maintained at 37°C in 5% CO2 in RPMI 1640 medium supplemented with 10% FBS, 50 µM 2-ME, and 100 µg/ml kanamycin. WEHI-231 cells were cultured with anti-IgM mAb (rat IgG, Bet-1) (a gift from W. Paul, National Institutes of Health, Bethesda, MD), control irrelevant anti-CD4 mAb (rat IgG, GK1.5) (American Type Culture Collection, Manassas, VA), or medium alone for the indicated times, in the presence of either irradiated (40,000 rad) CD40L-expressing Chinese hamster ovary (CHO) cells (36) (a kind gift from H. Yagita, Juntendo University, Tokyo, Japan) or control CHO cells.

Northern blot analysis

Total RNA was isolated from WEHI-231 cells stimulated with anti-IgM alone, CD40L alone, or the combination of both stimuli using TRI REAGENT (Sigma-Aldrich, St. Louis, MO), according to the manufacturer’s instructions. RNA samples were run on 1% agarose gels and transferred to nylon membrane, as described previously (37). Filters were prehybridized with a buffer (0.25 M Na2HPO4, pH 7.2, 7% SDS) and then hybridized for at least 12 h with 32P-labeled DNA probes (350- to 750-bp fragments) at 65°C. The fragments were generated using primers specific for E2A, Id3, or GAPDH (primer sequences available upon request). After hybridization, free probe was removed by washing. Radioactive labeled fragments were detected by autoradiography.

Western blot analysis

Cells were solubilized in lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Triton X-100, 1 mM PMSF, 1 µg/ml leupeptin, 1 µg/ml aprotinin) on ice for 30 min. Protein concentrations were measured using Bio-Rad DC protein assay kit (Bio-Rad, Hercules, CA). Equivalent amounts of protein were separated on 8–18% SDS-PAGE, and detected by Western blotting, as described (38). Anti-CDK4 (C8218), anti-CDK6 (C8348), anti-cyclin A (C4710), anti-cyclin D2 (C7339), anti-cyclin E (C4976), and anti-actin (A2066) were purchased from Sigma-Aldrich; anti-Id2, anti-Id3 (66701A), anti-E47 (13341A), and anti-CDK2 were obtained from BD Biosciences (San Jose, CA); while anti-V5 mAb was acquired from Invitrogen Life Technologies (Carlsbad, CA). Following incubation of blots with the indicated primary Abs, membranes were washed extensively. Bound Ab was detected with HRP-labeled goat anti-rabbit IgG or HRP-labeled goat anti-mouse IgG (Cappel, Aurora, OH). Following several washes, membrane-bound HRP-conjugated Ab was visualized by ECL, according to the manufacturer’s recommendations (Amersham Biosciences, Buckinghamshire, U.K.). The intensity of each band was measured using densitometer (NIH Image).

Construction of retroviral vectors

The cDNA for mouse Id3 was generated by RT-PCR using mouse Id3-specific primers. The cDNA sequence was confirmed by sequence analysis. Id3 was introduced into the retroviral vector pMX-IRES-GFP (39) (a kind gift of T. Kitamura, Institute of Medical Science, University of Tokyo, Tokyo, Japan), upstream of an internal ribosomal entry site (IRES) controlling expression of GFP. The GFP-encoding sequence was replaced by a cDNA encoding enhanced GFP (EGFP) (BD Biosciences), to create pMX-Id3-IRES-EGFP (pMX-Id3/EGFP).

Retrovirus production and transduction

Recombinant retrovirus was produced by transient transfection of the Phoenix-ecotropic packaging cell line ({varphi}NX) (a kind gift from G. Nolan, Stanford University, Stanford, CA) using FuGene-6 transfection reagent (Roche, Indianapolis, IN). Viral supernatants were harvested 24, 48, and 72 h after transfection, and stored at –80°C until use. Supernatants were incubated with 10 µg/ml hexadimethrine bromide (Sigma-Aldrich) on ice for 10 min just before infection. A modified version of a spin transduction method described by Kotani et al. (40) was used to infect cells. Briefly, cells (1 x 105/well) in 24-well plates were centrifuged with 0.5 ml of the viral supernatants at 1200 x g at room temperature for 90 min. After removal of the viral supernatants, cells were cultured with complete RPMI 1640 for the indicated periods before experimentation.

Flow cytometric analysis of apoptosis and cell cycle phase

Apoptosis and/or cell cycle phase were evaluated by flow cytometric analysis, as described (38). Briefly, cells were fixed in 70% ethanol at 4°C for 30 min, incubated with 500 µg/ml RNase at 37°C for 30 min, and then stained with propidium iodide (PI; 50 µg/ml). Sample DNA content was analyzed by flow cytometry (FACSCalibur; BD Biosciences). The proportion of cells in different cell cycle phases and undergoing apoptosis was calculated as percentages from statistics generated using CellQuest software (BD Immunocytometry Systems, San Jose, CA). When indicated, apoptosis was also evaluated using an annexin V-Cy5 apoptosis detection kit, according to the manufacturer’s instructions (Bio Vision, Mountain View, CA). Cells infected with a retrovirus encoding either Id3/EGFP or EGFP alone were cultured for the indicated times: cells positive for EGFP expression were then sorted using a FACSCalibur cytometer, followed by analysis of DNA content.

EMSA

The 32P-labeled oligonucleotide probe containing the Oct1 or µE5 site was incubated on ice for 40 min with 1 µg of protein from WEHI-231 nuclear extracts and 0.5 µg of poly(dI-dC) in 20 µl of binding buffer (10 mM HEPES, pH 8.0, 50 mM KCl, 1.25 mM MgCl2, 0.1 mM EDTA, 0.5 mM DTT, 10% glycerol). The sequence of the oligonucleotide was described, as previously described (41). For competition assays, either wild-type (WT) (AGCTGCTGCAGGTGTTCTTCGA) or mutant (AGCTGCTGACGGGTTTCTTCGA) oligonucleotides were added to the mixture of labeled µE5 probe and nuclear extracts. Samples were analyzed by 5% nondenaturing PAGE and visualized with a BAS 2000 bioimaging analyzer (Fuji, Minato-ku, Tokyo, Japan). In some experiments, the nuclear extracts were preincubated with Abs for 40 min before incubation with labeled DNA. Anti-E2A mAb (IgG1) was obtained from Santa Cruz Biotechnology (Santa Cruz, CA); control irrelevant anti-TLR10 mAb (IgG1) was from Imgenex (San Diego, CA); and goat anti-E2-2 Abs were from Abcam (Cambridge, U.K.).

Generation of stable lines overexpressing Id3

WEHI-231 cells were transduced with pMX-Id3/EGFP or pMX-EGFP retrovirus. After incubation with culture medium, several transformants were generated, followed by limiting dilution to obtain individual clone.

Deletion mutants of Id3

WT and mutant Id3 constructs with an N-terminal FLAG were generated by PCR. Resulting PCR products were subcloned into p3xFLAG-CMV-10 (Sigma-Aldrich). The sequences of the generated constructs were confirmed by nucleotide sequencing. These constructs were then transferred into the retroviral vector: WT and Id3-expressing retroviruses were produced, as described above. The biological activities of both the WT or mutant FLAG-tagged Id3 retroviruses were evaluated by their ability to influence growth of WEHI-231 cells.

Statistical analysis

Data were expressed as means ± SD for each experimental condition. Statistical significance was determined by Student’s t test. A value of p < 0.01 was considered to indicate statistically significant differences.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Anti-IgM induces an up-regulation of Id3, which can be reversed by coincubation with CD40L

Culture of WEHI-231 B lymphoma cells with 10 µg/ml anti-IgM in the presence of irradiated CHO cells induced G1 arrest and/or apoptosis. mIg-induced growth arrest could be reversed by coincubation with irradiated CHO cells expressing CD40L (K. Hata, unpublished observation), as reported previously (12, 13). As E2A and Id family members are involved in cell proliferation, differentiation, and apoptosis (14, 15, 17), we examined the levels of E2A and Ids expressed in WEHI-231 B lymphoma cells by Northern blot following mIg engagement. E2A expression was initially down-regulated by anti-IgM, followed by a small rise at 8 h (1.8-fold), but was up-regulated at low levels following CD40L stimulation, peaking at 2 h (1.8-fold increase) and then declining after 24 h (1.4-fold), when normalized to the GAPDH loading controls (Fig. 1A). Combined stimulation with anti-IgM and CD40L resulted in E2A levels below those seen in unstimulated cells. In contrast, we observed a transient up-regulation of Id3 expression at 2 h after anti-IgM stimulation, which leveled off at 4 h, only to increase again to 24 h to reach levels 5-fold greater than that seen in unstimulated cells. Id3 expression was down-regulated by treatment with either CD40L or anti-IgM plus CD40L (Fig. 1A). The anti-IgM-induced up-regulation of Id2 mRNA was transient, returning to baseline levels 8 h after stimulation. The treatment with CD40L, which reverses anti-IgM-induced growth arrest in WEHI-231 cells (12, 13), also up-regulated Id2 mRNA expression (Fig. 1A). Neither Id1 nor Id4 mRNA was detectable in WEHI-231 cells (K. Hata, unpublished observation).



View larger version (35K):
[in this window]
[in a new window]
  		FIGURE 1. The kinetics of E2A and Id3 expression in WEHI-231 cells following stimulation with anti-IgM, CD40L, or anti-IgM and CD40L together. A, WEHI-231 cells were stimulated with 10 µg/ml anti-IgM or control medium alone for the indicated times in the presence of either CD40L-expressing or control CHO cells. mRNA expression levels for E2A, Id2, Id3, or control GAPDH were determined by Northern blot. B, Id3 and actin protein levels were assessed by Western blot, as described in Materials and Methods. E2A, Id2, or Id3 expression levels were normalized to GAPDH (for mRNA) or actin (for protein) signals and expressed as the fold over the levels of E2A, Id2, or Id3 seen in unstimulated cells. Blots representative of three to four independent experiments are shown.

 
We analyzed the kinetics of Id3 expression after anti-IgM stimulation by Western blotting, because anti-IgM-induced up-regulation of Id3 mRNA expression appeared to correlate with the growth inhibition. Anti-IgM treatment induced the up-regulation of Id3 protein only marginally at 10 h and substantially at 24 h after stimulation, while either CD40L alone or CD40L plus anti-IgM caused the down-regulation of Id3 (Fig. 1B), when normalized to the actin-loading controls, as observed by Northern blot analysis. Stimulation with control irrelevant mAb (anti-CD4) had no effect on the expression of both E2A and Ids (K. Hata, unpublished observation). Together, the up-regulation of Id3 expression at both the mRNA and protein levels appears to correlate with the growth inhibition induced by anti-IgM treatment, which can be abolished by costimulation with CD40L.

Id3 induces the accumulation of cells in G1 phase

Cell growth is regulated by the balance between cellular proliferation and cell survival/death. Then we examined the effect of Id3 on cell cycle progression and cell survival using the pMX-Id3/EGFP retroviral vector (39). This vector contains a bicistronic mRNA encompassing the Id3 and EGFP genes controlled by the long terminal repeat promoter. WEHI-231 cells were transduced with retrovirus encoding either Id3/EGFP or EGFP alone: EGFP expression was monitored by flow cytometry. After transduction, the proportion of EGFP-positive cells in the population transduced with control EGFP remained constant up to 5 days after infection, whereas the proportion of Id3/EGFP-transduced cells decreased with time (Fig. 2A). These results suggest that Id3 induces growth inhibition in WEHI-231 cells. There were no apparent differences in the percentages of annexin V-positive cells between cells transduced with either control EGFP or Id3/EGFP: a comparable proportion of apoptotic cells was obtained in both groups following stimulation with anti-IgM (Fig. 2B), suggesting that Id3 alone cannot induce apoptosis in WEHI-231 cells.



View larger version (43K):
[in this window]
[in a new window]
  		FIGURE 2. Retroviral transduction of the Id3 gene into WEHI-231 cells results in growth arrest, but not apoptosis. A, WEHI-231 cells transduced with a retrovirus containing either Id3/EGFP or control EGFP alone were cultured for 5 days. The ratio of EGFP-positive cells was measured by flow cytometry and expressed as the percentage of EGFP-positive cells at the indicated day divided by the percentage of EGFP-positive cells at day 1. B, Cells transduced with a retrovirus encoding Id3/EGFP or control EGFP alone were cultured with 10 µg/ml anti-IgM or medium alone for 48 h. Cell samples were then stained with annexin-Cy5, followed by flow cytometric analysis. C, EGFP-positive cells were isolated from the retrovirally transduced cells by fluorescence-activated cell sorting: cell cycle analysis was evaluated by PI staining method. D, The percentage of cells in G1, S, and G2/M phase was determined by dividing the number of cells in G1, S, and G2/M by the total number of cells, multiplied by 100. The results are represented as a percentage ± the SD from four independent experiments (D). *, Significantly different from cells transduced with control EGFP alone.

 
To examine the effect of Id3 on cell cycle progression, we sorted EGFP-positive cells from the control EGFP- and Id3/EGFP-transduced cells. PI staining (Fig. 2C) revealed that the proportion of cells in G1 phase increased in Id3/EGFP-transduced cells in comparison with control EGFP-transduced cells (Fig. 2D). These findings suggest that Id3 induces growth arrest by reducing the number of cells entering the G1 to S phase transition.

Anti-IgM reduces E box-binding activity, which can be reversed by coincubation with CD40L

Ids form heterodimers with E proteins, resulting in a decrease in E box-binding activity (15). We therefore examined E box-binding activity by EMSA following stimulation with anti-IgM or CD40L. Incubation of a labeled probe containing an E box site with nuclear extracts from WEHI-231 cells detected a single E box-protein complex (Fig. 3A), as reported by Bain et al. (41). Formation of this complex was inhibited by WT, but not mutant, oligonucleotides (Fig. 3A), suggesting that a nuclear protein binds specifically to the E box motif. Furthermore, consistent with the observation that the predominant E box-binding species comprises E47 homodimers (42), addition of Ab with specificity for E2A resulted in a complete disruption of the complex formation (Fig. 3B). Conversely, Abs directed against related bHLH protein E2-2 did not interfere with E box-binding activity.



View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 3. Anti-IgM stimulation reduces E box-binding activity in WEHI-231 cells, while CD40L treatment enhances E box-binding. WEHI-231 cells simulated with anti-IgM, CD40L, the combination of anti-IgM and CD40L, or control medium alone for the indicated times were assessed by EMSA. A, The labeled probe was incubated with nuclear extracts from WEHI-231 cells in the presence (WT, lanes 2 and 3; mutated, lanes 4 and 5) or absence (lane 1) of competitors. Either 5-fold (lanes 2 and 4) or 50-fold excess (lanes 3 and 5) was used for the competition. B, The extracted were preincubated for 40 min without (lane 1) or with control irrelevant Ab (lane 2), anti-E2A (lane 3), or anti-E2-2 mAb (lane 4) before the binding reactions. C, The kinetics of E box-binding activity of the nuclear extracts of WEHI-231 cells following stimulation with 10 µg/ml anti-IgM, CD40L, or both stimuli. The µE5 or control Oct1 oligonucleotide was used for EMSA. D, The relative activity at the indicated time points was determined by quantitation of densitometer and expressed as a percentage of levels seen in unstimulated cells. One representative experiment of three is shown.

 
E box-binding activity was reduced immediately after stimulation with anti-IgM, whereas CD40L administration potentiated this activity, when noralized to the Oct1 controls (Fig. 3, C and D). Simultaneous addition of anti-IgM and CD40L resulted in an initial decrease in the E box-binding activity between 1 and 4 h, followed by a gradual increase in activity peaking at 24 h after stimulation (3.5-fold increase from the levels observed for cells treated with medium alone). These results suggest that E box-binding activity correlates with cell growth in WEHI-231 B lymphoma cells following stimulation with anti-IgM, CD40L, or anti-IgM with CD40L.

WEHI-231 cell lines overexpressing Id3 accumulate in G1 phase

To further examine the potential role for Id3 in cell cycle progression, we established WEHI 231 cell lines overexpressing Id3 through retroviral transduction of either pMX-Id3/EGFP or control pMX/EGFP. Two cell lines, Id3/EGFP-4 and -43, displayed elevated levels of Id3 protein in comparison with two clones expressing EGFP alone, EGFP-3 and -5 (Fig. 4A). Both lines (Id3/EGFP-4 and -43) contained an increased proportion of cells in G1 phase in comparison with the WT cells and those transfected with control EGFP alone (Fig. 4B). As expected, cell lines expressing high levels of Id3 exhibited a diminished E box-binding activity in comparison with cells expressing EGFP alone (Fig. 4C). These results suggest that Id3 inhibits the progression of WEHI-231 cells from G1 to S phase.



View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 4. The establishment of WEHI-231 cell lines overexpressing Id3. WEHI-231 cells transduced with a retrovirus encoding either Id3/EGFP or control EGFP were selected in the RPMI 1640 medium. Individual clones were obtained by limiting dilution. A, WT WEHI-231 cells or transformants (Id3, 4, and 43; control EGFP, 3, 5, and 12) were assayed for Id3 and actin protein expression by Western blotting. B, Cell cycle distribution of the transformants was determined by flow cytometry, as described in Fig. 2C. C, We also determined the E box-binding and octamer-binding activity of the nuclear extracts from the transformants, as described in Fig. 3B. One representative experiment of three is shown.

 
Cyclin D2, cyclin A, and cyclin E proteins are down-regulated in Id3/EGFP-expressing cell lines, whereas p27Kip1 protein is up-regulated

The transition from G1 to S phase in mammalian cells involves a set of nuclear proteins, including cyclins, CDKs, CKIs, and retinoblastoma gene product proteins (32, 33, 34). We determined the expression levels of these proteins in cell lines overexpressing either Id3/EGFP or EGFP alone by Western blotting. The expression of cyclin D2, cyclin A, and cyclin E in Id3/EGFP cell lines was substantially down-regulated, whereas that of CDK4 and CDK6 was comparable to that seen in control EGFP-expressing cell lines (Fig. 5). The levels of CDK2 proteins produced by one (Id3–4) of the two Id3-expressing cell lines were unaltered in comparison with the control EGFP-expressing cell lines, while expression was severely decreased in the other cell line (Id3–43). In contrast, p27Kip1 expression was markedly elevated in both Id3-expressing cell lines, in comparison with cells transduced with EGFP alone. Thus, Id3-mediated down-regulation of cyclin D2, cyclin A, and cyclin E, together with the up-regulation of p27Kip1, functions in Id3-mediated G1 growth arrest/retardation.



View larger version (39K):
[in this window]
[in a new window]
  		FIGURE 5. Decreased expression of several cyclin genes accompanied by an increased expression of p27Kip1 gene in WEHI-231 cells expressing Id3. WT, Id3-expressing, or control EGFP-expressing cells were assayed for the expression of CDKs (-2, -4, and -6), cyclins (-D2, -A, and -E), and p27Kip1 by Western blotting. Expression levels were determined, as described in Fig. 1B. One representative experiment of three is shown.

 
Both the HLH and the C-terminal portions of Id3 protein are responsible for Id3-mediated growth arrest

To identify the region of Id3 responsible for mediating growth arrest, we prepared several deletion mutants of the Id3 gene, as described by Chen et al. (43). The N-terminal region (aa 2–40), the HLH region (aa 41–80), the C-terminal region (aa 81–119), and various combinations of these domains were fused to the FLAG tag and introduced into retroviral vectors (Fig. 6A), as described in Materials and Methods. Retroviruses containing various regions of the Id3 gene were transduced into WEHI-231 cells: EGFP expression was monitored by flow cytometry. Western blotting analysis demonstrated that the various mutant forms of Id3 were expressed to almost the same levels, except Id3{Delta}C with a slightly lower level than WT Id3 in WEHI-231 cells (Fig. 6B). Although the Id3{Delta}40N mutant exhibited a slightly stronger activity to inhibit cell growth than WT Id3, the other Id3 mutants (Id3/{Delta}39C, Id3{Delta}HLH, Id3{Delta}40N/HLH, and Id3{Delta}40N/39C) failed to inhibit growth (Fig. 6C). A mutant Id3 in which serine 5 was replaced with an aspartate 5 retained the capacity to inhibit cell growth (K. Hata, unpublished observation). These results suggest that both the HLH and C-terminal regions of Id3 are required for Id3-mediated growth inhibition. Consistent with this notion, a mutant form of Id3 (Id3Pro49) (44) reported to alter the molecule’s helical structure failed to inhibit cell growth (Fig. 6C), suggesting that Id3-mediated growth inhibition requires the HLH region, probably through activity influenced by heterodimerization.



View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 6. Requirement of both the Id3 HLH and the C-terminal regions for the Id3-mediated growth inhibition. A, A schematic representation of Id3 (WT and Pro49 mutant) and various deletion constructs tagged with an N-terminal FLAG; deletion of the C terminus (Id3{Delta}C), the C and N termini (Id3{Delta}N/C), N terminus (Id3{Delta}N), the N terminus and HLH domain (Id3{Delta}N/HLH), or the HLH domain alone (Id3{Delta}HLH) is shown. B, Retroviruses encoding the Id3 or the indicated deletion constructs were transduced into WEHI-231 cells, as described in Fig. 2A. Expression of various deletions of Id3 in the retrovirally transduced cells was determined by Western blotting. C, The retrovirally transduced cells, as described in B, were cultured for the indicated times after infection: the proportion of EGFP-positive cells was determined, as described in Fig. 2A. One representative experiment of three is shown.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The engagement of mIg on the B lymphocyte cell surface can result in either activation (proliferation) or inactivation (anergy or apoptosis), depending on several factors, such as B cell maturational stage, the strength of mIg cross-linking, and the presence/absence of costimulator molecules, including CD40L (2, 3, 4, 5). Immature B cells are more sensitive to Ag-induced tolerance than mature B cells (2). WEHI-231 B lymphoma cells serve as a cell line model of primary immature B cells, often used as a model system to analyze mIg-mediated tolerance (10, 45). After the engagement of mIg, these cells undergo cell cycle arrest and eventual apoptosis. Coengagement of CD40 on B cells can reverse mIg-mediated cell cycle arrest (9, 11, 12, 13). E2A proteins belonging to the HLH family play a crucial role in B lymphocyte development, while Id proteins inhibit it (14, 15, 22). At a more basic level, Id proteins promote cell cycle progression (46), while E2A proteins impair it (17, 27, 28). Contrary to this notion, however, Zhao et al. (30) recently revealed that E2A proteins promote cell cycle progression in a subset of cell types. Moreover, Id2 is required for commitment to marginal zone B cells (47). Thus, the function of Ids might also depend on cell type and cellular activation status. In this study, WEHI-231 cells were used to examine the role of E2A/Id3 proteins in mIg-mediated growth inhibition of immature B cells.

The engagement of mIg on the surface of WEHI-231 cells resulted in a rapid up-regulation of Id3 mRNA, as has been reported in other cell types (15, 24). The enhanced levels of Id3 mRNA were sustained up to 24 h with only a small decrease at 4 h. The enhanced expression of Id3, however, could be abolished by coincubation with CD40L (Fig. 1A). In contrast, Id2 mRNA was transiently up-regulated by both anti-IgM and CD40L. Neither Id1 nor Id4, however, was identified by RT-PCR in WEHI-231 cells following any of the examined stimuli (K. Hata, unpublishedobservation). In agreement with our findings, TGF-{beta} both inhibited the growth of B lymphocyte progenitors and induced Id3 expression (48). Together, although the expression of Id2 mRNA is transiently up-regulated by either anti-IgM or CD40L, the expression of Id3 mRNA is enhanced only by anti-IgM, suggesting that the up-regulation of Id3 mRNA appears to correlate with growth inhibition of B lineage cells, including the WEHI-231 model of immature B cells.

The amount of cell growth is determined by the balance between cell proliferation and cell survival/apoptosis. Id proteins appear to promote cell cycle progression or apoptosis (16, 23, 46, 49, 50), while E2A proteins inhibit cell cycle progression (27, 28). Transient transfection of Id3 resulted in apoptosis of rat embryonic fibroblasts in culture medium deprived of serum (16). Massive thymic apoptosis was observed in Id1-transgenic mice (50). In contrast, retroviral transduction of the Id3 gene into WEHI-231 cells resulted in an accumulation of cells in G1 phase, but did not induce apoptosis (Fig. 2, B and D). E box-binding activity correlates well with the pattern observed for cell cycle progression in WEHI-231 cells; E box-binding activity was enhanced by CD40L treatment, but decreased following either exogenous Id3 expression or anti-IgM stimulation (Fig. 3, C and D). Zhao et al. (30) recently reported that E2A promotes cell cycle progression, while a dominant-negative form inhibits it in the pre-B cell line. These contradictory findings suggest that Id3 protein function differs depending between cell types and/or cellular maturational stages.

Immature B cells are susceptible to self Ag-induced apoptosis or anergy, while mature B cells proliferate following stimulation with foreign Ags (2, 3, 4). Mature B cells from Id3-deficient mice failed to proliferate in response to anti-IgM, while these cells exhibit proliferative responses comparable to primary WT B cells in response to LPS or CD40L (23). Mature T cells from Id3-deficient mice demonstrated equivalent proliferative responses to anti-CD3 mAb stimulation as those from WT mice (23). These results suggest that Id3 plays a crucial role in mIg-mediated proliferative responses in mature B cells. In contrast, WEHI-231 cells, a model for primary immature B cells, underwent growth inhibition following the engagement of mIgs or the ectopic expression of Id3 (5, 7, 10) (Figs. 2, C and D, and 4B). These data suggest that Id3 may contribute to the distinct fate of immature vs mature B cells following mIg engagement. Additional experiments will be required to address this hypothesis.

The G1 to S phase transition is regulated, at least in part by cyclins/CDKs and CKIs in mammalian cells (32, 33, 34). WEHI-231 cells overexpressing Id3 (Id3–4 and -43) displayed growth retardation, in comparison with WT and control EGFP-transduced cells; this retardation appeared to result from a prolonged time in G1 phase (Fig. 4, A and B). One of the Id3-overexpressing cell lines (Id3–43) proliferated despite a marked down-regulation of CDK2 (Fig. 5), thought to be essential in mammalian cell cycle progression through the G1/S phase transition. These findings are consistent with recent observations detailing that CDK2 is dispensable for mitotic cell division (51, 52). Id3-mediated growth inhibition might be accounted for in part by the reduced expression of cyclin D2, cyclin A, and cyclin E, together with the up-regulation of p27Kip1 (Fig. 5). Anti-IgM stimulation also caused WEHI-231 cells to up-regulate p27Kip1 expression, associated with a down-regulation in the expression of cyclins, including cyclin D2 (33, 34), suggesting that the activity of anti-IgM is partially mimicked by Id3. Consistent with our findings, Zhao et al. (30) recently reported that a dominant-negative form of E47 decreased the expression of cyclins D2, D3, and A. Id3-mediated reduction of E box-binding activity (Fig. 4C) may contribute to the changes in cyclin expression. We cannot formally exclude, however, the possibility that these changes are the indirect effects of a signal transduction pathway resulting from decreased cell cycle progression.

Id proteins, lacking the DNA-binding basic region of the HLH protein, function as negative regulators of other bHLH proteins through hetrodimer formation (14, 15). Formation of mixed hetrodimers results in the failure of bHLH transcriptional regulators to bind DNA. In addition, Id3 proteins can also associate with non-HLH proteins, including Pax-5 and the ternary complex factor subfamily of ETS-domain proteins (53, 54). Deletion mutants of Id3 gene revealed that both the HLH and C-terminal regions are required for Id3-induced growth inhibition (Fig. 6C). As the expression levels of a mutant Id3 protein lacking the C-terminal region were slightly lower than those of WT Id3 protein (Fig. 6B), the C-terminal region appeared to contribute to the stability of Id3 (43). Moreover, growth inhibition was not observed following expression of a Pro49 mutant of Id3 gene, which failed to heterodimerize with other bHLH protein targets (44). These data suggest that Id3-mediated growth inhibition requires heterodimerization.

Following mIg engagement, WEHI-231 B cells undergo growth arrest in G1 phase, accompanied by an immediate and sustained elevation of Id3 expression at both the mRNA and protein levels. Costimulation with CD40L reverses anti-IgM-induced G1 arrest, associated with concomitant down-regulation of Id3. Ectopic retroviral transduction of Id3 gene also results in growth arrest. Id3 thus mimics anti-IgM-mediated prevention of cell growth in WEHI-231 cells. Our findings thus provide valuable information furthering our understanding of mIg-mediated unresponsiveness in B cells.


   Acknowledgments
 
We thank Dr. William E. Paul (National Institutes of Health, Bethesda, MD), Dr. H. Yagita (Juntendo University), Dr. T. Kitamura (Institute of Medical Science, University of Tokyo), and Dr. G. P. Nolan (Stanford University) for supplying Bet-1, CD40L-expressing CHO cells, retroviral vector pMX-IRES-GFP, and the Phoenix packaging cell line ({varphi}NX), respectively.


   Footnotes
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by a grant from the Intractable Immune System Disease Research Center of Tokyo Medical University supported by Monbu-Kagakushou (to J.M.). Back

2 Address correspondence and reprint requests to Dr. Junichiro Mizuguchi, Department of Immunology and Intractable Disease Research Center, Tokyo Medical University 6-1-1 Shinjuku, Shinjuku-ku, 160-8402, Tokyo, Japan. E-mail address: mizu{at}tokyo-med.ac.jp Back

3 Abbreviations used in this paper: mIg, membrane-bound Ig; HLH, helix-loop-helix; bHLH, basic HLH; CDK, cyclin-dependent kinase; CHO, Chinese hamster ovary; CKI, CDK inhibitor; EGFP, enhanced GFP; Id, inhibitor of differentiation; IRES, internal ribosomal entry site; PI, propIdium iodide; WT, wild type. Back

Received for publication November 10, 2003. Accepted for publication June 7, 2004.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Nossal, G. J.. 1989. Immunologic tolerance: collaboration between antigen and lymphokines. Science 245:147.[Abstract/Free Full Text]
  2. King, L. B., J. G. Monroe. 2000. Immunobiology of the immature B cell: plasticity in the B-cell antigen receptor-induced response fine tunes negative selection. Immunol. Rev. 176:86.[Medline]
  3. Healy, J. I., C. C. Goodnow. 1998. Positive versus negative signaling by lymphocyte antigen receptors. Annu. Rev. Immunol. 16:645.[Medline]
  4. Nossal, G. J.. 1994. Negative selection of lymphocytes. Cell 76:229.[Medline]
  5. Donjerkovic, D., D. W. Scott. 2000. Activation-induced cell death in B lymphocytes. Cell Res. 10:179.[Medline]
  6. Pennell, C. A., D. W. Scott. 1986. Lymphoma models for B cell activation and tolerance. IV. Growth inhibition by anti-Ig of CH31 and CH33 B lymphoma cells. Eur. J. Immunol. 16:1577.[Medline]
  7. Benhamou, L. E., P. A. Cazenave, P. Sarthou. 1990. Anti-immunoglobulins induce death by apoptosis in WEHI-231 B lymphoma cells. Eur. J. Immunol. 20:1405.[Medline]
  8. Scott, D. W., D. Livnat, C. A. Pennell, P. Keng. 1986. Lymphoma models for B cell activation and tolerance. III. Cell cycle dependence for negative signalling of WEHI-231 B lymphoma cells by anti-µ. J. Exp. Med. 164:156.[Abstract/Free Full Text]
  9. Tsubata, T., J. Wu, T. Honjo. 1993. B-cell apoptosis induced by antigen receptor cross-linking is blocked by a T-cell signal through CD40. Nature 364:645.[Medline]
  10. DeFranco, A. L., M. R. Gold, J. P. Jakway. 1987. B-lymphocyte signal transduction in response to anti-immunoglobulin and bacterial lipopolysaccharide. Immunol. Rev. 95:161.[Medline]
  11. Scott, D. W., J. H. Chace, G. L. Warner, A. O’Garra, G. G. Klaus, H. Quill. 1987. Role of T cell-derived lymphokines in two models of B-cell tolerance. Immunol. Rev. 99:153.[Medline]
  12. Ishida, T., N. Kobayashi, T. Tojo, S. Ishida, T. Yamamoto, J. Inoue. 1995. CD40 signaling-mediated induction of Bcl-xL, Cdk4, and Cdk6: implication of their cooperation in selective B cell growth. J. Immunol. 155:5527.[Abstract]
  13. Merino, R., D. A. Grillot, P. L. Simonian, S. Muthukkumar, W. C. Fanslow, S. Bondada, G. Nunez. 1995. Modulation of anti-IgM-induced B cell apoptosis by Bcl-xL and CD40 in WEHI-231 cells: dissociation from cell cycle arrest and dependence on the avidity of the antibody-IgM receptor interaction. J. Immunol. 155:3830.[Abstract]
  14. Massari, M. E., C. Murre. 2000. Helix-loop-helix proteins: regulators of transcription in eucaryotic organisms. Mol. Cell. Biol. 20:429.[Free Full Text]
  15. Norton, J. D., R. W. Deed, G. Craggs, F. Sablitzky. 1998. Id helix-loop-helix proteins in cell growth and differentiation. Trends Cell Biol. 8:58.[Medline]
  16. Norton, J. D., G. T. Atherton. 1998. Coupling of cell growth control and apoptosis functions of Id proteins. Mol. Cell. Biol. 18:2371.[Abstract/Free Full Text]
  17. Engel, I., C. Murre. 2001. The function of E- and Id proteins in lymphocyte development. Nat. Rev. Immunol. 1:193.[Medline]
  18. Bain, G., E. C. Maandag, D. J. Izon, D. Amsen, A. M. Kruisbeek, B. C. Weintraub, I. Krop, M. S. Schlissel, A. J. Feeney, M. van Roon, et al 1994. E2A proteins are required for proper B cell development and initiation of immunoglobulin gene rearrangements. Cell 79:885.[Medline]
  19. Zhuang, Y., P. Soriano, H. Weintraub. 1994. The helix-loop-helix gene E2A is required for B cell formation. Cell 79:875.[Medline]
  20. Murre, C., P. S. McCaw, D. Baltimore. 1989. A new DNA binding and dimerization motif in immunoglobulin enhancer binding, daughterless, MyoD, and myc proteins. Cell 56:777.[Medline]
  21. Riechmann, V., I. van Cruchten, F. Sablitzky. 1994. The expression pattern of Id4, a novel dominant negative helix-loop-helix protein, is distinct from Id1, Id2 and Id3. Nucleic AcIds Res. 22:749.[Abstract/Free Full Text]
  22. Sun, X. H.. 1994. Constitutive expression of the Id1 gene impairs mouse B cell development. Cell 79:893.[Medline]
  23. Pan, L., S. Sato, J. P. Frederick, X. H. Sun, Y. Zhuang. 1999. Impaired immune responses and B-cell proliferation in mice lacking the Id3 gene. Mol. Cell. Biol. 19:5969.[Abstract/Free Full Text]
  24. Hara, E., T. Yamaguchi, H. Nojima, T. Ide, J. Campisi, H. Okayama, K. Oda. 1994. Id-related genes encoding helix-loop-helix proteins are required for G1 progression and are repressed in senescent human fibroblasts. J. Biol. Chem. 269:2139.[Abstract/Free Full Text]
  25. Deed, R. W., S. M. Bianchi, G. T. Atherton, D. Johnston, M. Santibanez-Koref, J. J. Murphy, J. D. Norton. 1993. An immediate early human gene encodes an Id-like helix-loop-helix protein and is regulated by protein kinase C activation in diverse cell types. Oncogene 8:599.[Medline]
  26. Christy, B. A., L. K. Sanders, L. F. Lau, N. G. Copeland, N. A. Jenkins, D. Nathans. 1991. An Id-related helix-loop-helix protein encoded by a growth factor-inducible gene. Proc. Natl. Acad. Sci. USA 88:1815.[Abstract/Free Full Text]
  27. Peverali, F. A., T. Ramqvist, R. Saffrich, R. Pepperkok, M. V. Barone, L. Philipson. 1994. Regulation of G1 progression by E2A and Id helix-loop-helix proteins. EMBO J. 13:4291.[Medline]
  28. Park, S. T., G. P. Nolan, X. H. Sun. 1999. Growth inhibition and apoptosis due to restoration of E2A activity in T cell acute lymphoblastic leukemia cells. J. Exp. Med. 189:501.[Abstract/Free Full Text]
  29. Quong, M. W., D. P. Harris, S. L. Swain, C. Murre. 1999. E2A activity is induced during B-cell activation to promote immunoglobulin class switch recombination. EMBO J. 18:6307.[Medline]
  30. Zhao, F., A. Vilardi, R. J. Neely, J. K. Choi. 2001. Promotion of cell cycle progression by basic helix-loop-helix E2A. Mol. Cell. Biol. 21:6346.[Abstract/Free Full Text]
  31. Morgan, D. O.. 1997. Cyclin-dependent kinases: engines, clocks, and microprocessors. Annu. Rev. Cell. Dev. Biol. 13:261.[Medline]
  32. Sherr, C. J., J. M. Roberts. 1999. CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev. 13:1501.[Free Full Text]
  33. Banerji, L., J. Glassford, N. C. Lea, N. S. Thomas, G. G. Klaus, E. W. Lam. 2001. BCR signals target p27Kip1 and cyclin D2 via the PI3-K signalling pathway to mediate cell cycle arrest and apoptosis of WEHI 231 B cells. Oncogene 20:7352.[Medline]
  34. Ezhevsky, S. A., H. Toyoshima, T. Hunter, D. W. Scott. 1996. Role of cyclin A and p27 in anti-IgM induced G1 growth arrest of murine B-cell lymphomas. Mol. Biol. Cell 7:553.[Abstract]
  35. Weinberg, R. A.. 1995. The retinoblastoma protein and cell cycle control. Cell 81:323.[Medline]
  36. Inaba, M., K. Inaba, Y. Fukuba, S. Mori, H. Haruna, H. Doi, Y. Adachi, H. Iwai, N. Hosaka, H. Hisha, et al 1995. Activation of thymic B cells by signals of CD40 molecules plus interleukin-10. Eur. J. Immunol. 25:1244.[Medline]
  37. Mizuguchi, J., H. Nakabayashi, Y. Yoshida, K. P. Huang, T. Uchida, T. Sasaki, S. Ohno, K. Suzuki. 1988. Increased degradation of protein kinase C without diminution of mRNA level after treatment of WEHI-231 B lymphoma cells with phorbol esters. Biochem. Biophys. Res. Commun. 155:1311.[Medline]
  38. Takada, E., H. Toyota, J. Suzuki, J. Mizuguchi. 2001. Prevention of anti-IgM-induced apoptosis accompanying G1 arrest in B lymphoma cells overexpressing dominant-negative mutant form of c-Jun N-terminal kinase 1. J. Immunol. 166:1641.[Abstract/Free Full Text]
  39. Nosaka, T., T. Kawashima, K. Misawa, K. Ikuta, A. L. Mui, T. Kitamura. 1999. STAT5 as a molecular regulator of proliferation, differentiation and apoptosis in hematopoietic cells. EMBO J. 18:4754.[Medline]
  40. Kotani, H., P. B. Newton, III, S. Zhang, Y. L. Chiang, E. Otto, L. Weaver, R. M. Blaese, W. F. Anderson, G. J. McGarrity. 1994. Improved methods of retroviral vector transduction and production for gene therapy. Hum. Gene Ther. 5:19.[Medline]
  41. Bain, G., C. B. Cravatt, C. Loomans, J. Alberola-Ila, S. M. Hedrick, C. Murre. 2001. Regulation of the helix-loop-helix proteins, E2A and Id3, by the Ras-ERK MAPK cascade. Nat. Immunol. 2:165.[Medline]
  42. Shen, C. P., T. Kadesch. 1995. B-cell-specific DNA binding by an E47 homodimer. Mol. Cell. Biol. 15:4518.[Abstract]
  43. Chen, B., B. H. Han, X. H. Sun, R. W. Lim. 1997. Inhibition of muscle-specific gene expression by Id3: requirement of the C-terminal region of the protein for stable expression and function. Nucleic Acids Res. 25:423.[Abstract/Free Full Text]
  44. Deed, R. W., S. Armitage, J. D. Norton. 1996. Nuclear localization and regulation of Id protein through an E protein-mediated chaperone mechanism. J. Biol. Chem. 271:23603.[Abstract/Free Full Text]
  45. Hasbold, J., G. G. Klaus. 1990. Anti-immunoglobulin antibodies induce apoptosis in immature B cell lymphomas. Eur. J. Immunol. 20:1685.[Medline]
  46. Norton, J. D.. 2000. ID helix-loop-helix proteins in cell growth, differentiation and tumorigenesis. J. Cell Sci. 113:3897.[Abstract]
  47. Becker-Herman, S., F. Lantner, I. Shachar. 2002. Id2 negatively regulates B cell differentiation in the spleen. J. Immunol. 168:5507.[Abstract/Free Full Text]
  48. Kee, B. L., R. R. Rivera, C. Murre. 2001. Id3 inhibits B lymphocyte progenitor growth and survival in response to TGF-{beta}. Nat. Immunol. 2:242.[Medline]
  49. Zebedee, Z., E. Hara. 2001. Id proteins in cell cycle control and cellular senescence. Oncogene 20:8317.[Medline]
  50. Kim, D., X. C. Peng, X. H. Sun. 1999. Massive apoptosis of thymocytes in T-cell-deficient Id1 transgenic mice. Mol. Cell. Biol. 19:8240.[Abstract/Free Full Text]
  51. Tetsu, O., F. McCormick. 2003. Proliferation of cancer cells despite CDK2 inhibition. Cancer Cell 3:233.[Medline]
  52. Ortega, S., I. Prieto, J. Odajima, A. Martin, P. Dubus, R. Sotillo, J. L. Barbero, M. Malumbres, M. Barbacid. 2003. Cyclin-dependent kinase 2 is essential for meiosis but not for mitotic cell division in mice. Nat. Genet. 35:25.[Medline]
  53. Yates, P. R., G. T. Atherton, R. W. Deed, J. D. Norton, A. D. Sharrocks. 1999. Id helix-loop-helix proteins inhibit nucleoprotein complex formation by the TCF ETS-domain transcription factors. EMBO J. 18:968.[Medline]
  54. Roberts, E. C., R. W. Deed, T. Inoue, J. D. Norton, A. D. Sharrocks. 2001. Id helix-loop-helix proteins antagonize pax transcription factor activity by inhibiting DNA binding. Mol. Cell. Biol. 21:524.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hata, K.
Right arrow Articles by Mizuguchi, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hata, K.
Right arrow Articles by Mizuguchi, J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS