The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kemp, T. J.
Right arrow Articles by Griffith, T. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kemp, T. J.
Right arrow Articles by Griffith, T. S.
The Journal of Immunology, 2004, 173: 892-899.
Copyright © 2004 by The American Association of Immunologists

Human B Cells Express Functional TRAIL/Apo-2 Ligand after CpG-Containing Oligodeoxynucleotide Stimulation1

Troy J. Kemp*,{dagger}, Jill M. Moore* and Thomas S. Griffith2,*,{dagger},{ddagger}

* Department of Urology, {dagger} Interdisciplinary Graduate Program in Immunology, and {ddagger} Prostate Cancer Research Program of the Holden Comprehensive Cancer Center, University of Iowa, Iowa City, IA 52242


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CpG-containing oligodeoxynucleotides (CpG ODN) have broad-ranging immunostimulatory effects, including the generation of antitumor immune responses. Analysis of different CpG ODN have identified two classes: CpG-A ODN, which stimulate high levels of IFN-{alpha} production from plasmacytoid dendritic cells and weakly activate B cells, and CpG-B ODN, which strongly activate B cells but stimulate low production of IFN-{alpha} from plasmacytoid dendritic cells. Previously, we observed that CpG-B ODN (2006) induces TRAIL/Apo-2 ligand (Apo-2L)-mediated killing of tumor cells by CD14+ PBMC. In this study, we extend our investigation of CpG ODN-induced TRAIL/Apo-2L expression and activity in PBMC to include CpG-A ODN. Of the two classes, IFN-{alpha} production and TRAIL/Apo-2L-mediated killing of tumor cells was greatest with CpG-A ODN. Surprisingly, CD3+, CD14+, CD19+, and CD56+ PBMC expressed high levels of TRAIL/Apo-2L following CpG-A ODN stimulation. When isolated, the CD19+ PBMC (B cells) were able to kill tumor cells in a TRAIL/Apo-2L-dependent manner. As with CD14+ PBMC, CD19+ sorted B cells were capable of up-regulating TRAIL/Apo-2L expression when stimulated with IFN-{alpha} alone. Interestingly, agonist anti-CD40 mAb further enhanced the IFN-{alpha}-induced TRAIL/Apo-2L expression on CD19+ B cells. These results are the first to demonstrate human B cell-mediated killing of tumor cells in a TRAIL/Apo-2L-dependent fashion.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Prompt recognition of, and response to, bacterial infections is needed by higher organisms to prevent any pathological consequences. Although a variety of bacterial cell wall components are immunostimulatory, the genomic DNA may be the strongest stimulating agent within the bacteria cell (1, 2). Indeed, bacterial DNA can stimulate various immune cells, including B cells, dendritic cells (DC),3 monocytes/macrophages (M{phi}), and NK cells (3). The strong stimulatory effect of bacterial DNA is largely due to the presence of unmethylated CG-containing motifs, which are the foundation for the design and testing of synthetic CpG-containing oligodeoxynucleotides (CpG ODN) as immune adjuvants and stand-alone therapeutics (4, 5, 6). Cellular recognition of CpG motifs is made possible by TLR9, a member of an evolutionarily conserved family of proteins that are responsible for mediating innate immune reactions, especially against bacterial infections, through the recognition of pathogen-associated molecular patterns (7, 8).

Studies examining the immunological effects of CpG ODN have determined that there are two main classes based upon the cell population stimulated and cytokines produced (3). CpG-A ODN contain mixed phosphodiester-phosphorothioate backbones and are particularly effective at stimulating plasmacytoid DC (pDC) to produce high levels of IFN-{alpha} and activating NK cells, but have poor stimulatory effects on B cells (9). The flexibility of the phosphodiester backbone in CpG-A ODN, which allows it to form hairpin loops, is essential to the induction of high levels of IFN-{alpha}. CpG-B ODN, by comparison, have phosphorothioate backbones and strongly activate human B cells to proliferate, secrete IL-6 and IL-10, and express increased levels of MHC class II, CD80, and CD86 (10). CpG-B ODN also induce DC maturation and activation, but relatively little pDC-derived IFN-{alpha} is produced with CpG-B ODN stimulation (9). The pDC-derived IFN-{alpha} is then capable of affecting a myriad of cellular functions and immunological responses.

IFNs were discovered for their antiviral activity (11), but their effects reach far beyond resistance to viral infection. Specifically, IFN-{alpha} modulates immune responses to bacterial infections and is the primary cytokine used to induce antitumor responses to various cancers, including bladder carcinoma and chronic myelogenous leukemia (12, 13). IFN-{alpha} is capable of increasing MHC class I expression on normal cells and enhancing the effector functions of the innate and adaptive immune system (11, 14). Several studies demonstrated that IFN-{alpha} increases the lytic activity of NK cells and CTL, along with inducing B cell proliferation and Ig secretion (15, 16, 17). Moreover, the effects of IFN-{alpha} are essential to the activation and differentiation of M{phi}. IFN-{alpha} increases the expression of FcRs on M{phi} and increases the phagocytosis of immune complexes formed on foreign Ags and tumor cells (18). Furthermore, IFN-{alpha} induces TRAIL/Apo-2L expression on human M{phi}, transforming them into highly effective tumor cell killers (19). However, M{phi} have not been the only cell type identified as being able to express TRAIL/Apo-2L upon IFN-{alpha} stimulation. DC, NK cells, and TCR-ligated T cells have been shown to express functional TRAIL/Apo-2L (20, 21, 22). Essentially, IFN-{alpha} is responsible for eliciting a host of M{phi} effector functions, whether making them more receptive to phagocytosis or transforming them into tumoricidal cells by a TRAIL/Apo-2L-dependent mechanism.

Interestingly, previous work from our laboratory revealed that the stimulation of PBMC with CpG-B ODN induces, in an IFN-{alpha}-dependent manner, the expression of functional TRAIL/Apo-2L on CD14+ M{phi}, which are able to kill tumor cell targets in vitro (23). These observations prompted us to evaluate the TRAIL/Apo-2L-stimulating capacity of CpG-A ODN. The results presented in this study demonstrate for the first time that CpG-A ODN stimulation of human PBMC leads to high levels of functional TRAIL/Apo-2L expression on CD19+ B cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents and mAb

Reagents and sources were as follows: IFN-{alpha} (100 ng/ml; PeproTech, Rocky Hill, NJ); RPA-T4, FITC-conjugated IgG1 anti-human CD4; HIT8a, FITC-conjugated IgG1 anti-human CD8; M5E2, FITC-conjugated IgG2a anti-human CD14; NCAM16.2, FITC-conjugated IgG2b anti-human CD56 (BD Biosciences, San Diego, CA); HIB19, FITC-conjugated IgG1 anti-human CD19; RIK-2, biotinylated IgG1 anti-human TRAIL (a gift from Dr. H. Yagita, Juntendo University, Tokyo, Japan); IgG1-biotin isotype control (Caltag Laboratories, Burlingame, CA). The soluble fusion proteins TRAIL-R2:Fc and Fas:Fc were purchased from Alexis Biochemicals (San Diego, CA).

CpG ODN

CpG ODN 2041 was obtained from Dr. R. Ashman (University of Iowa, Iowa City, IA), CpG ODN 2006 and 2243 were purchased from Coley Pharmaceutical Group (Wellesley, MA), and CpG ODN 2216 was synthesized by Sigma Genosys (The Woodlands, TX). All of the following sequences are 5'–3', lowercase letters are 5' of phosphothiorate linkages, and uppercase letter are 5' of phosphodiester linkages: CpG-A ODN 2216, ggGGGACGATCGTCgggggG; CpG-A control ODN 2243; ggGGGAGCATGCTGgggggG; CpG-B ODN 2006, tcgtcgttttgtcgttttgtcgtt; and CpG-B control ODN 2041, ctggtctttctggtttttttctcg.

Tumor cell line

The human melanoma cell line WM 793 was obtained from Dr. M. Herlyn (Wistar Institute, Philadelphia, PA), and cultured in DMEM supplemented with 10% FBS, penicillin, streptomycin, sodium pyruvate, nonessential amino acids, and HEPES (hereafter referred to as complete DMEM).

Preparation of PBMC

PBMC were isolated from normal, healthy donors by standard density gradient centrifugation over Ficoll-Paque Plus (Pharmacia, Uppsala, Sweden). To isolate CD19+ B cells from PBMC, a positive-selection isolation kit (Miltenyi Biotec, Auburn, CA) was used, containing magnetic beads conjugated to a mouse anti-human CD19 mAb. To verify the purity of the selected CD19+ cells, cells eluted from the selection column were stained with a FITC-conjugated anti-CD20 mAb (clone 2H7, IgG2b; eBioscience, San Diego, CA) and analyzed by flow cytometry. Purity was >98% for all purifications performed.

Flow cytometry

Cell analysis was performed on a FACScan (BD Biosciences) with >104 cells analyzed per sample. For multicolor cell analysis, cells were combined in a 96-well round-bottom plate with 20 µl of human IgG (12 µg/ml; Sigma-Aldrich, St. Louis, MO) to block Fc binding of the mAb and 20 µl each of the direct FITC-labeled and biotin-labeled mAb (60 µg/ml). Cells were then incubated at 4°C for 30 min. Following three washes with 200 µl of PBS containing 2 mg/ml BSA and 0.02% NaN3, 40 µl of PE-labeled streptavidin (1/100 dilution; Caltag Laboratories) was added for an additional 30 min. Cells were either analyzed immediately following staining or fixed in 1% paraformaldehyde until analysis.

PBMC/B cell-mediated killing of human tumor cells

PBMC (107 cells/2 ml/well in a six-well plate) were cultured in RPMI 1640 supplemented with 10% FBS, penicillin, streptomycin, sodium pyruvate, nonessential amino acids, and HEPES (hereafter referred to as complete RPMI) medium alone or CpG ODN (1 µg/ml) for 24 h, after which the cells were washed and resuspended in complete RPMI. In some experiments, B cells were positively selected from the PBMC following stimulation as described above. WM 793 tumor cells were labeled with 100 µCi of 51Cr for 1 h at 37°C, washed three times, and resuspended in complete medium. To determine TRAIL-induced death, 51Cr-labeled tumor cells (104/well) were incubated with varying numbers of effector cells for 14 h. In some cultures, TRAIL-R2:Fc or Fas:Fc (20 µg/ml), NG-monomethyl-L-arginine (L-NMMA; 300 µM; AerBio, Bloomington, IN), or concanamycin A (CMA; 20 nM; Sigma-Aldrich) were added to the PBMC or purified CD19+ B cells 15 min prior (2 h prior for CMA) to adding tumor cell targets. All cytotoxicity assays were performed in 96-well round-bottom plates and the percent specific lysis was calculated as follows: 100 x (experimental cpm – spontaneous cpm)/(total cpm – spontaneous cpm). Spontaneous and total 51Cr release were determined in the presence of either medium alone or 1% Nonidet P-40, respectively. The presence of TRAIL-R2:Fc or Fas:Fc during the assay had no effect on the level of spontaneous release by the target cells.

IFN-{alpha} neutralization

PBMC (106 cells/0.3 ml in a 5-ml polypropylene round-bottom tube (Falcon BD Labware, Franklin Lakes, NJ)) were stimulated, as described above, with CpG ODN alone, or CpG ODN in the presence of rabbit anti-human neutralizing IFN-{alpha} antiserum (10,000 U/ml; R&D Systems, Minneapolis, MN) or a nonspecific rabbit IgG isotype control Ab (Sigma-Aldrich). PBMC were then analyzed for TRAIL/Apo-2L expression by flow cytometry or cultured with 51Cr-labeled tumor cells to assess tumoricidal activity, as described above.

IFN-{alpha} and IL-6 ELISA

Human IFN-{alpha} or IL-6 protein levels produced after CpG ODN stimulation were quantitated using a sandwich ELISA purchased from R&D Systems.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CpG-A ODN-stimulated human PBMC mediate increased TRAIL/Apo-2L-dependent tumor cell lysis vs CpG-B ODN-stimulated PBMC

One of the distinguishing features of CpG-A ODN stimulation is the amount of IFN-{alpha} produced by pDC compared with CpG-B ODN. Although they only comprise ~0.1% of the cells within PBMC, pDC are the only cells within PBMC that produce IFN-{alpha} in response to CpG ODN (23, 24, 25). pDC are identical with the "natural type I IFN-producing cell" that has been described for several years (26, 27). In the present study, PBMC stimulated for 24 h with 1 µg CpG-A ODN (2216) resulted in the production of over 20,000 pg/ml IFN-{alpha} (Fig. 1A). By comparison, just over 100 pg/ml IFN-{alpha} was detected in the supernatants of PBMC stimulation with CpG-B ODN (2006). These are levels well within the range documented in other reports (24). There was no detectable IFN-{alpha} in the culture supernatants from CpG-A control ODN (2243), CpG-B control ODN (2041)-stimulated PBMC, or unstimulated PBMC. Based on the level of IFN-{alpha} produced, we hypothesized that PBMC stimulation with CpG-A ODN 2216 would correlate with increased tumoricidal activity. As predicted, there was increased tumor cell lysis when the PBMC were stimulated with 2216 compared with 2006 stimulation (Fig. 1B). PBMC stimulated with either control CpG ODN displayed lytic activity comparable to unstimulated PBMC. Previously, our laboratory demonstrated that the tumoricidal activity of CpG-B-stimulated PBMC was TRAIL/Apo-2L specific with the inclusion of TRAIL-R2:Fc (23). As with CpG-B ODN, CpG-A ODN-stimulated PBMC killed WM 793 cells by a TRAIL/Apo-2L-dependent mechanism as indicated in Fig. 1C. CpG-A ODN-stimulated PBMC incubated with Fas:Fc, a specific inhibitor of NO synthase, L-NMMA (28), or the perforin inhibitor CMA (29) did not inhibit cell lysis, but only the addition of TRAIL-R2:Fc blocked cell lysis.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 1. CpG-A ODN stimulates higher IFN-{alpha} production and PBMC-mediated tumoricidal activity compared with CpG-B ODN stimulation. A, PBMC were cultured for 24 h in the absence or presence of CpG-B ODN 2006, CpG-B ODN control 2041, CpG-A ODN 2216, or CpG-A ODN control 2243 (1 µg/ml). IFN-{alpha} levels in the culture supernatants were then determined by multispecies IFN-{alpha} ELISA. IFN-{alpha} levels represent the average amount measured from three independent experiments using different donors. ND, None detected. B, Isolated PBMC were cultured for 24 h in the absence or presence of CpG-B ODN 2006, CpG-B ODN control 2041, CpG-A ODN 2216, or CpG-A ODN control 2243 (1 µg/ml). The PBMC were then cultured for 14 h with 51Cr-labeled WM 793 target cells at the indicated E:T ratios. C, Isolated PBMC were cultured for 24 h in the absence or presence of CpG-A ODN 2216 (1 µg/ml). In addition, PBMC were incubated with L-NMMA (300 µM), CMA (20 nM), TRAIL-R2:Fc (20 µg/ml), or Fas:Fc (20 µg/ml) along with CpG-A ODN 2216 (1 µg/ml). The PBMC were then cultured for 14 h with 51Cr-labeled WM 793 target cells at the indicated E:T ratios. Data points represent the mean of triplicate wells, and the experiment was repeated on at least three different donors that gave similar results. For clarity, SD bars were omitted from the graphs, but were <10% of the value of all points.

 
CpG-A ODN stimulation induces high TRAIL/Apo-2L expression on multiple peripheral blood cell populations, including CD19+ B cells

Having demonstrated the presence of elevated tumoricidal activity in CpG-A ODN-stimulated PBMC, we then evaluated the expression of TRAIL/Apo-2L on CD4+, CD8+, CD14+, CD19+, and CD56+ PBMC. The PBMC were analyzed by flow cytometry following 24-h stimulation with 2006, 2216, and their respective controls to determine whether the increased levels of IFN-{alpha} from CpG-A ODN-stimulated PBMC induced higher levels of TRAIL/Apo-2L on the M{phi} and/or stimulated the expression of TRAIL/Apo-2L on additional cell types within PBMC as compared with CpG-B ODN. When stimulated with 2006, TRAIL/Apo-2L was expressed the highest on CD14+ M{phi} and at an intermediate level on CD19+ B cells (Fig. 2). Low levels of TRAIL/Apo-2L were present on CD4+ T cells and CD56+ NK cells, and no detectable TRAIL/Apo-2L was seen on CD8+ cells. In contrast, stimulation with 2216 resulted in significant TRAIL/Apo-2L expression on all five PBMC populations. No detectable TRAIL/Apo-2L was observed on any cell population following stimulation with either control CpG ODN 2041 or 2243. From these observations, it can be concluded that the increase in PBMC lytic activity following CpG-A ODN stimulation shown in Fig. 1B may be the result of the overall high level of TRAIL/Apo-2L expression on all the cell types examined.



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 2. TRAIL/Apo-2L expression on human PBMC (CD4+, CD8+, CD14+, CD19+, and CD56+ cells) after incubation for 24 h in the absence or presence of CpG-B ODN 2006, CpG-B ODN control 2041, CpG-A ODN 2216, or CpG-A ODN control 2243 (1 µg/ml). Histograms represent 104 gated cells in all conditions, and viability was >95% as assessed by propidium iodide exclusion. Similar observations were observed using PBMC from four different donors.

 
Previous studies have shown that peripheral blood T cells, NK cells, and M{phi} can express functional TRAIL/Apo-2L (19, 21, 22); however, finding that CD19+ B cells expressed high levels of TRAIL/Apo-2L after 2216 stimulation was most intriguing. Consequently, we wished to determine whether the TRAIL/Apo-2L expressed on the CD19+ B cells conferred these cells with tumoricidal activity. To test this theory, PBMC were stimulated with CpG-A ODN 2216 or the control 2243 for 24 h. CD19+ B cells were then isolated by positive selection from the bulk PBMC, and used as effector cells against the TRAIL/Apo-2L-sensitive human melanoma cell line WM 793 (30). Analysis of the >98% pure B cells demonstrated very high TRAIL/Apo-2L surface levels (Fig. 3, A and B). As presented in Fig. 3C, significant tumor cell lysis was measured when using 2216-stimulated B cells. Unstimulated and 2243-stimulated B cells exhibited no target cell lysis. The highest E:T ratio was limited to 17:1 due to the volumes of blood obtained and numbers of CD19+ B cells present. Furthermore, inclusion of the soluble fusion protein TRAIL-R2:Fc completely inhibited target cell lysis by the 2216-stimulated B cells, confirming the mechanism of death to be TRAIL/Apo-2L mediated. Similar results were obtained in all tested donors. To our knowledge, these results are the first to clearly demonstrate functional TRAIL/Apo-2L can be expressed on human peripheral blood B cells.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 3. TRAIL/Apo-2L-mediated tumoricidal activity by human B cells occurs after stimulation with CpG-A ODN. A, PBMC were incubated for 24 h in the absence or presence of either the stimulatory CpG-A ODN 2216 (1 µg/ml) or control CpG-A ODN 2243 (1 µg/ml). CD19+ B cells were then isolated from the PBMC using magnetic bead separation. The purity of the isolated CD19+ B cells was verified by CD20 staining. B, Surface TRAIL/Apo-2L levels on unstimulated, CpG-A ODN 2216-, or CpG-A ODN control 2243-stimulated purified CD19+ B cells. Histograms represent 104 gated cells, and viability was >95% after incubation as assessed by propidium iodide exclusion. C, CpG-A ODN 2216-stimulated CD19+ B cells were cultured for 14 h with 51Cr-labeled WM 793 target cells at the indicated E:T ratios. Inclusion of the fusion protein TRAIL-R2:Fc (20 µg/ml) inhibited killing of WM 793 target cells, whereas addition of Fas:Fc (20 µg/ml) did not. Unstimulated or CpG-A ODN control 2243-stimulated purified CD19+ B cells displayed no cytotoxic activity. Data points represent the mean of triplicate wells, and experiments were repeated at least three times using different donors with similar results. For clarity, SD bars were omitted from the graphs, but were <10% of the value of all points.

 
TRAIL/Apo-2L expression on B cells is dependent on IFN-{alpha} and enhanced with CD40 ligation

Analysis of the human TRAIL/Apo-2L promoter has identified a DNA motif consistent with a near-consensus IFN-{gamma}-activated sequence located at –108 to –100 bp upstream of the promoter start site (31). Human DC and M{phi} stimulated with either IFN-{alpha} or IFN-{gamma} express functional TRAIL/Apo-2L (19, 20), whereas TRAIL/Apo-2L expression on T cells requires IFN-{alpha} and TCR ligation (22), suggesting that the IFN-{alpha} produced by CpG-stimulated pDC may also be important in the TRAIL/Apo-2L expression on B cells. Thus, we cultured whole PBMC with IFN-{alpha} for 24 h, and then examined the same five cell populations as in Fig. 2 for TRAIL/Apo-2L expression by flow cytometry. Surprisingly, there was a dose-dependent increase in TRAIL/Apo-2L expression on the B cells, as with CD4+, CD14+, and CD56+ cells (Fig. 4A). TRAIL/Apo-2L expression was seen on CD8+ T cells only with the highest dose of IFN-{alpha}. Confirmation for the necessity of IFN-{alpha} in the CpG-A ODN-induced up-regulation of TRAIL/Apo-2L on PBMC reported in Figs. 1–3 was demonstrated by including neutralizing antiserum against IFN-{alpha}. PBMC stimulated with CpG-A ODN in the presence of the IFN-{alpha}-neutralizing antiserum failed to display tumoricidal activity (Fig. 4B). Flow cytometric analysis of CpG-A ODN-stimulated CD14+ M{phi} and CD19+ B cells revealed levels of TRAIL/Apo-2L expression comparable to unstimulated or control CpG-A ODN-stimulated PBMC when the IFN-{alpha}-neutralizing antiserum was included (Fig. 4C). Similar flow cytometry results were seen on CD3+ T cells and CD56+ NK cells (data not shown). However, in both cases, inclusion of control antiserum had no effect on modulating TRAIL/Apo-2L expression levels. Collectively, these results clearly show the importance for IFN-{alpha} in the CpG-A ODN-induced expression of TRAIL/Apo2L on PBMC.



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 4. IFN-{alpha} up-regulates TRAIL/Apo-2L expression on PBMC, and IFN-{alpha} neutralization of CpG-A ODN-stimulated PBMC results in the loss of functional TRAIL/Apo-2L expression. A, TRAIL/Apo-2L expression on human PBMC (CD4+, CD8+, CD14+, CD19+, and CD56+ cells) after incubation for 24 h in the absence or presence of IFN-{alpha} (10 ng/ml or 1 µg/ml). Histograms represent 104 gated cells in all conditions, and viability was >95% as assessed by propidium iodide exclusion. Similar observations were observed using PBMC from three different donors. B and C, IFN-{alpha} neutralization abrogates CpG-A ODN-induced tumoricidal activity and TRAIL/Apo2L expression. PBMC were incubated for 24 h in the absence or presence of either 1 µg/ml CpG-A ODN 2243, 2216, IFN-{alpha}-neutralizing antiserum (10,000 neutralizing U/ml), or a nonspecific control Ig. The PBMC were then cultured for 14 h with 51Cr-labeled WM 793 target cells at the indicated E:T ratios. Data points represent the mean of triplicate wells, and the experiment was repeated three times with similar results. For clarity, SD bars were omitted from the graphs, but were <10% of the value of all points. C, PBMC were stimulated as described in B, and then analyzed by flow cytometry for TRAIL/Apo-2L surface expression on CD14+ and CD19+ cells. Histograms represent 104 gated cells in all conditions, and viability was >95% as assessed by propidium iodide exclusion. These observations were reproduced using PBMC from three different donors.

 
B cells can receive positive stimuli from a variety of cytokines, including IFN, IL-4, and IL-6, as well as ligation of the BCR and CD40 that lead to proliferation, differentiation, cytokine production, and other effector functions. Furthermore, B cells have been shown to express mRNA for TLR9, correlating with their responsiveness to CpG ODN (32). It became important to then test whether purified B cells could be directly stimulated by CpG ODN to express TRAIL/Apo2L. Whereas CpG-A ODN 2216, CpG-B ODN 2006, or IFN-{alpha} induced TRAIL/Apo-2L expression on B cells in the context of bulk PBMC (see Figs. 2 and 4A), purified B cells stimulated with the two different classes of CpG in the same manner did not (Fig. 5A). To demonstrate that our process of purifying the B cells did not alter responsiveness to CpG ODN, the purified B cells were stimulated with the two different classes of CpG ODN for 24 h, and the amount of IL-6 produced was measured by ELISA. As expected, the purified B cells produced IL-6 when stimulated with CpG ODN (Fig. 5B). CpG-B directly stimulates B cells to produce IL-6 to a higher degree than CpG-A, which correlates with previous results (3, 5). These results also coincide with the general distinction that CpG-B is more conducive to stimulating B cells and CpG-A is only a weak B cell stimulator. Overall, these data suggest that IFN-{alpha} produced by pDC and some other factor(s) expressed on or secreted by non-B cell PBMC are needed to induce TRAIL/Apo-2L expression on B cells.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 5. IFN-{alpha} and CD40 ligation, but not CpG ODN, induces maximal TRAIL/Apo2L expression on purified CD19+ B cells. A, Magnetic bead-purified CD19+ B cells were stimulated for 24 h in the absence or presence of CpG-B ODN 2006, CpG-B ODN control 2041, CpG-A ODN 2216, or CpG-A ODN control 2243 (1 µg/ml). Surface levels of TRAIL/Apo-2L were then determined by flow cytometry. Histograms represent 104 gated cells in all conditions, and viability was >95% as assessed by propidium iodide exclusion. Similar observations were observed using PBMC from three different donors. B, Culture supernatants from the cells used in A were assayed for IL-6 by ELISA to demonstrate B cell responsiveness to CpG ODN stimulation. There was no detectable IL-6 in the supernatants of either control CpG ODN (2041 or 2243)-stimulated cells. C, Purified CD19+ B cells were incubated for 24 h in the absence or presence of either anti-CD40 mAb (20 µg/ml), IFN-{alpha} (100 ng/ml), anti-BCR (20 µg/ml), and IFN-{alpha} (100 ng/ml), or anti-CD40 mAb (20 µg/ml) and IFN-{alpha} (100 ng/ml), and then analyzed for TRAIL/Apo-2L surface expression. Histograms represent 104 gated cells in all conditions, and viability was >95% as assessed by propidium iodide exclusion. These observations were reproduced using purified CD19+ B cells from three different donors.

 
Because TRAIL/Apo-2L expression on B cells was induced only when in the presence of unfractionated PBMC, we reasoned that another stimulus was acting on the B cells and needed for maximal TRAIL/Apo-2L expression. A recent report demonstrated that IFN-{alpha} induced the expression of CD40L (CD154) on human CD4+ T cells (33). Thus, we investigated whether IFN-{alpha}, combined with CD40 ligation by agonistic mAb, induced the expression of TRAIL/Apo-2L on B cells. Purified B cells were incubated with IFN-{alpha} alone, and in combination with agonist Abs to the BCR or CD40 for 24 h. Stimulation with anti-CD40 or anti-BCR Ab alone did not induce TRAIL/Apo-2L expression (Fig. 5C), nor did stimulation with the combination of CpG-A ODN and anti-CD40 (data not shown). Interestingly, IFN-{alpha} alone was sufficient to stimulate modest TRAIL/Apo-2L expression on purified B cells, and costimulation through the BCR along with IFN-{alpha} did not enhance the level of TRAIL/Apo-2L expression. In contrast, there was enhanced expression of TRAIL/Apo-2L when an agonist CD40 mAb was included with the IFN-{alpha}. In conclusion, these results demonstrate that B cells express functional TRAIL/Apo-2L and IFN-{alpha} is sufficient to induce TRAIL/Apo-2L expression. Furthermore, costimulation through CD40 ligation is capable of enhancing TRAIL/Apo-2L expression on B cells in comparison to IFN-{alpha} alone.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The vertebrate immune system uses pattern recognition receptors to detect the presence of invading microbes and initiate an immune response to eliminate the pathogen (34). The studies that demonstrated CpG ODN can mimic the pathogen-associated molecular patterns present in bacteria and viruses were landmark events that not only showed how the innate and adaptive immune systems can communicate to deal with such attacks on the body, but were also the launching pad for examining the role of CpG ODN as immune adjuvants in multiple areas of immunology and disease treatment (2, 4, 35, 36). Of particular interest is the use of CpG ODN in cancer immunotherapeutic settings, which can be traced back to the reports of Coley (37). Although studies with CpG ODN in tumor immunology have yielded exciting results (38, 39, 40, 41, 42, 43), many fundamental questions remain regarding the mechanism by which CpG ODN induces antitumor immune responses. Previously, we demonstrated that CpG-B ODN induce peripheral blood pDC to produce IFN-{alpha}, which then stimulates M{phi} to express functional TRAIL/Apo-2L (23). We have extended this observation to demonstrate that the two classes of CpG ODN lead to distinct differences in the PBMC populations that express TRAIL/Apo-2L, as well as the level of TRAIL/Apo-2L expressed on the PBMC. Although the finding that T cells, NK cells, and M{phi} expressed high levels of TRAIL/Apo-2L after stimulation with CpG-A ODN 2216 was interesting, the most surprising observation was that 2216 stimulation also induced TRAIL/Apo-2L expression on B cells, turning them into TRAIL/Apo-2L-expressing cytotoxic B cells. Moreover, the B cell expression of TRAIL/Apo-2L was dependent on IFN-{alpha}, as it is with the other cell populations examined within PBMC. However, it is important to note that IFN-{alpha} was not the sole stimulatory factor driving TRAIL/Apo-2L expression on B cells, as it is for other peripheral blood cell populations (e.g., M{phi} and CD11c+ DC) (19, 20). CD40 ligation was needed for maximal TRAIL/Apo-2L expression on purified B cells. At present, these results suggest that the IFN-{alpha} produced by CpG ODN stimulation induces TRAIL/Apo-2L on the main cellular components of the peripheral blood (M{phi}), but also enhances with CD40-CD40L interaction to induce TRAIL/Apo-2L expression on less prevalent cell populations (i.e., B cells).

The expression of a death-inducing ligand on B cells is not new to the scientific literature. Hahne et al. (44) reported in 1996 that either LPS or PMA-stimulated B cells can express functional Fas ligand (FasL). Several years later, Mariani and Krammer (45) reported that some transformed cells of the B cell lineage, specifically the mouse lines A20 and WEHI.231 and human lines BJAB and REH, constitutively expressed TRAIL/Apo-2L. They then demonstrated that TRAIL was present on freshly isolated mouse B220+ cells following LPS stimulation (46). Interestingly, the functional state of TRAIL/Apo-2L on the B cells in either of these studies was not investigated. Looking back, it is difficult to guess why this was not tested. Both of these studies were comparing the differentially regulated expression of FasL and TRAIL/Apo-2L on T and B cells, before and after stimulation, and did not rigorously test the functional state of either molecule. In the results presented in this study, the dramatic and surprising up-regulation of TRAIL/Apo-2L expression on B cells following CpG-A ODN stimulation made the investigation into its functionality a necessity.

Perhaps the most puzzling question that arises from our findings is why B cells would express functional TRAIL/Apo-2L. The most obvious answer is to eliminate tumor cells, and the fact that tumor-infiltrating B cells have been reported (47, 48, 49) suggests that there could be some cell-mediated tumoricidal contribution from B cells in such a situation. B cells function as APCs in certain scenarios (50); thus, it is possible that Ags derived from tumor cells killed by the TRAIL/Apo-2L-expressing B cells may be presented by the same B cells and activate T cells in the vicinity. Another potential function for TRAIL/Apo-2L-expressing B cells is to maintain immune homeostasis and down-regulate immune responses that could lead to autoimmune inflammation. Studies using TRAIL–/– mice or soluble TRAIL-R2:Fc infused into TRAIL+/+ mice to block TRAIL activity in vivo have found that experimental autoimmune arthritis is exacerbated compared with control mice (51). Moreover, autocollagen Ab responses were dramatically increased in mice treated with TRAIL-R2:Fc, indicating that persistent TRAIL/Apo-2L blockade in mice enhanced the humoral immune responses that were related to the increased level of disease. Cellular immune responses to collagen were also augmented in the TRAIL-R2:Fc-treated mice in the above-mentioned study, as measured by lymphocyte proliferation and cytokine production (IL-2 and IFN-{gamma}). The expression of TRAIL on B cells may also be important in the death of activated peripheral blood T cells. B cells play a vital role in supplying help to T cells during immune responses, and it is well known that numbers of activated T cells are kept regulated by the phenomenon of activation-induced cell death (52, 53). Although many studies have demonstrated a role of the Fas-FasL system in peripheral deletion of T cells, there is growing evidence that TRAIL is also involved in this process (54, 55). Activation-induced cell death can occur in a cell-autonomous fashion, for example, but can also occur when activated T cells interact with other T cells or nonlymphoid cells expressing FasL or TRAIL/Apo-2L (52, 56). Therefore, it is possible that TRAIL/Apo-2L-expressing B cells could participate in restoring immune homeostasis in a similar way.

It has been well documented that pDC express the highest amounts of TLR9 among the cells in the peripheral blood and, consequently, are the most responsive to CpG ODN (32, 57, 58). pDC produce high levels of IFN-{alpha} when stimulated with CpG-A ODN, yet very low levels of IFN-{alpha} are produced following CpG-B stimulation (24). It appears this difference relates to the fact that both CpG ODN trigger distinct regulatory pathways within the pDC that determine the amount of IFN-{alpha} produced. CpG-B ODN preferentially triggers type I IFN production within the first 12 h of stimulation, whereas CpG-A ODN-stimulated pDC produce type I IFN for 48 h after stimulation that peaks between 12 and 24 h (59). To further stimulate type I IFN production, CpG-A ODN triggers a positive-feedback loop based on the activation of the type I IFNR by endogenous type I IFN (59, 60). Clearly, our results show that the amount of IFN-{alpha} produced following CpG ODN stimulation was related to the distribution and extent of TRAIL/Apo-2L expression on PBMC. However, we believe it unlikely that the differences in expression on the different PBMC populations were simply a consequence of the amount of IFN-{alpha} produced. In humans, there are multiple IFN-{alpha} genes, with at least 13 IFN-{alpha} genes transcribed (61). The coding sequences of these genes diverge up to 8%, giving rise to 12 different functional subtype proteins (IFN-{alpha}1 and -{alpha}13 are identical). All IFN-{alpha} subtypes are structurally similar and share a common cell surface receptor; however, there is evidence that individual IFN subtypes bind to different sites of the type I IFNR and have different binding affinities, leading to the formation of distinct signaling complexes, which might be expected to differentially recruit downstream signaling pathways (60, 62, 63). Moreover, evidence for the differential induction of IFN-{alpha}-responsive genes in an IFN-{alpha} subtype- and cell type-specific manner has been recently shown (64). Gene expression profiling of T cells stimulated with IFN-{alpha}1, -{alpha}2, or -{alpha}21 found no difference in TRAIL/Apo-2L mRNA levels; however, there was a >2-fold increase in TRAIL/Apo-2L mRNA in DC after stimulation with IFN-{alpha}2. This would suggest that tailoring the contribution of TRAIL/Apo-2L, both at the level at which cells express TRAIL/Apo-2L and how much, in an antitumor immune response may be possible by using distinct IFN-{alpha} subtype(s).


    Acknowledgments
 
We thank Drs. Bennett Elzey, David Lubaroff, and Timothy Ratliff for careful reading of the manuscript. We also acknowledge Linda Buckner for secretarial assistance.


    Footnotes
 
1 This work was supported by a Department of Defense Prostate Cancer Research Program New Investigator Award (PC010599) and a Carver Medical Research Initiative Grant administered through the University of Iowa Carver College of Medicine. Back

2 Address correspondence and reprint requests to Dr. Thomas S. Griffith, Department of Urology, 3204 Medical Education and Biomedical Research Facility, University of Iowa, 375 Newton Road, Iowa City, IA 52242-1089. E-mail address: thomas-griffith{at}uiowa.edu Back

3 Abbreviations used in this paper: DC, dendritic cell; M{phi}, macrophage; CpG ODN, CpG-containing oligodeoxynucleotide; pDC, plasmacytoid DC; L-NMMA, NG-monomethyl-L-arginine; CMA, concanamycin A; FasL, Fas ligand. Back

Received for publication January 12, 2004. Accepted for publication May 5, 2004.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Tokunaga, T., H. Yamamoto, S. Shimada, H. Abe, T. Fukuda, Y. Fujisawa, Y. Furutani, O. Yano, T. Kataoka, T. Sudo, et al 1984. Antitumor activity of deoxyribonucleic acid fraction from Mycobacterium bovis BCG. I. Isolation, physicochemical characterization, and antitumor activity. J. Natl. Cancer Inst. 72:955.
  2. Yamamoto, S., E. Kuramoto, S. Shimada, T. Tokunaga. 1988. In vitro augmentation of natural killer cell activity and production of interferon-{alpha}/{beta} and -{gamma} with deoxyribonucleic acid fraction from Mycobacterium bovis BCG. Jpn. J. Cancer Res. 79:866.[Medline]
  3. Krieg, A. M.. 2002. CpG motifs in bacterial DNA and their immune effects. Annu. Rev. Immunol. 20:709.[Medline]
  4. Kuramoto, E., O. Yano, Y. Kimura, M. Baba, T. Makino, S. Yamamoto, T. Yamamoto, T. Kataoka, T. Tokunaga. 1992. Oligonucleotide sequences required for natural killer cell activation. Jpn. J. Cancer Res. 83:1128.[Medline]
  5. Krieg, A. M., A. K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. A. Koretzky, D. M. Klinman. 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374:546.[Medline]
  6. Krieg, A. M.. 1998. Leukocyte stimulation by oligodeoxynucleotides. C. A. Stein, and A. M. Krieg, eds. Applied Antisense Oligonucleotide Technology 431. Wiley, New York.
  7. Akira, S., K. Takeda, T. Kaisho. 2001. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immunol. 2:675.[Medline]
  8. Takeda, K., S. Akira. 2001. Roles of Toll-like receptors in innate immune responses. Genes Cells 6:733.[Abstract]
  9. Verthelyi, D., R. A. Zeuner. 2003. Differential signaling by CpG DNA in DCs and B cells: not just TLR9. Trends Immunol. 24:519.[Medline]
  10. Hartmann, G., J. Battiany, H. Poeck, M. Wagner, M. Kerkmann, N. Lubenow, S. Rothenfusser, S. Endres. 2003. Rational design of new CpG oligonucleotides that combine B cell activation with high IFN-{alpha} induction in plasmacytoid dendritic cells. Eur. J. Immunol. 33:1633.[Medline]
  11. Isaacs, A., J. Lindenmann. 1987. Virus interference. I. The interferon. By A. Isaacs and J. Lindenmann, 1957. J. Interferon. Res. 7:429.
  12. Luo, Y., X. Chen, T. M. Downs, W. C. DeWolf, M. A. O’Donnell. 1999. IFN-{alpha}2B enhances Th1 cytokine responses in bladder cancer patients receiving Mycobacterium bovis bacillus Calmette-Guérin immunotherapy. J. Immunol. 162:2399.[Abstract/Free Full Text]
  13. Kantarjian, H. M., M. J. Keating, E. H. Estey, S. O’Brien, S. Pierce, M. Beran, C. Koller, E. Feldman, M. Talpaz. 1992. Treatment of advanced stages of Philadelphia chromosome-positive chronic myelogenous leukemia with interferon-{alpha} and low-dose cytarabine. J. Clin. Oncol. 10:772.[Abstract/Free Full Text]
  14. Gresser, I.. 1990. Biologic effects of interferons. J. Invest. Dermatol. 95:66S.[Medline]
  15. Herberman, R. B., C. W. Reynolds, J. R. Ortaldo. 1986. Mechanism of cytotoxicity by natural killer (NK) cells. Annu. Rev. Immunol. 4:651.[Medline]
  16. Lindahl, P., P. Leary, I. Gresser. 1972. Enhancement by interferon of the specific cytotoxicity of sensitized lymphocytes. Proc. Natl. Acad. Sci. USA 69:721.[Abstract/Free Full Text]
  17. Morikawa, K., H. Kubagawa, T. Suzuki, M. D. Cooper. 1987. Recombinant interferon-{alpha}, -{beta}, and -{gamma} enhance the proliferative response of human B cells. J. Immunol. 139:761.[Abstract]
  18. Vogel, S., D. Finbloom, K. English, D. Rosenstreich, S. Langreth. 1983. Interferon-induced enhancement of macrophage Fc receptor expression: {beta}-interferon treatment of C3H/HeJ macrophages results in increased numbers and density of Fc receptors. J. Immunol. 130:1210.[Abstract]
  19. Griffith, T. S., S. R. Wiley, M. Z. Kubin, L. M. Sedger, C. R. Maliszewski, N. A. Fanger. 1999. Monocyte-mediated tumoricidal activity via the tumor necrosis factor-related cytokine, TRAIL. J. Exp. Med. 189:1343.[Abstract/Free Full Text]
  20. Fanger, N. A., C. R. Maliszewski, K. Schooley, T. S. Griffith. 1999. Human dendritic cells mediate cellular apoptosis via tumor necrosis factor-related apoptosis-inducing ligand (TRAIL). J. Exp. Med. 190:1155.[Abstract/Free Full Text]
  21. Zamai, L., M. Ahmad, I. M. Bennett, L. Azzoni, E. S. Alnemri, B. Perussia. 1998. Natural killer (NK) cell-mediated cytotoxicity: differential use of TRAIL and Fas ligand by immature and mature primary human NK cells. J. Exp. Med. 88:2375.
  22. Kayagaki, N., N. Yamaguchi, M. Nakayama, H. Eto, K. Okumura, H. Yagita. 1999. Type I interferons (IFNs) regulate tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) expression on human T cells: a novel mechanism for the antitumor effects of type I IFNs. J. Exp. Med. 189:1451.[Abstract/Free Full Text]
  23. Kemp, T. J., B. D. Elzey, T. S. Griffith. 2003. Plasmacytoid dendritic cell-derived IFN-{alpha} induces TNF-related apoptosis-inducing ligand/Apo-2L-mediated antitumor activity by human monocytes following CpG oligodeoxynucleotide stimulation. J. Immunol. 171:212.[Abstract/Free Full Text]
  24. Krug, A., S. Rothenfusser, V. Hornung, B. Jahrsdorfer, S. Blackwell, Z. K. Ballas, S. Endres, A. M. Krieg, G. Hartmann. 2001. Identification of CpG oligonucleotide sequences with high induction of IFN-{alpha}/{beta} in plasmacytoid dendritic cells. Eur. J. Immunol. 31:2154.[Medline]
  25. Blackwell, S. E., A. M. Krieg. 2003. CpG-A-induced monocyte IFN-{gamma}-inducible protein-10 production is regulated by plasmacytoid dendritic cell-derived IFN-{alpha}. J. Immunol. 170:4061.[Abstract/Free Full Text]
  26. Siegal, F. P., N. Kadowaki, M. Shodell, P. A. Fitzgerald-Bocarsly, K. Shah, S. Ho, S. Antonenko, Y. J. Liu. 1999. The nature of the principal type 1 interferon-producing cells in human blood. Science 284:1835.[Abstract/Free Full Text]
  27. Cella, M., D. Jarrossay, F. Facchetti, O. Alebardi, H. Nakajima, A. Lanzavecchia, M. Colonna. 1999. Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat. Med. 5:919.[Medline]
  28. Martin, J. H., S. W. Edwards. 1993. Changes in mechanisms of monocyte/macrophage-mediated cytotoxicity during culture: reactive oxygen intermediates are involved in monocyte-mediated cytotoxicity, whereas reactive nitrogen intermediates are employed by macrophages in tumor cell killing. J. Immunol. 150:3478.[Abstract]
  29. Kataoka, T., K. Takaku, J. Magae, N. Shinohara, H. Takayama, S. Kondo, K. Nagai. 1994. Acidification is essential for maintaining the structure and function of lytic granules of CTL: effect of concanamycin A, an inhibitor of vacuolar type H+-ATPase, on CTL-mediated cytotoxicity. J. Immunol. 153:3938.[Abstract]
  30. Griffith, T. S., W. A. Chin, G. C. Jackson, D. H. Lynch, M. Z. Kubin. 1998. Intracellular regulation of TRAIL-induced apoptosis in human melanoma cells. J. Immunol. 161:2833.[Abstract/Free Full Text]
  31. Wang, Q., Y. Ji, X. Wang, B. M. Evers. 2000. Isolation and molecular characterization of the 5'-upstream region of the human TRAIL gene. Biochem. Biophys. Res. Commun. 276:466.[Medline]
  32. Hornung, V., S. Rothenfusser, S. Britsch, A. Krug, B. Jahrsdorfer, T. Giese, S. Endres, G. Hartmann. 2002. Quantitative expression of Toll-like receptor 1–10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides. J. Immunol. 168:4531.[Abstract/Free Full Text]
  33. Shibuya, H., T. Nagai, A. Ishii, K. Yamamoto, S. Hirohata. 2003. Differential regulation of Th1 responses and CD154 expression in human CD4+ T cells by IFN-{alpha}. Clin. Exp. Immunol. 132:216.[Medline]
  34. Takeda, K., T. Kaisho, S. Akira. 2003. Toll-like receptors. Annu. Rev. Immunol. 21:335.[Medline]
  35. Krieg, A. M., W. C. Gause, M. F. Gourley, A. D. Steinberg. 1989. A role for endogenous retroviral sequences in the regulation of lymphocyte activation. J. Immunol. 143:2448.[Abstract]
  36. Krieg, A. M., J. Tonkinson, S. Matson, Q. Zhao, M. Saxon, L. M. Zhang, U. Bhanja, L. Yakubov, C. A. Stein. 1993. Modification of antisense phosphodiester oligodeoxynucleotides by a 5' cholesteryl moiety increases cellular association and improves efficacy. Proc. Natl. Acad. Sci. USA 90:1048.
  37. Wiemann, B., C. O. Starnes. 1994. Coley’s toxins, tumor necrosis factor and cancer research: a historical perspective. Pharmacol. Ther. 64:529.[Medline]
  38. Weiner, G. J., H. M. Liu, J. E. Wooldridge, C. E. Dahle, A. M. Krieg. 1997. Immunostimulatory oligodeoxynucleotides containing the CpG motif are effective as immune adjuvants in tumor antigen immunization. Proc. Natl. Acad. Sci. USA 94:10833.[Abstract/Free Full Text]
  39. Heckelsmiller, K., K. Rall, S. Beck, A. Schlamp, J. Seiderer, B. Jahrsdorfer, A. Krug, S. Rothenfusser, S. Endres, G. Hartmann. 2002. Peritumoral CpG DNA elicits a coordinated response of CD8 T cells and innate effectors to cure established tumors in a murine colon carcinoma model. J. Immunol. 169:3892.[Abstract/Free Full Text]
  40. Heckelsmiller, K., S. Beck, K. Rall, B. Sipos, A. Schlamp, E. Tuma, S. Rothenfusser, S. Endres, G. Hartmann. 2002. Combined dendritic cell- and CpG oligonucleotide-based immune therapy cures large murine tumors that resist chemotherapy. Eur. J. Immunol. 32:3235.[Medline]
  41. Hafner, M., R. Zawatzky, C. Hirtreiter, W. A. Buurman, B. Echtenacher, T. Hehlgans, D. N. Mannel. 2001. Antimetastatic effect of CpG DNA mediated by type I IFN. Cancer Res. 61:5523.[Abstract/Free Full Text]
  42. Lonsdorf, A. S., H. Kuekrek, B. V. Stern, B. O. Boehm, P. V. Lehmann, M. Tary-Lehmann. 2003. Intratumor CpG-oligodeoxynucleotide injection induces protective antitumor T cell immunity. J. Immunol. 171:3941.[Abstract/Free Full Text]
  43. Stern, B. V., B. O. Boehm, M. Tary-Lehmann. 2002. Vaccination with tumor peptide in CpG adjuvant protects via IFN-{gamma}-dependent CD4 cell immunity. J. Immunol. 168:6099.[Abstract/Free Full Text]
  44. Hahne, M., T. Renno, M. Schroeter, M. Irmler, L. French, T. Bornard, H. R. MacDonald, J. Tschopp. 1996. Activated B cells express functional Fas ligand. Eur. J. Immunol. 26:721.[Medline]
  45. Mariani, S. M., P. H. Krammer. 1998. Differential regulation of TRAIL and CD95 ligand in transformed cells of the T and B lymphocyte lineage. Eur. J. Immunol. 28:973.[Medline]
  46. Mariani, S. M., P. H. Krammer. 1998. Surface expression of TRAIL/Apo-2 ligand in activated mouse T and B cells. Eur. J. Immunol. 28:1492.[Medline]
  47. Eerola, A. K., Y. Soini, P. Paakko. 1999. Tumour infiltrating lymphocytes in relation to tumour angiogenesis, apoptosis and prognosis in patients with large cell lung carcinoma. Lung Cancer 26:73.[Medline]
  48. Tormanen-Napankangas, U., Y. Soini, P. Paakko. 2001. High number of tumour-infiltrating lymphocytes is associated with apoptosis in non-small cell lung carcinoma. APMIS 109:525.[Medline]
  49. Nzula, S., J. J. Going, D. I. Stott. 2003. Antigen-driven clonal proliferation, somatic hypermutation, and selection of B lymphocytes infiltrating human ductal breast carcinomas. Cancer Res. 63:3275.[Abstract/Free Full Text]
  50. Lanzavecchia, A.. 1990. Receptor-mediated antigen uptake and its effect on antigen presentation to class II-restricted T lymphocytes. Annu. Rev. Immunol. 8:773.[Medline]
  51. Song, K., Y. Chen, R. Goke, A. Wilmen, C. Seidel, A. Goke, B. Hilliard. 2000. Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is an inhibitor of autoimmune inflammation and cell cycle progression. J. Exp. Med. 191:1095.[Abstract/Free Full Text]
  52. Brunner, T., R. J. Mogil, D. LaFace, N. J. Yoo, A. Mahboubi, F. Echeverri, S. J. Martin, W. R. Force, D. H. Lynch, C. F. Ware, et al 1995. Cell-autonomous Fas (CD95)/Fas-ligand interaction mediates activation-induced apoptosis in T-cell hybridomas. Nature 373:441.[Medline]
  53. Brunner, T., N. J. Yoo, T. S. Griffith, T. A. Ferguson, D. R. Green. 1996. Regulation of CD95 ligand expression: a key element in immune regulation?. Behring Inst. Mitt. 97:161.
  54. Jeremias, I., I. Herr, T. Boehler, K. M. Debatin. 1998. TRAIL/Apo-2-ligand-induced apoptosis in human T cells. Eur. J. Immunol. 28:143.[Medline]
  55. Martinez-Lorenzo, M. J., M. A. Alava, S. Gamen, K. J. Kim, A. Chuntharapai, A. Pineiro, J. Naval, A. Anel. 1998. Involvement of APO2 ligand/TRAIL in activation-induced death of Jurkat and human peripheral blood T cells. Eur. J. Immunol. 28:2714.[Medline]
  56. Bonfoco, E., P. M. Stuart, T. Brunner, T. Lin, T. S. Griffith, Y. Gao, H. Nakajima, P. A. Henkart, T. A. Ferguson, D. R. Green. 1998. Inducible nonlymphoid expression of Fas ligand is responsible for superantigen-induced peripheral deletion of T cells. Immunity 9:711.[Medline]
  57. Bauer, M., V. Redecke, J. W. Ellwart, B. Scherer, J. P. Kremer, H. Wagner, G. B. Lipford. 2001. Bacterial CpG-DNA triggers activation and maturation of human CD11c, CD123+ dendritic cells. J. Immunol. 166:5000.[Abstract/Free Full Text]
  58. Kadowaki, N., S. Ho, S. Antonenko, R. W. Malefyt, R. A. Kastelein, F. Bazan, Y. J. Liu. 2001. Subsets of human dendritic cell precursors express different Toll-like receptors and respond to different microbial antigens. J. Exp. Med. 194:863.[Abstract/Free Full Text]
  59. Kerkmann, M., S. Rothenfusser, V. Hornung, A. Towarowski, M. Wagner, A. Sarris, T. Giese, S. Endres, G. Hartmann. 2003. Activation with CpG-A and CpG-B oligonucleotides reveals two distinct regulatory pathways of type I IFN synthesis in human plasmacytoid dendritic cells. J. Immunol. 170:4465.[Abstract/Free Full Text]
  60. Marie, I., J. E. Durbin, D. E. Levy. 1998. Differential viral induction of distinct interferon-{alpha} genes by positive feedback through interferon regulatory factor-7. EMBO J. 17:6660.[Medline]
  61. De Maeyer, E., J. De Maeyer-Guignard. 1998. Type I interferons. Int. Rev. Immunol. 17:53.[Medline]
  62. Hiscott, J., K. Cantell, C. Weissmann. 1984. Differential expression of human interferon genes. Nucleic Acids Res. 12:3727.[Abstract/Free Full Text]
  63. MacDonald, N. J., D. Kuhl, D. Maguire, D. Naf, P. Gallant, A. Goswamy, H. Hug, H. Bueler, M. Chaturvedi, J. de la Fuente, et al 1990. Different pathways mediate virus inducibility of the human IFN-{alpha}1 and IFN-{beta} genes. Cell 60:767.[Medline]
  64. Hilkens, C. M., J. F. Schlaak, I. M. Kerr. 2003. Differential responses to IFN-{alpha} subtypes in human T cells and dendritic cells. J. Immunol. 171:5255.[Abstract/Free Full Text]

Related articles in The JI:

IN THIS ISSUE

The JI 2004 173: 713-714. [Full Text]  



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
M. P. Simons, K. G. Leidal, W. M. Nauseef, and T. S. Griffith
TNF-related apoptosis-inducing ligand (TRAIL) is expressed throughout myeloid development, resulting in a broad distribution among neutrophil granules
J. Leukoc. Biol., March 1, 2008; 83(3): 621 - 629.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
B. G. Molenkamp, P. A.M. van Leeuwen, S. Meijer, B. J.R. Sluijter, P. G.J.T.B. Wijnands, A. Baars, A. J.M. van den Eertwegh, R. J. Scheper, and T. D. de Gruijl
Intradermal CpG-B Activates Both Plasmacytoid and Myeloid Dendritic Cells in the Sentinel Lymph Node of Melanoma Patients
Clin. Cancer Res., May 15, 2007; 13(10): 2961 - 2969.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. J. Kemp, A. T. Ludwig, J. K. Earel, J. M. Moore, R. L. VanOosten, B. Moses, K. Leidal, W. M. Nauseef, and T. S. Griffith
Neutrophil stimulation with Mycobacterium bovis bacillus Calmette-Guerin (BCG) results in the release of functional soluble TRAIL/Apo-2L
Blood, November 15, 2005; 106(10): 3474 - 3482.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Papageorgiou, L. Lashinger, R. Millikan, H. B. Grossman, W. Benedict, C. P. N. Dinney, and D. J. McConkey
Role of Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand in Interferon-Induced Apoptosis in Human Bladder Cancer Cells
Cancer Res., December 15, 2004; 64(24): 8973 - 8979.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Related articles in The JI
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kemp, T. J.
Right arrow Articles by Griffith, T. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kemp, T. J.
Right arrow Articles by Griffith, T. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS