The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fiorucci, S.
Right arrow Articles by Morelli, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fiorucci, S.
Right arrow Articles by Morelli, A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ACETYLSALICYLIC ACID
*NITRIC OXIDE
The Journal of Immunology, 2004, 173: 874-882.
Copyright © 2004 by The American Association of Immunologists

Nitric Oxide Regulates Immune Cell Bioenergetic: A Mechanism to Understand Immunomodulatory Functions of Nitric Oxide-Releasing Anti-Inflammatory Drugs

Stefano Fiorucci1,*, Andrea Mencarelli*, Eleonora Distrutti*, Monia Baldoni*, Piero del Soldato{dagger} and Antonio Morelli*

* Dipartimento di Medicina Clinica e Sperimentale, Clinica di Gastroenterologia ed Epatologia, Università degli Studi di Perugia, Perugia, Italy; and {dagger} Nicox SA, Sophia Antipolis, France


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The 2-(acetyloxy)benzoic acid 3-(nitrooxymethyl)phenyl ester (NCX-4016) is a NO-releasing derivative of aspirin. In this study, we provide evidence that NCX-4016 delivered to PMBC-derived T lymphocytes and monocytes causes a transitory inhibition of cell respiration and {approx}50% reduction of cellular ATP, which translates in a time-reversible inhibition of cell proliferation and IL-2, IL-4, IL-5, and IFN-{gamma} secretion. Exposure of lymphocytes and monocytes to aspirin, 2-(acetyloxy)benzoic acid 3-(hydroxymethyl)phenyl ester (NCX-4017), a non-NO-releasing analog of NCX-4016, and cyclooxygenase inhibitors, reduced PG formation, but has no effect on cytokine/chemokine release. In contrast, delivering NO with (z)-1-[2-(2-aminoethyl)-N-(2-ammonioethyl)amino] diazen-1-ium-1,2 diolate (DETA-NO) reproduced most of the metabolic and anti-cytokine activities of NCX-4016. Scavenging NO with hemoglobin or adding selective substrates of complex II, III, and IV of the mitochondrial respiratory chain reverses NCX-4016' inhibitory activities. Exposure to DETA-NO and NCX-4016 enhances glucose uptake, glycolytic rate, and lactate generation in CD3/CD28-costimulated lymphocytes, while reduced citric acid cycle intermediates. These effects were not reproduced by selective and nonselective cyclooxygenase 2 inhibitors. In summary, we demonstrated that exposure of lymphocytes to NCX-4016 causes a metabolic hypoxia that inhibits lymphocyte reactivity to costimulatory molecules, providing a potential counteregulatory mechanism to control activated immune system.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Energy metabolism of immune cells is subject to drastic changes during cell activation by Ags and mitogens and plays a central role in regulating cell response in innate and adaptive immunity (1, 2, 3). A rapid and sustained increase of energy expenditure is required to support proliferation, differentiation, and effector functions of immune cells, including the increased synthesis of cytokines, chemokines, and surface adhesion molecules. However, in contrast to hepatocytes and myocytes, resting lymphocytes and monocytes do not have large internal glycogen stores and are highly dependent on the import of extracellular glucose and glycolysis for the production of ATP (4, 5, 6, 7, 8). Regulation of glucose uptake in lymphocytes is only partially defined. Indeed, while many studies suggest that glucose uptake and glycolytic regulation are homeostatically controlled by cellular ATP and metabolite levels, a growing body of evidence indicates that bioenergetic functions are the selective target of costimulatory molecule, such as CD28 (9, 10). Thus, it has been shown that costimulation of TCR of human peripheral blood cell with anti-CD28 mAb leads to PI3K/Akt-dependent up-regulation of glucose transporter-1 (GLUT-1)2 expression, glucose uptake, and glycolytic flux, allowing T cells to anticipate energetic and biosynthetic needs associated with an immune stimulation (10).

During aerobic glycolysis, ATP is generated by mitochondria as a function of O2 consumption in a chain of reactions that involves a group of enzymes clustered at the inner mitochondrial membrane and collectively known as mitochondrial respiratory chain (11). Microenvironmental conditions found in injured tissues, however, are characterized by low levels of O2 and glucose, as well as high concentrations of lactate and reductive metabolites (12). In those areas, inflammation and vasodilation are often maintained by activation of the high output NO synthase (i.e., the inducible NO synthase (NOS)). NO, a physiological messenger that regulates many aspects of cell physiology, is progressively emerging as a possible modulator of O2 consumption (13, 14, 15) and energy expenditure in many cell types (16, 17, 18). Thus, exposure to NO causes the S-nitrosylation/inhibition of cytochrome c oxidase, i.e., the terminal component (complex IV) of the mitochondrial respiratory chain responsible for almost all O2 consumption (15), switching cell bioenergetic functions from an aerobic to anaerobic set, thus making NO a potential mediator of immune cell function (19, 20, 21).

Nonsteroidal anti-inflammatory drugs (NSAIDs) modulate mitochondrial respiratory chain in nonimmune cells (3). Disruption of mitochondrial function caused by NSAIDs, however, is irreversible and has been mechanistically linked to gastrointestinal side effects rather than to the anti-inflammatory activity (3). The 2-(acetyloxy)benzoic acid 3-(nitrooxymethyl)phenyl ester (NCX-4016), an anti-thrombotic and anti-inflammatory agent (reviewed in Ref. 22) that consists of an acetylsalicylic acid (ASA)-like moiety linked to a nitroxybutyl moiety, represents the prototype of a new family of NSAIDs that inhibits cyclooxygenase (COX) activities and releases NO (NO-NSAIDs). Thus, while NCX-4016 inhibits COX-1 and COX-2, it also exerts COX-independent, NO-mediated activities on platelets, lymphocytes, and monocytes (22, 23, 24, 25, 26, 27, 28). Because modulation of cell respiration might represent an important mechanism for controlling immune cell reactivity, we have designed a study to investigate whether NCX-4016 regulates bioenergetic functions in lymphocytes and monocytes. The results of the present study demonstrate that regulation of mitochondrial functions represents a new anti-inflammatory mechanism of NO-releasing NSAIDs.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
The (z)-1-[2-(2-aminoethyl)-N-(2-ammonioethyl)amino] diazen-1-ium-1,2 diolate (DETA-NO) was obtained from Alexis Biochemicals (San Diego, CA). NCX-4016 and 2-(acetyloxy)benzoic acid 3-(hydroxymethyl)phenyl ester (NCX-4017), a non-NO-releasing analog of NCX-4016, were from Nicox SA (Sophia Antipolis, France). The 2,7-dichlorodihydrofluorescein diacetate was from Alexis Biochemicals. Malate, pyruvate, succinate, rotenone, antimycin A, myxothiazol, oligomycin, and BSA were obtained from Sigma-Aldrich (St. Louis, MO).

PBMC preparation and monocytes and T lymphocyte isolation

Human PBMCs were obtained from normal individual donors to the Blood Bank Service of Perugia University Hospital. PBMCs were isolated by density gradient centrifugation (400 x g for 30 min at room temperature) through a Ficoll-Hypaque gradient (Pharmacia Biotech, Uppsala, Sweden), as described (27). The major band, containing the mononuclear cells, was harvested with a yield typically of 1.5–2 x 108 cells per isolation. PBMC were washed by centrifugation in RPMI 1640 (Life Technologies Italia Srl, Milan, Italy) supplemented with 10% FCS, 2 mM L-glutamine, and 1% penicillin/streptomycin (Life Technologies), henceforth called culture medium, and 5 x 107 PBMCs were allowed to adhere in 75-cm2 cell culture flasks for 45 min in a 37°C humidified 5% CO2 atmosphere. The nonadherent cells were removed, and adherent cells were washed with sterile PBS, harvested, and stained with monocyte-specific anti-CD14 mAb to assess the purity of the preparation. Ninety percent of the isolated cells expressed CD14. Cell viability, evaluated by trypan blue exclusion, was always >95%. In some experiments, highly purified monocytes (>97%) were obtained by positive selection of CD14+ cells. Highly purified T cells (>98%) were obtained from the plastic-nonadherent cell population by negative selection of T lymphocytes using anti-CD19-coated magnetic cell separation microbeads (Miltenyi Biotec, Florence, Italy).

Cell proliferation

Cell proliferation was assessed by measuring [3H]thymidine incorporation. A total of 1 µCi of [3H]thymidine was added for 16 h to the cultures. At the end of incubation, cells were harvested onto glass-fiber filters, and radioactivity was counted in a Beckman scintillation counter (Beckman Coulter, Milan, Italy). Data are represented as the mean disintegrations per minute ± SD from triplicate cultures.

NO generation and oxygen consumption

NO formation was measured using a 2-mm NO-sensitive electrode, as described previously (16, 18, 26), connected to the ISO-NO Mark II meter (World Precision Instruments, Sarasota, FL). The NO electrode was calibrated by addition of known concentrations of NaNO2 under reducing conditions (Kl/H2SO4). O2 consumption was measured using a Clark-type oxygen electrode (World Precision Instruments) in a magnetically stirred, thermostatically regulated chamber at 30°C (26). Briefly, cells were suspended in a total volume of 0.5 ml of air-saturated isotonic buffer composed of 220 mM mannitol, 70 mM sucrose, 10 mM HEPES (pH 7.2), 5 mM KH2PO4, and 1 mM EGTA. After 6 h of incubation with 100 µM DETA-NO and NCX-4016, CD3/CD28-stimulated T cells were gently permeabilized with digitonin, and O2 consumption measured with or without 10 µM hemoglobin (Hb) in the medium. O2 use by complexes I, III, and IV was assessed after the addition of 10 mM glutamate plus 2 mM malate (15, 16, 17, 18, 26). ADP-stimulated O2 consumption by complexes II, III, and IV was measured after the addition of 10 mM succinate and 10 µM rotenone. Azide-sensitive cytochrome oxidase activity (complex IV) was measured by using 3 mM ascorbate plus 0.3 mM N,N,N',N'-tetramethyl-p-phenylenediamine in the presence of 2 µM antimycin A (16, 17, 18).

Flow cytometric measurement of mitochondrial membrane potential ({Delta}{psi}m)

The {Delta}{psi}m was measured, as previously described, in cells loaded with 5,5',6,6'-tetrachloro-1,1',3,3'-tetraethylbenzimidazolocarbocyanine iodide (JC-1) (26). Briefly, after exposure to different agents, monocytes and lymphocytes (5 x 105/ml) were incubated with 5 µg/ml JC-1 (26). This cyanine dye accumulates in the mitochondrial matrix under the influence of the {Delta}{psi}m and forms J aggregates that have characteristic absorption and emission spectra. Flow cytometry was performed on an Epics XL instrument (Beckman Coulter). After gating out small sized (i.e., noncellular) debris, 50,000 events were collected for each analysis. Results are expressed as either the mean aggregate fluorescence (red) alone or as the ratio of aggregate/monomer (red/green).

Peroxynitrite assay

Levels of peroxynitrite were measured with the fluorescent probe 5-(and-6)-carboxy-2',7'-dichlorofluorescein diacetate (DCFDA), which can be hydrolyzed by cellular nonspecific esterases and oxidized to form the fluorescent product, 2',7'-dichlorofluorescein, after reactions with peroxynitrite (26). After loading with 10 µM DCFDA at 37°C for 30 min, lymphocytes were washed twice to remove unloaded dye and incubated with 100 µm ASA, NCX-4016, DETA-NO, and NCX-4017 for 3 h, and fluorescence was determined at 502 nm excitation and 523 nm emission for DCFDA.

Glucose uptake

Glucose uptake was measured using a modified protocol of Whetton et al. (4). Briefly, stimulated T cells and monocytes were incubated for 15 min at 37°C in glucose uptake buffer (8.1 mM Na2HPO4, 1.4 mM KH2PO4, 2.6 mM KCl, 136 mM NaCl, 0.5 mM MgCl2, 0.9 mM CaCl2, pH 7.4) to deplete intracellular glucose stores. Triplicate samples of 1 x 106 cells were incubated with 1 µCi of [3H]2-deoxyglucose (New England Nuclear, Boston, MA) in glucose uptake buffer for 2 min at room temperature and immediately spun through a layer of bromododecane (Sigma-Aldrich) into 20% perchloric acid/8% sucrose, stopping the reaction and separating the cells from unincorporated [3H]2-deoxyglucose. The perchloric acid/sucrose/T cell layer was removed and analyzed by liquid scintillation using a 1450 Beckman (Beckman Coulter) scintillation counter.

GLUT-1 mRNA assay

In mammalian nonepithelial cells, facilitated transport of glucose is mediated by a family of stereospecific transport proteins known as GLUT proteins (29). To examine GLUT-1 expression, lymphocytes were incubated with the appropriate agent and then lysed. RNA was isolated with the RNeasy kit (Qiagen, Valencia, CA), and cDNA was prepared with Superscript II RNase H– reverse transcriptase (Life Technologies, Rockville, MD). The sequence of sense primers used in RT-PCR for GLUT-1 was TCCACGAGCATCTTCGAGA, and the antisense was ATACTGGAAGCACATGCCC. For GAPDH, the sense primer was TGGTATCGTGGAAGGACTCATG, and the antisense primer was ATGCCAGTGAGCTTCCCGTTCAGC. The PCR products were separated by electrophoresis in 1.5% agarose gels and visualized with ethidium bromide stain.

ATP and lactate assay

ATP and lactate concentrations were measured in the same experiments (16, 17, 18). Thus, aliquots of the cell suspensions (monocytes and T lymphocytes) were acidified with HClO4 and neutralized with KHCO3. Glucose and lactate levels in culture supernatants were measured using enzymatic diagnostic kits (Sigma-Aldrich), following the manufacturer’s instructions. ATP concentrations were measured by chemiluminescence using a commercially available kit (Sigma-Aldrich) following the manufacturer’s instructions.

Determination of enzymatic activities

For determinations of total aconitase and succinate dehydrogenase activity, the cells were collected and sonicated with Tris buffer (50 mM, pH 7.4) containing protease inhibitor mixture tablet (Boehringer Mannheim, Mannheim, Germany), and the cell lysate was separated from cellular debris by centrifugation (14,000 x g, 1 min). A total of 50 µg of protein from the supernatant was mixed with reaction buffer (50 mM Tris, pH 7.4, 1 U/ml isocitrate dehydrogenase, 0.6 mM MnCl2, 20 µM fluorocitrate, 400 µM cis-aconitate, 1 µM phenazine methosulfate, 200 µM cytochrome c, and 200 µM NADP), and the mixture was incubated at 25°C for 30 min. The OD was measured at 550 nm. For succinate dehydrogenase determinations, 50 µg of protein from the supernatant was mixed with a different reaction buffer (50 mM Tris, pH 7.4, 20 mM sodium succinate, 1 mM potassium cyanide, 1 µM phenazine methosulfate, and 5 mM cytochrome c), and the OD was measured at 550 nm after 5 min at 25°C (16, 17, 18).

Detection of cell death and apoptosis

Apoptotic cells were detected by flow cytometry after staining with FITC-conjugated annexin V and propidium iodide (PI) by using a commercially available kit (annexin V-FITC kit; Immunotech, Marseille, France), as described (26). Cells were considered apoptotic when they were annexin V positive and PI negative. Staining of cells by PI was an indicator of the loss of plasma membrane integrity and therefore of necrosis (16, 26).

Cytokine and chemokine assay

RANTES, IL-1{beta}, IL-6, IL-8, IL-12p40, IL-18, TNF-{alpha}, and IFN-{gamma} concentrations in cell supernatants were measured using commercial ELISA kits (Endogen, Woburn, MA), using the standard procedure recommended by manufacturers. Cytokine concentrations were calculated from the standard curves using the GraphPad Prism software (GraphPad, San Diego, CA), and results were expressed as pg/ml. Each kit was specific and showed negligible cross-reactivity with several other cytokines (data furnished by the manufacturer). PGE2 levels were measured in cell supernatants using a commercially available enzyme immunoassay system (Cayman Chemical, Milan, Italy). PGE2 concentrations were calculated from the standard curve, and results were expressed as pg/ml. The kit was specific and showed no cross-reactivity with several other eicosanoids (data furnished by the manufacturer).

Statistics

Data were analyzed with two-tailed Student’s t test using Prism 3 (GraphPad). Values are given as mean ± SEM. A p value <0.05 was considered to be statistically significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Effect of DETA-NO and NCX-4016 on energy metabolism in resting T cells

As illustrated in Fig. 1, exposure of resting lymphocytes to DETA-NO and NCX-4016 resulted in a time- and concentration-dependent formation of NO. At the steady state (3 h of incubation), exposure of PMBC-derived lymphocytes to 100 µM DETA-NO and NCX-4016 generated {approx}800 and {approx}400 nM NO, as assessed by a NO-sensitive electrode (n = 8; p < 0.001 vs medium alone). Adding nitro-L-arginine-methyl ester, 100 µM, to inhibit the constitutive and the inducible form of NOS (data not shown) had no effect on NO formation caused by DETA-NO and NCX-4016 (n = 4; p > 0.05 vs DETA-NO and NCX-4016). Exposure of resting lymphocytes to DETA-NO and NCX-4016, 100 µM, for 3 h resulted in a time- and concentration-dependent increase of {Delta}{psi}m (Fig. 1, b and c; n = 8; p < 0.01 vs baseline). However, not only the {Delta}{psi}m hyperpolarization induced by NCX-4016 was more pronounced than that caused by DETA-NO, but the effect was sustained over time and maintained for up to 12 h (Fig. 1c). Furthermore, DETA-NO exerts a biphasic effect on {Delta}{psi}m, i.e., an early hyperpolarization, followed by a subsequent depolarization (Fig. 1c). Exposure of PMBC-derived lymphocytes to NCX-4016 and DETA-NO associates with a profound decline in O2 consumption and ATP generation (Fig. 1d; n = 8; p < 0.01 vs medium). Indeed, as shown in Fig. 1e, measurement of the steady state ATP levels indicated that lymphocytes treated with 100 µM NCX-4016 and DETA-NO for 24 h have nearly half of the level of ATP of the cells exposed to the medium alone (n = 8; p < 0.05 vs medium). As shown in Fig. 1f, exposure to DETA-NO, but not to NCX-4016, resulted in 3- to 4-fold increase of peroxynitrite concentrations (n = 7; p < 0.01 vs medium). In contrast to NCX-4016 and DETA-NO, ASA and NCX-4017, a non-NO-releasing derivative of NCX-4016, did not induce NO formation and failed to modulate O2 consumption, {Delta}{psi}m, and ATP levels, nor did they induce peoxynitrite formation (n = 6–7; p > 0.05 vs medium alone). Exposure to NCX-4016 and DETA-NO had no effect on cell survival rates, resulting in 24-h apoptotic rates of 2.0 ± 0.3, 2.4 ± 0.5, and 2.6 ± 0.9%, respectively, in cell treated with medium alone or 100 µM NCX-4016 and DETA-NO.



View larger version (25K):
[in this window]
[in a new window]
  		FIGURE 1. Effect of DETA-NO and NCX-4016 on resting lymphocytes. a, NO generation in response to NCX-4016 and DETA-NO in resting lymphocytes. NO formation was monitored continuously for 3 h using a NO-sensitive electrode. Data are mean ± SE of eight independent measures. *, p < 0.01 vs control cells. b, Changes in {Delta}{psi}m as measured by JC-1 relative red fluorescence intensity. The mitochondrial potential was assessed after 3 h of incubation with each agent. Data are mean ± SE of eight independent measures. *, p < 0.01 vs control cells. c, Time course of {Delta}{psi}m in lymphocytes incubated with 100 µM NCX-4016, DETA-NO, ASA, and NCX-4017. Data are mean ± SE of eight independent measures. *, p < 0.01 vs control cells. d, DETA-NO and NCX-4016 inhibit O2 consumption in resting lymphocytes. Data are mean ± SE of eight independent measures; *, p < 0.01 vs control cells. e, ATP levels were measured in resting lymphocytes incubated for 24 h. Data are mean ± SE of eight independent measures. *, p < 0.05 vs control cells. f, DETA-NO, 100 µM, increases peroxynitrite formation. Data are mean ± SE of eight independent measures. *, p < 0.05 vs control cells.

 
Effect of DETA-NO and NCX-4016 on lymphocyte effector functions

Because proliferation and production of chemokine and cytokines are hallmarks of lymphocyte function, we then investigated whether NCX-4016 modulates cytokine release from lymphocytes challenged with anti-CD3/anti-CD28 mAbs. As shown in Fig. 2, a and b, CD3/CD28 cross-linking triggers lymphocyte proliferation and cytokine release, an event that was significantly attenuated by coincubating the cells with 100 µM NCX-4016 (n = 8; p < 0.01 vs anti-CD3/anti-CD28 alone), but not with ASA. NCX-4016 did not induce cell toxicity because only 4.0 ± 0.3% of anti-CD3/anti-CD28-stimulated lymphocytes stained positively to annexin V after exposure to 100 µM NCX-4016 compared with 2.6 ± 0.4% of control cells and 2.9 ± 0.8% of lymphocytes treated with anti-CD3/anti-CD28 alone (n = 6; p > 0.05 vs medium).



View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 2. Effect of DETA-NO and NCX-4016 on effector functions of lymphocytes stimulated with anti-CD3/anti-CD28. a, DETA-NO and NCX-4016 inhibit cell proliferation induced by costimulatory molecules. Data are mean ± SE of eight independent measures. *, p < 0.01 vs anti-CD3/anti-CD28 alone. b, DETA-NO and NCX-4016 inhibit cytokine production induced by costimulatory molecules. Data are mean ± SE of eight independent measures. *, p < 0.01 vs anti-CD3/anti-CD28 alone. c and d, Inhibition of IL-2 secretion caused by DETA-NO and NCX-4016 is time reversible. Data are mean ± SE of six independent measures. *, p < 0.01 vs anti-CD3/anti-CD28 alone.

 
To evaluate whether inhibition of cytokine release induced by NCX-4016 was time reversible, lymphocytes were rechallenged with a second addition of anti-CD3/anti-CD28 mAbs 24 h after starting the first incubation with NCX-4016. As shown in Fig. 2, c and d, the second addition of costimulatory mAbs fully restored the ability of lymphocytes to generate cytokine in response to CD3/CD28 cross-linking (n = 8; p > 0.05 vs LPS in the second incubation).

Similarly to NCX-4016, DETA-NO, 100 µM, reduced lymphocyte proliferation and IL-2, IL-4, and IL-5 release induced by lymphocyte stimulation with anti-CD3/anti-CD28 (n = 8; p < 0.05 vs LPS). However, in contrast to NCX-4016, DETA-NO failed to modulate IFN-{gamma} secretion (n = 8; p > 0.05 vs LPS). Similarly to NCX-4016, inhibition of IL-2 release caused by DETA-NO was time reversible (Fig. 2, c and d).

To investigate whether the effect of NCX-4016 extended to other immune cells, we tested whether this compound inhibits cytokine/chemokine release from LPS-stimulated monocytes and found that, similarly to lymphocytes, exposure to NCX-4016 and DETA-NO, 100 µM, inhibited cytokine/chemokine secretion induced by exposure of cells to 10 µg/ml LPS for 24 h (Fig. 3, a and b; n = 6; p < 0.01 vs LPS). This effect was not reproduced by ASA or NCX4017 (data not shown). Inhibition of cytokine secretion caused NCX-4016 in LPS-primed monocytes to be time reversible. Thus, as shown in Fig. 3, c and d, inhibition of IL-1{beta} and IL-6 secretion caused by NCX-4016 in monocytes, fully reversed after a second addition of LPS (n = 8; p < 0.01 vs LPS). DETA-NO was significantly less effective than NCX-4016 in modulating cytokine and chemokine release in response to LPS, and while it inhibited IL-1{beta}, IL-6, IL-12p40, and IL-18 (n = 8; p < 0.05 vs LPS alone), it had no effect on secretion of RANTES, IL-8, IFN-{gamma}, and TNF-{alpha} induced by LPS (n = 8; p > 0.05 vs LPS alone).



View larger version (34K):
[in this window]
[in a new window]
  		FIGURE 3. Effect of DETA-NO and NCX-4016 on effector functions of PMBC-derived monocytes stimulated with bacterial endotoxin, 10 µg/ml. a and b, DETA-NO and NCX-4016 inhibit cytokine and chemokine production induced by LPS. Data are mean ± SE of eight independent measures. *, p < 0.01 vs LPS alone. c and d, Inhibition of IL-1{beta} and IL-6 secretion caused by DETA-NO and NCX-4016 is time reversible. Data are mean ± SE of eight independent measures. *, p < 0.01 vs LPS alone.

 
Because NCX-4016 has two active moieties and both contribute to its pharmacological effects, we have then explored whether inhibition of COX-1 and COX-2 is involved in cytokine/chemokine regulation exerted by NCX-4016 on lymphocytes (data not shown) and monocytes. As illustrated in Fig. 4, however, despite the fact that incubation with maximally effective concentrations of ASA and selective and nonselective COX-2 inhibitors (indomethacin and celecoxib) abrogated PGE2 and 6-keto-PGF1{alpha} release from LPS-stimulated monocytes (n = 6; p < 0.01 vs medium), these agents failed to reduce IL-1{beta}, IL-18, and IFN-{gamma} secretion (Fig. 4b; n = 8).



View larger version (14K):
[in this window]
[in a new window]
  		FIGURE 4. a, NCX-4016 abrogated PGE2 and 6-keto-PGF1{alpha} release induced in monocytes by LPS, 10 µg/ml. Data are mean ± SE of eight independent measures. *, p < 0.01 vs LPS alone. b, Selective and nonselective COX-2 inhibitors fail to inhibit cytokine secretion induced by LPS. Data are mean ± SE of eight independent measures. *, p < 0.01 vs LPS alone.

 
Effect of DETA-NO and NCX-4016 on ATP and glycolysis in stimulated T cells

Measurement of the steady state ATP levels indicated that lymphocytes (Fig. 5, a and b) and monocytes (Fig. 5, c and d) exposedto NCX-4016 and DETA-NO (100 µM) have nearly half the level of the cells treated with anti-CD3/anti-CD28 or LPS (n = 8; p < 0.01). The ATP levels in cells treated with DETA-NO and NCX-4016 were the same as control cells. Although exposure to anti-CD3/anti-CD28 and LPS markedly increased O2 consumption, NCX-4016 and DETA-NO (Fig. 5; n = 8; p < 0.01) abrogate these changes.



View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 5. Effect of DETA-NO and NCX-4016 on ATP levels and O2 consumption in lymphocytes and monocytes. a and b, Effect of NO donors, 100 µM, on ATP concentrations and O2 consumption in lymphocytes exposed to anti-CD3/anti-CD28. Data are mean ± SE of eight independent measures. *, p < 0.01 vs anti-CD3/anti-CD28. c and d, Effect of NO donors, 100 µM, on ATP concentrations and O2 consumption in LPS-primed monocytes. Data are mean ± SE of eight independent measures. *, p < 0.01 vs LPS.

 
As shown in Fig. 6, stimulation of lymphocytes with anti-CD3/anti-CD28 for as little as 6 h was sufficient to produce a significant increase in glucose uptake (n = 6; p < 0.001 vs medium), while either Ab alone had no effect on the glucose uptake rate (data not shown). Addition of NCX-4016 and DETA-NO, 100 µM, resulted in a further stimulation of glucose uptake (Fig. 6a; n = 6; p < 0.05 vs CD3/CD28 alone). Stimulation of glucose uptake by CD3/CD28 costimulation correlated with increased expression of the GLUT-1 mRNA (Fig. 6, b and c; n = 6; p < 0.05 vs control cells) (4, 10). This effect was maintained in cells exposed to DETA-NO and NCX-4016, 100 µM, for 18 h (n = 6–8).



View larger version (29K):
[in this window]
[in a new window]
  		FIGURE 6. Effect of DETA-NO and NCX406 on lymphocyte’s bioenergetic. a, DETA-NO and NCX-4016 engance glucose uptake in response to anti-CD3/anti-CD28. Data are mean ± SE of six independent measures. *, p < 0.01 vs anti-CD3/anti-CD28. b, RT-PCR analysis of GLUT-1 expression in lymphocytes incubated with anti-CD3/anti-CD28 and DETA-NO and NCX-4016. Lanes are: 1, untreated lymphocytes; 2, lymphocytes treated with anti-CD3/anti-CD28; 3, lymphocytes treated with anti-CD3/anti-CD28 plus DETA-NO, 100 µM; 4, lymphocytes treated with anti-CD3/anti-CD28 plus NCX-4016, 100 µM; and 5, lymphocytes treated with anti-CD3/anti-CD28 plus aspirin, 100 µM. The PCR is representative of at least six others. c, Densitometric analysis of RT-PCR bands. Data are mean ± SE of six to eight independent measures. *, p < 0.01 vs untreated cells. d, NO donors increase 6-phosphofructokinase activity. Data are mean ± SE of six independent measures. *, p < 0.05 vs untreated cells; **, p < 0.05 vs cells incubated with anti-CD3/anti-CD28. e, Exposure of anti-CD3/anti-CD28-primed lymphocytes to NO donors increases lactate secretion. Data are mean ± SE of eight independent measures. *, p < 0.05 vs untreated cells; **, p < 0.05 vs cells incubated with anti-CD3/anti-CD28. f and g, Exposure of anti-CD3/anti-CD28-primed lymphocytes to NO donors reduces the activity of succinate dehydrogenase and aconitase activity. Data are mean ± SE of eight independent measures. *, p < 0.05 vs untreated cells; **, p < 0.05 vs cells incubated with anti-CD3/anti-CD28.

 
Consistent with these data, exposure of anti-CD3/anti-CD28-stimulated lymphocytes to NCX-4016 and DETA-NO resulted in a significant enhancement of the glycolytic rate, as assessed by measuring the activity of 6-phosphofructokinase (Fig. 6d; n = 6; p < 0.05 vs control cells). However, data shown in Fig. 6e demonstrated that the major product of increased glycolysis was lactate. Lactate generation was even further increased by the exposure of CD3/CD28-costimulated lymphocytes to NCX-4016 (and DETA-NO) (Fig. 6; n = 8; p < 0.05). Consistent with these changes, exposure of lymphocytes to NCX-4016 and DETA-NO decreased the activity of succynate dehydrogenase and aconitase, two of the enzymes involved in the citric acid cycle (n = 8; p < 0.01).

Scavenging NO with Hb, 10 µM, fully restored the ability of lymphocytes to respond to costimulatory mAbs by increasing the rate of O2 consumption and ATP formation as well as IL-2 secretion (Fig. 7; n = 8; p < 0.05 vs DETA-NO and NCX-4016). Furthermore, despite the fact that an increased energy demand was placed, coincubation with Hb reduced the rate of glucose uptake (Fig. 1b; n = 8; p < 0.05 vs NCX-4016 and DETA-NO) and lactate formation (data not shown).



View larger version (17K):
[in this window]
[in a new window]
  		FIGURE 7. a–d, NO scavenging with Hb reverts the effects of DETA-NO and NCX-4016 on O2 (a), glucose uptake (b), ATP levels (c), and IL-2 secretion (d). Data are mean ± SE of eight independent measures. *, p < 0.01 vs medium; **, p < 0.01 vs anti-CD3/anti-CD28; {psi}, p < 0.05 vs DETA-NO and NCX-4016 alone.

 
Effect of DETA-NO and NCX-4016 on mitochondrial respiration

The mechanism through which NCX-4016 and DETA-NO inhibit O2 was further investigated by analyzing the effect these agents exert on oxidative phosphorylation intermediates. Results shown in Table I demonstrate that exposure to DETA-NO and NCX-4016 inhibits the activity of complexes I, II, III, and IV. This effect was fully reversible by Hb, 10 µM, after 3 h of incubation with NCX-4016 and DETA-NO (n = 8; p < 0.01 vs cells incubated without Hb).


View this table:
[in this window]
[in a new window]
  		Table I. NO scavenging with Hb reverts, inhibition of O2 consumption caused by NCX-4016 and DETA-NO on anti-CD3/anti-CD28-stimulated lymphocytesa

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The central finding of this study is that NCX-4016, a NO-releasing derivative of ASA, reduces ATP formation and O2 consumption in immune cells, resulting in a transitory impairment of the ability of lymphocytes and monocytes to release cytokines and chemokines in response to costimulatory molecules or bacterial endotoxin. Although NCX-4016 has two active moieties and both contribute to its pharmacological activity (22), present results indicate that modulation of mitochondrial functions exerted by NCX-4016 is due to the release of NO. Support to this view comes from the following observations: first, exposure of resting lymphocytes (and monocytes) to NCX-4016 leads to NO formation; second, NCX-4017, a non-NO-releasing analog of NCX-4016, ASA, and selective and nonselective COX-2 inhibitors reduce prostanoid generation, but fail to inhibit cytokine release induced by anti-CD3/anti-CD28 and LPS (27). In contrast, we observed a slight, although significant increase of IL-1{beta} and TNF-{alpha} release from monocytes incubated with ASA, suggesting that endogenous prostanoid contributes to limit cytokine/chemokine release in immune cells (30, 31); third, inhibition of cytokine release and mitochondrial perturbation caused by NCX-4016 was, at least partially, reproduced by incubating lymphocytes and monocytes with the NO donor DETA-NO; and, finally, scavenging NO with Hb greatly attenuated inhibition of cytokine secretion and mitochondrial effects of NCX-4016 and DETA-NO.

Despite the fact that, similarly to NCX-4016, DETA-NO greatly impairs ATP formation and O2 consumption in resting and CD3/CD28-costimulated lymphocytes, it failed to fully reproduce the inhibitory effect NCX-4016 exerts on cytokine secretion. Several of our results might contribute to explain these discrepancies: first, at the concentration used in this study, i.e., 100 µM, the amount of NO released by DETA-NO approaches that of inducible NOS (i.e., {approx}1 µM), being significantly higher than that released by the equimolar concentration of NCX-4016 (32). Second, most likely due to the large amount of NO released, and in contrast to NCX-4016, exposure to DETA-NO causes peroxynitrite formation. Because peroxynitrites activate NF-{kappa}B (33, 34), and directly stimulate cytokine secretion (33, 34, 35), it is likely that failure of DETA-NO to attenuate cytokine/chemokine secretion in monocytes is due to formation of these radical species. Third, as a consequence of peroxynitrite formation and high NO release, DETA-NO exerts biphasic effect on {Delta}{psi}m, i.e., an early hyperpolarization, followed by a late depolarization (16, 17, 18). Fourth, we have previously shown that, in contrast to DETA-NO, NCX-4016 at the concentration of 100 µM inhibits nuclear translocation of NF-{kappa}B (36). Finally, NCX-4016 and DETA-NO seem to release NO with a different mechanism. Indeed, while DETA-NO releases NO spontaneously, NCX-4016 requires the intervention of cellular esterases. By confocal microscopy analysis, we have previously shown that NO formation in cells exposed to DETA-NO associates with the appearance of diffuse cytosolic fluorescence, while NCX-4016 induces a characteristic pattern of hot spots of activity localized at specific subcellular compartments near to the plasma membrane (26). Although the pharmacological relevance of this observation remains unclear, it suggests that NCX-4016 releases low amount of NO with a different kinetic of DETA-NO.

NO is increasingly recognized as a physiological regulator of O2 use (13, 14, 37). At least two components of the mitochondrial respiratory chain have been shown to interact with NO, resulting in a profound inhibition of O2 consumption (15, 37). Clementi et al. (16) have shown that at low cellular concentrations, 1–10 µM, NO donors interact in a reversible manner with cytochrome c oxidase (complex IV), causing a transitory inhibition of cell respiration and oxidative phosphorylation. In cells exposed to higher concentrations of a NO donor (50–100 µM), inhibition of cell respiration becomes irreversible and appears largely dependent on the S-nitrosylation/inhibition of complex I (16, 37). Although O2 consumption by mitochondria is mainly regulated by cellular ATP levels, interaction of O2 with NO might lead to a situation in which, even in the presence of an adequate supply of O2, cytochrome c oxidase exerts a considerable control over the rate of respiration through changes in its affinity for O2 (15, 37). In this situation, NO might generate a situation of metabolic hypoxia in which the available O2 cannot be adequately used by cells (14). Because O2 consumption is essential for oxidative phosphorylation, the major metabolic consequence of these interactions will be a reduction of oxidative breakdown of glucose, leading to further impairment of cells to generate ATP when an increased expenditure of energy occurs (14, 15, 16, 17, 18, 26, 37). We have now provided evidence that increasing intracellular concentrations of NO with NCX-4016 (and DETA-NO) results in a time-reversible inhibition of cell respiration and inability of immune cells to generate ATP in response to stimulation. Furthermore, the experiment shown in Table I demonstrates that impairment of O2 use caused by NCX-4016 was mainly due to inhibition of complex IV activity. Indeed, addition of rotenone and succinate or ascorbate in the presence of N,N,N',N'-tetramethyl-p-phenylenediamine resulted in full recovery of cell respiration despite the constant clamp of NO concentrations generated by NCX-4016 (37).

In addition to inhibition of cell respiration, we also demonstrated that NCX-4016 modulates glucose use (38). Indeed, in lymphocytes exposed to anti-CD3/anti-CD28, NCX-4016 caused a {approx}4-fold increase of glucose uptake and glycolytic rate, as assessed by measuring 6-phosphofructukinase activity. However, increased glucose uptake associates with 4-fold increase in lactate secretion, indicating that {approx}70% of glucose taken up by lymphocytes was secreted as lactate (10). Consistent with this view, exposure to NCX-4016 decreased the activity of succynate dehydrogenase and aconitase, two of the intermediate enzymes of the citric acid cycle (10, 11, 12).

We have previously demonstrated that NCX-4016 down-regulates IL-1{beta}, IL-18, and IFN-{gamma} secretion in PMBC-derived monocytes (27), and linked this effect to IL-1 converting enzyme/caspase-1 S-nitrosylation/inhibition (22). However, while S-nitrosylation of cysteine proteases transduces many non-cGMP-dependent effects of NO (39, 40, 41), S-nitrosylation of caspase-1 subunits occurs at concentration of 10–100 µM NO (reviewed in Ref. 15), i.e., significantly higher than those required for inhibition of cytochrome c oxidase ({approx}60 nM) (14, 18, 42).

Arachidonic acid and its metabolites are considered to be important regulators of facilitated glucose transport in insulin-sensitive cells such as adipocytes (43). In these cells, arachidonic acid stimulates glucose uptake and GLUT-1 membrane incorporation (43, 44). However, the finding that ASA and NCX-4017 do not modulate GLUT-1 expression in anti-CD3/anti-CD28-costimulated lymphocytes suggests that COX inhibition is not involved in the effect exerted by NCX-4016. Supporting this view, it has previously been demonstrated that facilitation of glucose transport induced by arachidonic acid is COX independent, while it involves lipoxygenase and peroxisome proliferator-activated receptor-{gamma} pathways (44).

The results of present study might have clinical relevance. Indeed, an increased rate of O2 consumption has been described in PMBC of patients with systemic lupus erythematosus (45) and active rheumatic diseases (46). Because high levels of ATP are required to sustain energy consuming by immune processes, it seems likely that interfering with lymphocyte’s bioenergetic might help to reduce inflammatory reaction. Consistent with this view, it has been shown that antirheumatic/immunosuppressive drugs such as cloroquine (47), auronofin (48), glucorticoid (45, 48), and cyclosporine (49) inhibit mitochondrial respiration and/or decrease ATP formation in immune cells (1, 2, 3).

In conclusion, this study suggests that NO might exert a regulatory function on lymphocytes and monocytes, providing a potential counterregulatory signal in communication between the innate and acquired immunity. The demonstration that NCX-4016 inhibits immune cell bioenergetic suggests that NO-releasing NSAIDs have the potential to exert anti-inflammatory effects that extend behind COX inhibition.


   Footnotes
 
1 Address correspondence and reprint requests to Dr. Stefano Fiorucci, Clinica di Gastroenterologia ed Epatologia Policlinico Monteluce Via E. dal Pozzo 06100 Perugia Italy. E-mail address: fiorucci{at}unipg.it Back

2 Abbreviations used in this paper: GLUT, glucose transporter; {Delta}{psi}m, mitochondrial membrane potential; ASA, acetylsalicylic acid; COX, cyclooxygenase; DCFDA, 5-(and-6)-carboxy-2',7'-dichlorofluorescein diacetate; DETA-NO, (z)-1-[2-(2-aminoethyl)-N-(2-ammonioethyl)amino] diazen-1-ium-1,2 diolate; Hb, hemoglobin; JC-1, 5,5',6,6'-tetrachloro-1,1',3,3'-tetraethylbenzimidazolocarbocyanine iodide; NCX-4016, 2-(acetyloxy)benzoic acid 3-(nitrooxymethyl)phenyl ester; NCX-4017, 2-(acetyloxy)benzoic acid 3-(hydroxymethyl)phenyl ester; NOS, NO synthase; NSAID, nonsteroidal anti-inflammatory drug; PI, propidium iodide. Back

Received for publication October 7, 2003. Accepted for publication May 5, 2004.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Plas, D. R., C. B. Thompson. 2002. Cell metabolism in the regulation of programmed cell death. Trends Endocrinol. Metab. 13:75.[Medline]
  2. Krauss, S., M. D. Brand, F. Buttgereit. 2001. Signaling takes a breath: new quantitative perspectives on bioenergetics and signal transduction. Immunity 15:497.[Medline]
  3. Buttgereit, F., G. R. Burmester, M. D. Brand. 2000. Bioenergetics of immune functions: fundamental and therapeutic aspects. Immunol. Today 21:192.[Medline]
  4. Whetton, A. D., G. W. Bazill, T. M. Dexter. 1984. Haemopoietic cell growth factor mediates cell survival via its action on glucose transport. EMBO J. 3:409.[Medline]
  5. Roos, D., J. A. Loos. 1970. Changes in the carbohydrate metabolism of mitogenically stimulated human peripheral lymphocytes. I. Stimulation by phytohaemagglutinin. Biochim. Biophys. Acta 222:565.[Medline]
  6. Sagone, A. L., Jr., A. F. LoBuglio, S. P. Balcerzak. 1974. Alterations in hexose monophosphate shunt during lymphoblastic transformation. Cell. Immunol. 14:443.[Medline]
  7. Levene, P. A., G. M. Meyer. 1912. The action of leukocytes on glucose. J. Biol. Chem. 11:361.[Free Full Text]
  8. Kempner, W.. 1939. The nature of leukemic blood cells as determined by their metabolism. J. Clin. Invest. 18:291.
  9. Rathmell, J. C., M. G. Vander Heiden, M. H. Harris, K. A. Frauwirth, C. B. Thompson. 2000. In the absence of extrinsic signals, nutrient utilization by lymphocytes is insufficient to maintain either cell size or viability. Mol. Cell 6:683.[Medline]
  10. Fauwirth, K. A., J. L. Riley, M. H. Harris, R. V. Parry, J. C. Rathmell, D. R. Plas, R. L. Elstrom, C. H. June, C. B. Thompson. 2002. CD28 signaling pathway regulates glucose metabolism. Immunity 6:769.
  11. DiMauro, S., E. A. Schon. 2003. Ochondrial respiratory-chain diseases. N. Engl. J. Med. 48:2656.
  12. Saadi, S., L. E. Wrenshall, J. L. Platt. 2002. Regional manifestations and control of the immune system. FASEB J. 16:9.
  13. Wingrove, J. A., P. H. O’Farrell. 1999. Nitric oxide contributes to behavioral, cellular, and developmental responses to low oxygen in Drosophila. Cell 98:105.[Medline]
  14. Semenza, G. L.. 1999. Perspectives on oxygen sensing. Cell 98:281.[Medline]
  15. Moncada, S., J. D. Erusalimsky. 2003. Nitric oxide modulate mitochondrial energy generation and apoptosis?. Nat. Rev. Mol. Cell Biol. 3:214.
  16. Clementi, E., G. C. Brown, M. Feelisch, S. Moncada. 1998. Persistent inhibition of cell respiration by nitric oxide: crucial role of S-nitrosylation of mitochondrial complex I and protective action of glutathione. Proc. Natl. Acad. Sci. USA 95:7631.[Abstract/Free Full Text]
  17. Borutaite, V., A. Matthias, H. Harris, S. Moncada, G. C. Brown. 2001. Reversible inhibition of cellular respiration by nitric oxide in vascular inflammation. Am. J. Physiol. Heart Circ. Physiol. 281:H2256.[Abstract/Free Full Text]
  18. Beltran, B., A. Mathur, M. R. Duchen, J. D. Erusalimsky, S. Moncada. 2000. The effect of nitric oxide on cell respiration: a key to understanding its role in cell survival or death. Proc. Natl. Acad. Sci. USA 97:14602.[Abstract/Free Full Text]
  19. Drapier, J. C., J. B. Hibbs, Jr. 1998. Differentiation of murine macrophages to express nonspecific cytotoxicity for tumor cells results in L-arginine-dependent inhibition of mitochondrial iron-sulfur enzymes in the macrophage effector cells. J. Immunol. 15:140:2829.
  20. Stuehr, D. J., C. F. Nathan. 1989. Nitric oxide: a macrophage product responsible for cytostasis and respiratory inhibition in tumor target cells. J. Exp. Med. 169:1543.[Abstract/Free Full Text]
  21. Coleman, J. W.. 2001. Nitric oxide in immunity and inflammation. Int. Immunopharmacol. 1:1397.[Medline]
  22. Wallace, J. L., L. J. Ignarro, S. Fiorucci. 2002. Potential cardioprotective actions of NO-releasing aspirin. Nat. Rev. Drug Discov. 1:375.[Medline]
  23. Fiorucci, S.. 2001. NO-releasing NSAIDs are caspase inhibitors. Trends Immunol. 22:232.[Medline]
  24. Fiorucci, S., L. Santucci, P. Gresele, R. M. Faccino, P. Del Soldato, A. Morelli. 2003. Gastrointestinal safety of NO-aspirin (NCX-4016) in healthy human volunteers: a proof of concept endoscopic study. Gastroenterology 124:600.[Medline]
  25. Fiorucci, S., A. Mencarelli, A. Meneguzzi, A. Lechi, A. Morelli, P. del Soldato, P. Minuz. 2002. NCX-4016 (NO-aspirin) inhibits lipopolysaccharide-induced tissue factor expression in vivo: role of nitric oxide. Circulation 106:3120.[Abstract/Free Full Text]
  26. Fiorucci, S., A. Mencarelli, R. Mannucci, E. Distrutti, A. Morelli, P. del Soldato, S. Moncada. 2002. NCX-4016, a nitric oxide-releasing aspirin, protects endothelial cells against apoptosis by modulating mitochondrial function. FASEB J. 16:1645.[Abstract/Free Full Text]
  27. Fiorucci, S., L. Santucci, G. Cirino, A. Mencarelli, L. Familiari, P. D. Soldato, A. Morelli. 2000. IL-1{beta} converting enzyme is a target for nitric oxide-releasing aspirin: new insights in the antiinflammatory mechanism of nitric oxide-releasing nonsteroidal antiinflammatory drugs. J. Immunol. 165:5245.[Abstract/Free Full Text]
  28. Fiorucci, S., L. Santucci, E. Antonelli, E. Distrutti, G. Del Sero, O. Morelli, L. Romani, B. Federici, P. Del Soldato, A. Morelli. 2000. NO-aspirin protects from T cell-mediated liver injury by inhibiting caspase-dependent processing of Th1-like cytokines. Gastroenterology 118:404.[Medline]
  29. Mueckler, M., R. C. Hresko, M. Sato. 1997. Structure, function and biosynthesis of GLUT1. Biochem. Soc. Trans. 25:951.[Medline]
  30. Flescher, E., D. Fossum, P. J. Gray, G. Fernandes, M. J. Harper, N. Talal. 1991. Aspirin-like drugs prime human T cells: modulation of intracellular calcium concentrations. J. Immunol. 146:2553.[Abstract]
  31. Hsia, J., N. Sarin, J. H. Oliver, A. L. Goldstein. 1989. Aspirin and thymosin increase interleukin-2 and interferon-{gamma} production by human peripheral blood lymphocytes. Immunopharmacology 17:167.[Medline]
  32. Mateo, J., M. Garcia-Lecea, S. Cadenas, C. Hernandez, S. Moncada. 2003. Regulation of hypoxia-inducible factor-1{alpha} by nitric oxide through mitochondria-dependent and -independent pathways. Biochem. J. 376:537.[Medline]
  33. Matata, B. M., M. Galinanes. 2002. Peroxynitrite is an essential component of cytokines production mechanism in human monocytes through modulation of nuclear factor-{kappa}B DNA binding activity. J. Biol. Chem. 277:2330.[Abstract/Free Full Text]
  34. Radi, R., A. Cassina, R. Hodara, C. Quijano, L. Castro. 2002. Peroxynitrite reactions and formation in mitochondria. Free Radical Biol. Med. 33:1451.[Medline]
  35. Jozsef, L., C. Zouki, N. A. Petasis, C. N. Serhan, J. G. Filep. 2002. Lipoxin A4 and aspirin-triggered 15-epi-lipoxin A4 inhibit peroxynitrite formation: NF-{kappa}B and AP-1 activation, and IL-8 gene expression in human leukocytes. Proc. Natl. Acad. Sci. USA 99:13266.[Abstract/Free Full Text]
  36. Fiorucci, S., E. Distrutti, A. Mencarelli, G. Rizzo, A. R. Di Lorenzo, M. Baldoni, P. Del Soldato, A. Morelli, J. Wallace. 2004. Cooperation between aspirin-triggered lipoxin and nitric oxide (NO) mediates anti-adhesive properties of NCX-4016 (NO-aspirin) on neutrophil-endothelial cell adherence. J. Pharmacol. Exp. Ther. 309:1174.[Abstract/Free Full Text]
  37. Paxinou, E., M. Weisse, Q. Chen, J. M. Souza, C. Hertkorn, M. Selak, E. Daikhin, M. Yudkoff, G. Sowa, W. C. Sessa, H. Ischiropoulos. 2001. Dynamic regulation of metabolism and respiration by endogenously produced nitric oxide protects against oxidative stress. Proc. Natl. Acad. Sci. USA 98:11575.[Abstract/Free Full Text]
  38. Shikhman, A. R., D. C. Brinson, J. Valbracht, M. K. Lotz. 2001. Cytokine regulation of facilitated glucose transport in human articular chondrocytes. J. Immunol. 167:7001.[Abstract/Free Full Text]
  39. Foster, M. W., T. J. McMahon, J. S. Stamler. 2003. S-nitrosylation in health and disease. Trends Mol. Med. 9:160.[Medline]
  40. Stamler, J. S., S. Lamas, F. C. Fang. 2001. Nitrosylation: the prototypic redox-based signaling mechanism. Cell 106:675.[Medline]
  41. Brown, G. C., C. E. Cooper. 1994. Nanomolar concentrations of nitric oxide reversibly inhibit synaptosomal respiration by competing with oxygen at cytochrome oxidase. FEBS Lett. 356:295.[Medline]
  42. Nugent, C., J. B. Prins, J. P. Whitehead, J. M. Wenworth, V. K. K. Chatterjee, S. O’Rahilly. 2001. Arachidonic acid stimulates glucose uptake in 3T3–L1 adipocytes by increasing GLUT1 and GLUT4 levels at the plasma membrane: evidence for involvement of lipooxygenase metabolites and peroxisome proliferator-activator receptor {gamma}. J. Biol. Chem. 276:9149.[Abstract/Free Full Text]
  43. Karlsson, H., J. W. DePierre, L. Nassberger. 1997. Energy levels in resting and mitogen-stimulated human lymphocytes during treatment with FK506 or cyclosporin A in vitro. Biochim. Biophys. Acta 1319:301.[Medline]
  44. Avruch, J.. 1998. Insulin signal transduction through protein kinase cascades. Mol. Cell. Biochem. 182:31.[Medline]
  45. Gergely, P., Jr., B. Niland, N. Gonchoroff, R. Pullmann, Jr., P. E. Phillips, A. Perl. 2002. Persistent mitochondrial hyperpolarization, increased reactive oxyygen intermediate production, and cytoplasmic alkalinization characterize altered IL-10 signaling in patients with systemic lupus erythematosus. J. Immunol. 169:1092.[Abstract/Free Full Text]
  46. Kuhnke, A., G. R. Burmester, S. Krauss, F. Buttgereit. 2003. Bioenergetics of immune cells to assess rheumatic disease activity and efficacy of glucocorticoid treatment. Ann. Rheum. Dis. 62:133.[Abstract/Free Full Text]
  47. Deepalakshmi, P. D., K. Parasakthy, S. Shanthi, N. S. Devaraj. 1994. Effect of chloroquine on rat liver mitochondria. Indian J. Exp. Biol. 32:797.[Medline]
  48. Anderson, R., C. E. Van Rensburg, G. K. Joone, A. Lessing. 1991. Auranofin inactivates hosphofructokinase in human neutrophils, leading to depletion of intracellular ATP and inhibition of superoxide generation and locomotion. Mol. Pharmacol. 40:427.[Abstract]
  49. Buttgereit, F., A. Grant, M. Muller, M. D. Brand. 1994. The effects of methylprednisolone on oxidative phosphorylation in concanavalin-A-stimulated thymocytes: top-down elasticity analysis and control analysis. Eur. J. Biochem. 223:513.[Medline]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
V. Kaddai, T. Gonzalez, M. Bolla, Y. Le Marchand-Brustel, and M. Cormont
The nitric oxide-donating derivative of acetylsalicylic acid, NCX 4016, stimulates glucose transport and glucose transporters translocation in 3T3-L1 adipocytes
Am J Physiol Endocrinol Metab, July 1, 2008; 295(1): E162 - E169.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
K.-S. Choi, E.-K. Song, and C.-Y. Yim
Cytokines secreted by IL-2-activated lymphocytes induce endogenous nitric oxide synthesis and apoptosis in macrophages
J. Leukoc. Biol., June 1, 2008; 83(6): 1440 - 1450.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
K. R. Atkuri, L. A. Herzenberg, A.-K. Niemi, T. Cowan, and L. A. Herzenberg
Importance of culturing primary lymphocytes at physiological oxygen levels
PNAS, March 13, 2007; 104(11): 4547 - 4552.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
G. Rizzo, M. Disante, A. Mencarelli, B. Renga, A. Gioiello, R. Pellicciari, and S. Fiorucci
The Farnesoid X Receptor Promotes Adipocyte Differentiation and Regulates Adipose Cell Function in Vivo
Mol. Pharmacol., October 1, 2006; 70(4): 1164 - 1173.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
B. T. Ameredes, R. Zamora, J. M. Sethi, H.-L. Liu, L. K. Kohut, A. L. Gligonic, A. M. K. Choi, and W. J. Calhoun
Alterations in Nitric Oxide and Cytokine Production with Airway Inflammation in the Absence of IL-10
J. Immunol., July 15, 2005; 175(2): 1206 - 1213.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fiorucci, S.
Right arrow Articles by Morelli, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fiorucci, S.
Right arrow Articles by Morelli, A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ACETYLSALICYLIC ACID
*NITRIC OXIDE

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS