|
|
||||||||



* Departments of Medicine, Microbiology, and Immunology and Lineberger Comprehensive Cancer Center, University of North Carolina, Chapel Hill, NC 27599;
Department of Pediatrics, Division of Pediatric Bone Marrow Transplantation and University of Minnesota Cancer Center Minneapolis, MN 55455; and
Center for Immunology and Inflammatory Diseases and Division of Rheumatology, Allergy, and Immunology, Massachusetts General Hospital and Harvard Medical School, Boston, MA 02129
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Chemokines are small chemotactic cytokines that mediate their activity by binding to G protein-coupled receptors (GPCRs) (27) and fall into four families, C, CC, CXC, and CX3C, based on the number and position of N-terminal cysteine residues (28). Receptors for these molecules are named accordingly, with CC chemokines binding CC receptors (CCR) and CXC chemokines binding CXCR (28). The system is complex, with multiple chemokine ligands binding any one receptor, and in most cases, multiple receptors binding the same chemokine. Specificity is imparted upon the system through differential expression of chemokine ligands and receptors by particular cell types and/or in response to specific stimuli. For example, naive T cells express CCR7, a receptor for the chemokines CCL19 and -21, which are expressed in secondary lymphoid tissues (29, 30, 31). Activation and differentiation to Th1/T cytotoxic type I (Tc1) cells induces down-regulation of CCR7, and up-regulation of CXCR3 and CCR5, receptors for chemokines CXCL9, CXCL10, and CXCL11 and CCL3, CCL4, and CCL5, respectively (28, 32, 33). Interaction of chemokines with receptors results in a series of intracellular events leading to the activation of integrins, firm arrest of rolling leukocytes, and actin polymerization (27). Additionally, signaling events involving receptor phosphorylation lead to desensitization of receptors by uncoupling from G proteins and can lead to internalization of receptors through a
-arrestin-dependent process (34). Cross-talk between chemokine receptors can occur through heterologous desensitization, a process through which activation of one receptor leads to the ligand-independent phosphorylation and decoupling of other GPCRs (34, 35, 36, 37, 38).
The involvement of chemokines in the recruitment of effector T cells to target organs during GVHD is a relatively new finding with potential therapeutic importance. Expression of proinflammatory chemokines, such as CCL2, CCL3, CCL4, CCL5, CXCL9, and CXCL10, in target organs during GVHD has been demonstrated in a number of experimental models (21, 39, 40, 41), although specific roles for most of these ligands during GVHD have not been determined. Our group demonstrated that the production of CCL3 by donor T cells was critical in the recruitment of alloreactive CD8+ T cells into the lung and liver in a class I MHC-disparate transplant (21). Interestingly, the recruitment of CD4+ T cells was increased at these sites in the absence of CCL3 production by donor T cells and correlated with earlier mortality in MHC class II-disparate recipients. Furthermore, in a completely MHC-mismatched model of idiopathic pneumonia syndrome, the absence of CCL3 production by donor T cells led to increased T cell accumulation in both spleen and lung (24), suggesting that other proinflammatory chemokines may overcompensate for the absence of CCL3 in certain target organs.
A critical role for the chemokine receptor, CCR5, in the migration of alloreactive T cells in nonirradiated haploidentical recipients was recently shown (25, 26). However, a specific role for CCR5 in transplants using conditioning therapy, commonly used for human allogeneic bone marrow transplant recipients, was not demonstrated. Thus, we were interested in determining the function of CCR5 on donor T cells in the setting of intensive conditioning therapy. Unexpectedly, we found that the administration of CCR5/ donor T cells led to enhanced GVHD and earlier lethality in three different conditioned model systems. In this study we show that the activity of CCR5 during GVHD is dependent on the inflammatory milieu and provide a potential mechanism for the enhanced GVHD found using CCR5/ T cells that involves enhanced migration of these cells to CXCL10.
| Materials and Methods |
|---|
|
|
|---|
Donor mice consisted of male C57BL/6J mice (H2b; termed B6; The Jackson Laboratory, Bar Harbor, ME) and CCR5/ mice, which have been described previously (42). We performed backcrosses of CCR5/ mice for 10 generations on the B6 genetic background to generate donor mice. In some experiments donors were CCR5/ or B6 mice expressing the enhanced GFP (eGFP) protein. Generation of eGFP-expressing B6 was previously described (21), and these were crossed with our CCR5/ strain to generate eGFP-expressing CCR5/ mice. Recipient mice were male (B6xDBA/2) F1 mice, referred to as B6D2 (H2bxd; The Jackson Laboratory), BALB/c (H2d), and B10.BR (H2k). Within each experiment, all recipient mice were the same age, which ranged from 612 wk. Donor mice also ranged from 612 wk of age. In some in vitro assays of T cell function, donors were female B6 and CCR5/ mice. Donors were age- and gender-matched in each experiment.
Preparation of cells for transplant
On the day of transplantation, bone marrow was collected from both B6 donors and syngeneic controls by euthanizing animals with CO2 and collecting femurs and tibiae. These bones were flushed with 12 ml/bone RPMI 1640 medium (Life Technologies, Grand Island, NY) containing 10% FBS (Life Technologies). Cells were collected, and erythrocytes were removed using ammonium chloride, potassium carbonate (ACK) lysis buffer. Cells were washed in PBS/0.5% FBS and incubated with anti-CD90 mAb-coated microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany), and T cells were depleted by separation on a magnetic column with collection of the column flow-through. These cells were washed and suspended at 3 x 107/ml in injectable, nonbacteriostatic 0.9% NaCl solution. The efficiency of T cell depletion was >95%, as measured using flow cytometry. Donor T cells were isolated on the day of transplantation by collecting the spleens from B6, CCR5/, or syngeneic control mice, treating cell suspensions with ACK lysis buffer to remove erythrocytes, and incubating with anti-CD90 mAb-coated microbeads as described above. T cells were isolated via magnetic column selection using the manufacturers instructions. These cells were suspended in injectable 0.9% NaCl at 5 x 107/ml. The purity of selected T cells was
90%. Alternatively, in several experiments unselected splenocytes were used. These were prepared as described above, except that after the ACK lysis step, cells were washed, counted, and resuspended at 5 x 108/ml in 0.9% injectable saline.
Bone marrow transplantation
B6D2 and B10.BR recipients were lethally irradiated with 850950 cGy from a 137Cs source (86.3 cGy/min.). BALB/c recipients were lethally irradiated with 950 cGy of irradiation. After irradiation, mice were kept in autoclaved cages, fed gamma-irradiated food, and received water (pH 2) treated with 2 g/l neomycin sulfate. The following day, mice received 3 x 106 T cell-depleted bone marrow cells (either B6 or syngeneic cells) and 15 x 106 magnetically selected CD90+ splenic T cells (B6, CCR5/, or syngeneic T cells) or 5 x 107 unselected splenocytes, in a total volume of 0.2 ml, by tail vein injection. In one set of experiments, groups of transplant recipients received i.p. injections of either hamster anti-mouse CXCL10 mAb (43) or hamster IgG control Ab (The Jackson Laboratory). These mice received 100 µg of Ab in 200 µl of PBS i.p. on days 1, 1, 3, and 5. In another set of experiments, nonirradiated B6D2 recipients received 5 x 107 unselected splenocytes alone in a volume of 0.2 ml by tail vein injection.
GVHD grading
Mice were observed twice weekly for signs of GVHD, and a previously described clinical scoring system was used to assess disease severity (44).
Histopathology
Samples of each organ were removed at the time of death (days 3, 7, and 18), placed into Omnifix (F. R. Chemical, Mount Vernon, NY), and paraffin-embedded. These were sectioned with a microtome. The sections were stained with H&E, and individual sections were evaluated for evidence of GVHD using a quantitative assessment, as described previously (45). The sections were evaluated by one of us (A.P.-M.), who was blinded to the treatment given.
Analysis of cytokines in tissue homogenates
Transplanted mice were killed on day 7. Whole liver, lung, and colon were collected into 1 ml of PBS/2.5 µg/ml aprotinin, 2.5 µg/ml leupeptin, and 4 mM Pefabloc SC (Roche, Indianapolis, IN) and homogenized using a Polytron homogenizer (Kinematica, Littau-Lucerne, Switzerland). Homogenates were incubated on ice for 30 min, cleared by centrifugation, and immediately analyzed for IL-2, IL-4, IL-5, IFN-
, and TNF-
using the mouse Th1/Th2 cytokine bead array (BD Pharmingen, San Diego, CA). Homogenates were analyzed undiluted, and diluted 1/5 in assay dilution buffer (BD Pharmingen). The cytokine bead array assay was performed and analyzed according to the manufacturers protocol.
Isolation of leukocytes from tissues
Mice were killed on days 3, 7, and 18 and perfused through the heart with 10 ml of PBS. Spleen, liver, lung, colon, and kidney were excised and weighed. Livers, lungs, colons, and kidneys were digested in a solution of 1 mg/ml collagenase A (Roche) and 75 U of DNase I (Sigma-Aldrich, St. Louis, MO) in RPMI 1640/5% newborn calf serum. Digested tissues were treated with ACK lysis buffer to remove RBCs and were passed through 100-µm pore size cell strainers. Leukocytes were isolated by centrifugation in a solution of 40% Percoll (Sigma-Aldrich) in RPMI 1640/5% newborn calf serum. The pelleted cells were washed in PBS/2% FBS and stored overnight at 4°C before Ab staining for flow cytometric analysis. Spleens were teased apart, treated with ACK lysis buffer, and washed in PBS/2% FBS, and the cells were stored at 4°C until staining.
Abs and flow cytometry
Cells isolated as described above were blocked for 15 min at 4°C in mouse whole IgG (Sigma-Aldrich), followed by Ab staining for 15 min at 4°C. Stained cells were washed once with PBS/2% FBS before fixing in 1.0% formaldehyde. Abs used for FACS were obtained from BD Pharmingen and included anti-H2Kb-FITC (clone AF6-88.5, mouse IgG2a
), anti-H2Kd-PE (SF1-1.1, mouse IgG2a
), anti-mCD3
-PerCP (145-2C11, hamster IgG group 1
), anti-mCD4-PerCP (RM4-5, rat IgG2a
), and anti-mCD8
-PerCP (53-6.7, rat IgG2a
). Isotype controls were obtained from BD/Pharmingen. FACS analysis was performed using a FACScan flow cytometer (BD Biosciences, Mountain View, CA). Three-color analysis was performed using FlowJo analysis software (Tree Star, Ashland, OR), in which cells staining with the PerCP-labeled CD marker mAb were gated, the expression of H2Kb and H2Kd was determined on the gated cells, and the number of PerCP-positive H2Kb-positive H2Kd-negative cells (donor T cells) in the sample was quantified. In some experiments, when eGFP-expressing donor cells were used, no anti-H2 Abs were used to distinguish donor cells. The eGFP+ cells staining positively for CD markers were quantified.
In vitro activated T cells were stained for CXCR3 expression using a purified rat anti-mouse CXCR3 mAb (clone 220803; R&D Systems, Minneapolis, MN) or rat anti-mouse IgG2a isotype control (R&D Systems), followed by secondary staining with PE-conjugated goat anti-rat Ig (BD Pharmingen).
Real-time RT-PCR analysis of chemokine ligand and receptor expression
Total RNA was prepared from freshly harvested tissues and fresh or cultured T cells using TRIzol (Invitrogen, San Diego, CA) according to the manufacturers protocol. Synthesis of cDNA from total RNA was performed using random hexamers, Moloney murine leukemia virus reverse transcriptase, and RNasin (Promega, Madison, WI). Real-time RT-PCR was performed using the ABI PRISM 7900 sequence detection system (PerkinElmer, Foster City, CA). Primers and/or probes were designed to span exon/exon junctions. CCL3, CCL4, CXCL10, CXCL11, and CXCR3 probes were labeled at the 5' end with the reporter dye FAM and at the 3' end with the quencher dye TAMRA. The 18S rRNA probe was labeled at the 5' end with the reporter dye TET and at the 3' end with TAMRA. Probes were synthesized by Integrated DNA Technologies (Coralville, IA), and primers were synthesized by the University of North Carolina oligonucleotide synthesis facility. The primer and probe sequences were as follows (in the 5' to 3' orientation): CCL3 forward, CGCCAATTCATCGTTGACTA; CCL3 reverse, AGATCTGCCGGTTTCTCTTA; CCL3 probe, CTTTGCTCCCAGCCAGGTGTCATTT; CCL4 forward, CTGTGCTCCAGGGTTCTC; CCL4 reverse, AGACTGCTGGTCTCATAGTA; CCL4 probe, CCAATGGGCTCTGACCCTCCCAC; CXCL10 forward, GAGATCATTGCCACGATGAA; CXCL10 reverse, CTCCAGTTAAGGAGCCCTTT; CXCL10 probe, TGAATCCGGAATCTAAGACCATCAA; CXCL11 forward, CTCAAGGCTTCCTTATGTTCA; CXCL11 reverse, CTTTCTCGATCTCTGCCATTT; CXCL11 probe, CGCTGTCTTTGCATCGGCCC; CXCR3 forward, AGCCATGTACCTTGAGGTTA; CXCR3 reverse, CAGAGAAGTCGCTCTCGTTT; CXCR3 probe, AGATGCCTCGGACTTTGCCTTTCTT; 18S rRNA forward, GCTGCTGGCACCAGACTT; 18S rRNA reverse, CGGCTACCACATCCAAGG; and 18S rRNA probe, CAAAATTACCCACTCCCGACCCG. Standard curves were generated for each primer and probe set, using dilutions of separate plasmids containing a cloned copy of each amplicon. PCR was conducted in a total volume of 15 µl with 2x Platinum Quantitative Supermix-UDG (Invitrogen). Thermocycler parameters included 2 min at 50°C, 2 min at 95°C, and 40 cycles involving denaturation at 95°C for 15 s and annealing/extension at 56°C for 1 min and 30 s. Values for chemokine and CXCR3 expression in each sample were calculated based on standard curves, and these were normalized by dividing the copies of chemokine message by the copies of 18S rRNA. To assess differences between time points, relative chemokine expression was calculated by dividing the normalized values for each experimental sample at each time point by the mean normalized value for irradiated allogeneic recipients on day 3. Relative CXCR3 expression was assessed by dividing normalized values for each sample by the mean normalized value for freshly isolated B6 T cells.
Chemotaxis assays
Splenic CD90+ T cells were isolated from B6 and CCR5/ donors, and these cells were stimulated to induce the expression of both CCR5 and CXCR3, as previously described (46). Briefly, cells were cultured at 1.5 x 106/well for 48 h in 24-well plates (Costar, Acton, MA) in the presence of immobilized anti-CD3
and anti-CD28 Abs (5 and 2 µg/ml, respectively; BD Pharmingen), followed by removal from immobilized Abs, and an additional 48 h in culture in the presence of 1 ng/ml recombinant murine IL-12 (PeproTech, Rocky Hill, NJ). Culture medium consisted of RPMI 1640 supplemented with 10% FBS, 1 mM sodium pyruvate (Life Technologies), 1x nonessential amino acids (Life Technologies), 100 U/ml penicillin and 100 µg/ml streptomycin (Life Technologies), and 50 µM 2-ME (Sigma-Aldrich). After this culture period, 2 x 105 T cells were placed on top of the membrane of a Chemotx plate (NeuroProbe, Cabin John, MD), and 100 ng/ml recombinant murine CXCL10 or CCL4 (PeproTech) was aliquoted into the lower wells. Chemotaxis was allowed to occur at 37°C in 5% CO2 for 30 min. Each sample was assayed in duplicate. The membrane was then removed, and the cells in the lower well were quantified via MTT (Sigma-Aldrich).
MLRs
Responder cells (B6 and CCR5/ T cells or B6/eGFP and CCR5//eGFP T cells) were prepared as described above, using magnetic beads to select for CD90+ splenocytes. Responders (5 x 105) were mixed with irradiated (21 Gy) B6D2 splenic stimulators at four different stimulator:responder ratios (0.5, 1, 2, and 4) and plated in 96-well, round-bottom plates (Costar, Cambridge, MA). These reactions were performed in triplicate and incubated 45 days at 37°C in 5% CO2. Culture medium consisted of Iscoves medium (Life Technologies), supplemented as described above. During the last 1620 h of incubation, 1 µCi of [3H]thymidine (Amersham Pharmacia Biotech, Piscataway, NJ) was added. Cells were harvested onto filters using a FilterMate harvester (PerkinElmer, Boston, MA), and [3H]thymidine incorporation was measured by scintillation counting via a TopCount counter (PerkinElmer, Boston, MA).
T cell apoptosis assays
Mixed lymphocyte cultures were prepared as described above, using irradiated B6D2 stimulator cells and B6/eGFP and CCR5//eGFP responders at a 1:1 ratio. These were incubated for 36 days, and at these time points, cells were collected and stained with PE-conjugated annexin V and the vital dye 7-aminoactinomycin D. The proportions of GFP+ cells staining positively for annexin V-PE and negatively for 7-AAD were determined by flow cytometry.
CTL assays
Effector cells (splenic CD90+ T cells) were prepared as described from B6 and CCR5/ mice. These were mixed in a 1:1 ratio with irradiated B6D2 splenocytes and were cultured for 5 days in the MLR culture medium described above at a concentration of 1 x 106 cells/ml. Target cells were P815 (H2d), EL-4 (H2b), and YAC-1 cells labeled with 100 µCi of 51Cr (Amersham Pharmacia Biotech) at 37°C for 90 min and washed extensively. Effector cells and targets were mixed at E:T cell ratios of 50, 25, 12.5, and 6.25:1 and cultured for 6 h at 37°C. Chromium released into the medium in these cultures was compared with spontaneous release by target cells alone and with maximum release by targets treated with 10% Triton X-100 (Sigma-Aldrich). Chromium release was quantified by scintillation counting using the TopCount counter (PerkinElmer): % specific lysis = [(experimental release spontaneous release)/(maximum release spontaneous release)] x 100.
Statistical analyses
Estimates of the probability of survival for all groups were determined using the method described by Kaplan and Meier (47). Groups were compared for differences in histopathology scores using the rank-sum test and for differences in cytokine production, cell infiltration, relative chemokine expression, and chemotaxis using the Students t test. For all tests, p
0.05 was considered significant.
| Results |
|---|
|
|
|---|
To examine the importance of CCR5 expression on donor T cells in GVHD, haploidentical parent-to-F1 transplants were performed in which heavily irradiated B6D2 mice were given 3 x 106 T cell-depleted bone marrow cells from B6 donors supplemented with 2.5 x 106 splenic T cells from either CCR5/ (B6 background) or B6 mice. Interestingly, although at this T cell dose all the mice receiving B6 T cells survived (Fig. 1A), mortality was 50% for mice receiving 2.5 x 106 CCR5/ T cells (p = 0.05). Mortality was also increased in hamster IgG-treated B6D2 recipients of 1 x 106 CCR5/ vs B6 donor T cells (Fig. 6). These data correlated with statistically greater clinical GVHD scores in B6D2 recipients receiving 2.5 x 106 T cells from CCR5/ compared with B6 donors beginning on day 17 (Fig. 1B). When evaluated in B6D2 mice receiving a dose of T cells that induced GVHD in all animals (5 x 106), recipients of CCR5/ T cells again suffered significantly earlier mortality compared with recipients of B6 T cells (p = 0.02; Fig. 1C).
|
|
|
Histopathology in liver, lung, colon, spleen, and kidney sections was studied in B6D2 recipients of CCR5/ or B6 unselected splenocytes and syngeneic controls (Fig. 2). Histopathology on day 3 was unremarkable in all groups, with the exception of findings in the spleen and colon that are typically found after irradiation. On days 7 and 18, there were changes in the liver, lung, colon, and spleen of mice receiving either CCR5/ or B6 splenocytes indicative of acute GVHD. There was a statistically significant difference in the GVHD score in the lungs of mice receiving CCR5/ compared with B6 splenocytes on days 7 (p = 0.03) and 18 (p = 0.007). GVHD scores in the liver assessed on day 18 were modestly, but not significantly, higher in recipients of CCR5/ vs B6 splenocytes. Pathology in the spleens was similar between the two groups. Consistent with studies in other murine GVHD models, scoring of GVHD in the kidney sections from all transplant groups was minimal even at the latest time point (data not shown), when pathology in other tissues was most significant. Thus, the accelerated GVHD severity and mortality in recipients of CCR5/ T cells was found to correlate significantly with more severe histopathologic lesions arising early in the course of disease in the lungs of mice receiving CCR5/ cells as well as a trend toward more severe lesions in the liver later post-transplant.
|
We next evaluated donor T cell infiltrates in GVHD target organs on days 3, 7, and 18 by flow cytometry. Interestingly, as shown in Fig. 3, we found significantly increased donor T cell infiltrates in organs from mice receiving CCR5/ compared with B6 splenocytes. The most significant increases were found in CD8+ T cells in the liver and lung on day 7 and in the liver on day 18. However, significant differences were also found for CD4+ T cells on day 7 in the liver and lung. These data correlated with increased histopathology scores in the lung after receipt of CCR5/ vs B6 T cells. Significant increases in CCR5/ donor T cell infiltrates were also observed in the kidney at early time points (data not shown), although the number of cells present was very modest. Infiltration of CCR5/ donor T cells in the spleen was not significantly increased at any time point compared with that of B6 donor cells, which correlated with the histopathology data. No significant differences in T cell infiltrates in the colon between mice receiving B6 or CCR5/ cells were observable at any time point. As previous studies demonstrated enhanced production of cytokines such as IFN-
, IL-4, and GM-CSF by CCR5/ effector cells (48, 49), we assessed cytokine levels in the above target organs via the cytokine bead array assay. Although significant levels of Th1/Tc1 cytokines (IFN-
and TNF-
), but not Th2/Tc2 cytokines (IL-4), were observed in all target organs, no significant differences existed between recipients of B6 and CCR5/ donor cells (data not shown).
|
Infiltration of GVHD target organs by CCR5/ donor cells is dependent on conditioning of recipient mice
A recent study by Murai et al. (26) using nonirradiated B6D2 recipient mice demonstrated decreased, rather than increased, infiltration of target organs by CCR5/, compared with CCR5+/+ B6 donor splenocytes, on day 14 post-transplant. As this study used a different strain of CCR5/ mice than ours, we sought to determine whether the apparent discrepancy between our data and those of the previous study was due to strain differences or transplant conditioning. We performed transplants in B6D2 recipients using 5 x 107 unselected splenocytes from B6 and CCR5/ donors using the method used by Murai et al. (26), which does not include recipient conditioning, and assessed donor T cell infiltrates at day 14. As shown in Fig. 4A, infiltration of liver, lung, spleen, and Peyers patches by CCR5/ donor cells was moderately decreased compared with B6 in the absence of irradiation. However, in B6D2 recipients that were conditioned with 850 cGy of irradiation, we confirmed our earlier findings of an increased number of CCR5/ compared with B6 donor T cells in the liver and lung (Fig. 4B). The increases observed in liver and lung in irradiated recipients at this time point were similar to our findings on day 18 in the previous experiment (Fig. 3), in which we demonstrated significantly increased CCR5/ T cell infiltrates in the liver, but only a modest increase in CD8+ CCR5/ T cells in the lung.
|
We next addressed the expression of several proinflammatory chemokines at days 3, 7, and 14 post-transplant in both irradiated (950 cGy) and nonirradiated B6D2 recipients of B6 transplants, syngeneic transplants (B6D2), and untreated controls. Total RNA was collected from livers, lungs, and spleens from recipients, and real-time RT-PCR was performed on cDNA generated from these RNA samples. As illustrated in Fig. 5, in the liver and lung, where we had observed significant differences in B6 vs CCR5/ T cell infiltrates in irradiated recipients, the expression of all chemokines assayed occurred earlier in irradiated recipients of allogeneic T cells compared with nonirradiated recipients. In the liver and lung of irradiated recipients, the CXCR3 ligands, CXCL10 and CXCL11, were induced earliest, beginning on day 3 post-transplant, whereas the CCR5 ligands, CCL3 and CCL4, began to increase on day 7. The CXCR3 ligands continued to increase through the first week post-transplant, and their expression either reached a plateau or declined during the second week. The expression of the CCR5 ligands did not decrease during the second week, with the exception of CCL3 expression in the lung, which declined slightly. In nonirradiated recipients receiving allogeneic T cells, the expression of the CXCR3 ligands again preceded that of the CCR5 ligands, beginning on day 7. Levels of CXCR3 ligands were highest on day 14 in these recipients, but peak levels were not significantly different from peak levels seen on day 7 in irradiated recipients. The CCR5 ligands were induced during the second week post-transplant in nonirradiated recipients, and interestingly, peak expression observed on day 14 was in most cases (again with the exception of CCL3 expression in the lung) significantly higher than the peak expression observed in the irradiated recipients. Chemokine expression was not induced in the liver and lung of either nonirradiated or irradiated recipients of syngeneic T cells, with the exception of a modest, but significant, increase in CXCL11 expression in the liver in irradiated syngeneic transplant recipients on day 3.
|
Role of CXCL10 in migration of CCR5/ T cells and GVHD severity
To determine whether the increased expression of CXCL10 early post-transplant could play a role in enhanced GVHD found using CCR5/ T cells, we evaluated the in vitro migration of wild-type and CCR5/ cells. We activated B6 and CCR5/ T cells in culture using methods shown previously to induce the expression of both CXCR3 and CCR5 (46). The optimal concentration of CXCL10 for the migration of B6 T cells was determined to be 100 ng/ml (data not shown). At this concentration of CXCL10, CCR5/ T cells had significantly increased migration compared with B6 T cells (Fig. 6A). This increase in migratory response to CXCL10 was not associated with increased expression of CXCR3 by CCR5/ T cells, as determined by both real time RT-PCR and staining for cell surface protein (Fig. 6, B and C). To assess the in vivo relevance of this finding, B6D2 recipients were lethally irradiated and given B6 bone marrow with B6 or CCR5/ T cells. Included were groups of recipients treated with an anti-CXCL10 mAb. B6D2 recipients given CCR5/ T cells and four doses of a hamster IgG control Ab had 43% mortality compared with 0% in those receiving B6 T cells and IgG control Ab. Administration of four doses of 100 µg of anti-murine CXCL10 mAb prevented mortality completely in B6D2 recipients of CCR5/ T cells (Fig. 6D). Thus, the enhanced GVHD found using CCR5/ donor T cells was abrogated by blocking the function of CXCL10.
| Discussion |
|---|
|
|
|---|
Murai et al. (26) described decreased proportions of eGFP-expressing CCR5/ donor splenocytes infiltrating liver, spleen, mesenteric lymph node, and intestinal epithelium on day 14 post-transplantation. To confirm that the differences in our data were due to differences in pretransplant conditioning, we performed transplants in nonirradiated B6D2 recipients and assessed donor cell infiltrates on day 14 post-transplant, as did Murai et al. (26) Our data confirm that reported by Murai et al. (26), as in the absence of irradiation, transplantation of CCR5/ T cells led to fewer donor T cells isolated from the liver, lung, and Peyers patch, whereas in lethally irradiated recipients there was an increase in CCR5/ T cells at these sites. These data demonstrate that differences in pretransplant conditioning altered the effect of eliminating CCR5 expression from donor cells on the migration and/or expansion of these cells. This finding has clear significance, as in the clinical setting, conditioning of allogeneic bone marrow transplant recipients with TBI and/or chemotherapy is necessary for efficient engraftment. Thus, our work suggests that the use of inhibitors of CCR5 could exacerbate, not ameliorate, GVHD in patients that receive fully myeloablative conditioning therapy.
To understand the mechanism behind the differential role of CCR5 in T cell migration during GVHD in irradiated and nonirradiated recipients, we analyzed the expression of several proinflammatory chemokines in GVHD target organs at various time points after transplant. We focused our analysis on the liver and lung, where we had seen significant differences in B6 vs CCR5/ T cell infiltrates. The expression of CCL3, CCL4, CXCL10, and CXCL11 were significantly increased in liver and lung from irradiated recipients compared with nonirradiated recipients during the first 7 days post-transplant. Although delayed compared with irradiated recipients, the expression of the CCR5 ligands, CCL3 and CCL4, was more prominent in these tissues in nonirradiated recipients on day 14 post-transplant. Consistent with a role for these ligands in GVHD pathogenesis in nonirradiated recipients, recruitment of T cells into these target organs was largely dependent upon CCR5 expression on donor T cells, as the infusion of CCR5/ donor T cells resulted in lower levels of infiltration. Importantly, we found a marked increase in the IFN-inducible CXCR3 ligands, CXCL10 and CXCL11, in the liver and lung of irradiated compared with nonirradiated recipients during the first week post-transplant. Interestingly, the expression of CXCR3 ligands in the spleens of irradiated recipients declined rapidly during the first week post-transplant. This is consistent with previous observations in our laboratory that CXCR3 ligands such as CXCL9 and CXCL10 are expressed early after transplant due to the combined effects of radiation and transfer of allogeneic T cells (J. Serody, unpublished observations) and suggests that they are expressed primarily from recipient cells post-transplant. The increased infiltration of CCR5/ T cells observed in the liver and lung of irradiated recipients correlated with elevated levels of CXCR3 ligands that persisted throughout the first week post-transplant in those tissues. In contrast, we did not see increased CCR5/ T cell infiltrates in the spleen, where levels of these ligands decreased substantially after day 3. The decreased expression of ligands that bind to CXCR3 in lethally irradiated recipients after day 7 in liver and lung and after day 3 in spleen could be due to an influx of donor T cells that either dilute recipient cells expressing these ligands or destroy them, which would be consistent with previous work on the time for turnover of recipient APCs post-transplantation (50, 51). The observation of only modest induction of CXCL11 in liver and CXCL10 in spleen in irradiated recipients of syngeneic transplants confirms our previous observations that induction of these ligands early after transplantation requires both conditioning effects and transfer of allogeneic T cells.
Because CXCR3 ligands were more prominently expressed during the first week post-transplant in target tissues of irradiated recipients, we hypothesized that the difference in GVHD severity and tissue infiltrates in recipients of CCR5/ vs B6 donor T cells could result from differences in the activity of these ligands on B6 and CCR5/ T cells. We therefore assessed the ability of B6 and CCR5/ T cells to migrate in response to CXCL10. CCR5/ T cells migrated more efficiently to a physiologically relevant dose of CXCL10 compared with B6 T cells. Interestingly, this was not associated with increased expression of CXCR3 in CCR5/ T cells. Furthermore, Ab-mediated neutralization of CXCL10 in vivo during the induction of GVHD prevented increased mortality in recipients of CCR5/ donor T cells. These data suggest that CCR5 may be involved in modulating the response of T cells to CXCR3 ligands. The capacity of CCR5 to reduce the responsiveness of lymphocytes to non-CCR5-binding chemokines through heterologous desensitization has been demonstrated in other studies (36, 37), although this is the first demonstration that eliminating CCR5 expression increases T cell sensitivity to a CXCR3 ligand. Previous investigators have shown that Th1 cells express CXCR3 and CCR5 preferentially (32, 33). As acute GVHD in the B6 into B6D2 model is mediated by Th1 cytokine-expressing T cells (5), our in vitro and in vivo data would suggest that CCR5 may play an important role in down-modulating the response to ligands that bind CXCR3 on Th1/Tc1 cells. We are currently evaluating this hypothesis.
We have demonstrated a correlation between donor T cell infiltration and tissue pathology in the lung, which is consistent with previous studies (24). However, concordant with previous findings from our group (21) and others (52), significant increases in CCR5/ donor T cell infiltrates in the liver did not lead to significant increases in pathology, as assessed by quantitative histopathological scoring. The difference between B6 and CCR5/ CD8+ T cell infiltrates increased between days 7 and 18; thus, it is possible that the differences in liver GVHD scores may have been significant if evaluated beyond day 18. Alternatively, the liver has been shown to trap systemically activated CD8+ T cells via adhesion molecule expression on sinusoidal endothelium and to induce their apoptosis, possibly through cytokine production by bone marrow-derived Kupffer cells and dendritic cells (53). Thus, the increased number of CD8+ T cells found in the liver may reflect the trapping of previously activated alloreactive T cells, which do not cause tissue damage characteristic of GVHD.
A specific role for the chemokine receptor, CXCR3, in mediating graft rejection after heart transplantation has been conclusively demonstrated by Hancock et al. (54, 55). However, the complexity of the chemokine system has made it difficult to identify a specific function for chemokine ligands and receptors during GVHD. Most studies that have identified a role for a specific ligand or receptor have relied on recipient mice that have not been conditioned or that have received sublethal conditioning (20, 21, 22, 25, 26). Our work suggests a potential explanation for these findings. Our group has recently shown that donor cells infiltrate widely into peripheral lymphoid tissues immediately post-transplantation, followed 4872 h later by migration of activated T cells to GVHD target organs (56). This could lead to increased expression of chemokine ligands, such as CXCL10 and CXCL11 by recipient cells, induced by the combination of irradiation and production of IFN-
by activated allogeneic donor T cells interacting with professional recipient APCs. The local production of CXCL10 and CXCL11 would lead to the recruitment and expansion of donor T cells in these GVHD target organs. This would correspond with our finding that the infiltration of CCR5/ and B6 T cells does not differ on day 3, but is significantly different by day 7 post-transplantation. Later autocrine production of CCR5-binding chemokines by recruited T cells responding to alloantigens within target organs may be critical in amplifying this response. In support of this model, our group has identified allogeneic donor T cells as the major source of the CCR5 ligand CCL3 during GVHD in settings of both class I and class II MHC mismatch and has demonstrated that CCL3 production by donor T cells in target organs such as liver and lung is not detectable until day 6 post-transplant (21). In the absence of conditioning therapy, autocrine production by donor T cells may be the predominant source of chemokines; therefore, CCR5 ligands may play a more significant role. Thus, approaches that do not target both these axes may show little effect in MHC-mismatched bone marrow transplants using lethal irradiation, and our data indicate that inhibiting only one axis may potentiate the other. This hypothesis would be consistent with recent data from Duffner et al. in which they were able to show a significant role for CXCR3 in the migration of donor T cells to the small bowel in a minor mismatch model, but not in the B6 into B6D2 model (23). In this model, MHC mismatch induces more significant T cell expansion and subsequent production of CCR5-binding chemokines by these cells. In the absence of CXCR3 expression, T cells may have a greater response to CCR5-binding chemokines. Additionally, CXCR3- and/or CCR5-binding chemokines may be important only in the migration of T cells into the small bowel, liver, and lung; other ligands and receptors may be critical in the migration of alloreactive T cells to the colon and skin.
In summary, we have found that the absence of CCR5 on donor T cells can enhance or diminish T cell migration into specific GVHD target organs dependent on whether recipient mice receive conditioning therapy. This suggests that targeting CCR5 will only be effective clinically in the absence of myeloablative conditioning therapy. Additionally, we have found that CCR5/ T cells have enhanced migration to the CXCR3 ligand, CXCL10, demonstrating a novel role for CCR5. Future work will determine the mechanism for this finding.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Jonathan S. Serody, Lineberger Comprehensive Cancer Center, Campus Box 7295, University of North Carolina, Chapel Hill, NC 27599-7295. E-mail address: jonathan_serody{at}med.unc.edu ![]()
3 Abbreviations used in this paper: GVHD, graft-vs-host disease; eGFP, enhanced GFP; GPCR, G protein-coupled receptor; ACK, ammonium chloride, potassium carbonate; Tc, T cytotoxic. ![]()
Received for publication January 8, 2004. Accepted for publication May 4, 2004.
| References |
|---|
|
|
|---|
antibody for the treatment of refractory severe acute graft-versus-host disease. Blood 79:3362.
on graft-versus-host disease and graft-versus-leukemia. J. Clin. Invest. 104:459.[Medline]
antibodies on acute graft-versus-host disease pathologies. Blood 91:4051.
is critical to the recruitment of CD8+ T cells to the liver, lung and spleen during graft-versus-host disease. Blood 96:2973.
are impaired in causing GVHD across a class I but not class II MHC barrier. Blood 93:43.
(CCL3) post allogeneic BMT in mice. Blood 101:3714.
receptor CCR7. J. Cell Biol. 141:1053.
-arrestins in the termination and transduction of G-protein-coupled receptor signals. J. Cell Sci. 115:455.
stimulation. Eur. J. Immunol. 32:1792.[Medline]
are overcome to control infection with Leishmania donovani in CC chemokine receptor (CCR) 5-, macrophage inflammatory protein-1
-, or CCR2-deficient mice. J. Immunol. 163:5519.
4
7 integrin) is an important homing integrin on alloreactive T cells in the development of intestinal graft-versus-host disease. Blood 103:1542.This article has been cited by other articles:
![]() |
T. Yi, Y. Chen, L. Wang, G. Du, D. Huang, D. Zhao, H. Johnston, J. Young, I. Todorov, D. T. Umetsu, et al. Reciprocal differentiation and tissue-specific pathogenesis of Th1, Th2, and Th17 cells in graft-versus-host disease Blood, October 1, 2009; 114(14): 3101 - 3112. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Kim, R. Romero, C. J. Kim, A. L. Tarca, S. Chhauy, C. LaJeunesse, D.-C. Lee, S. Draghici, F. Gotsch, J. P. Kusanovic, et al. Villitis of Unknown Etiology Is Associated with a Distinct Pattern of Chemokine Up-Regulation in the Feto-Maternal and Placental Compartments: Implications for Conjoint Maternal Allograft Rejection and Maternal Anti-Fetal Graft-versus-Host Disease J. Immunol., March 15, 2009; 182(6): 3919 - 3927. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Carlson, M. L. West, J. M. Coghill, A. Panoskaltsis-Mortari, B. R. Blazar, and J. S. Serody In vitro-differentiated TH17 cells mediate lethal acute graft-versus-host disease with severe cutaneous and pulmonary pathologic manifestations Blood, February 5, 2009; 113(6): 1365 - 1374. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Li, Y. Chen, W. He, T. Yi, D. Zhao, C. Zhang, C.-L. Lin, I. Todorov, F. Kandeel, S. Forman, et al. Anti-CD3 preconditioning separates GVL from GVHD via modulating host dendritic cell and donor T-cell migration in recipients conditioned with TBI Blood, January 22, 2009; 113(4): 953 - 962. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. He, Q. Cao, Y. Qiu, J. Mi, J. Z. Zhang, M. Jin, H. Ge, S. G. Emerson, Y. Zhang, and Y. Zhang A New Approach to the Blocking of Alloreactive T Cell-Mediated Graft-versus-Host Disease by In Vivo Administration of Anti-CXCR3 Neutralizing Antibody J. Immunol., December 1, 2008; 181(11): 7581 - 7592. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Holst, C. Orskov, K. Qvortrup, J. P. Christensen, and A. R. Thomsen CCR5 and CXCR3 Are Dispensable for Liver Infiltration, but CCR5 Protects against Virus-Induced T-Cell-Mediated Hepatic Steatosis J. Virol., September 15, 2007; 81(18): 10101 - 10112. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zhang, J. Lou, N. Li, I. Todorov, C.-L. Lin, Y.-A. Cao, C. H. Contag, F. Kandeel, S. Forman, and D. Zeng Donor CD8+ T Cells Mediate Graft-versus-Leukemia Activity without Clinical Signs of Graft-versus-Host Disease in Recipients Conditioned with Anti-CD3 Monoclonal Antibody J. Immunol., January 15, 2007; 178(2): 838 - 850. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kallikourdis, K. G. Andersen, K. A. Welch, and A. G. Betz Alloantigen-enhanced accumulation of CCR5+ 'effector' regulatory T cells in the gravid uterus PNAS, January 9, 2007; 104(2): 594 - 599. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. McDyer Human and Murine Obliterative Bronchiolitis in Transplant Proceedings of the ATS, January 1, 2007; 4(1): 37 - 43. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ueha, M. Murai, H. Yoneyama, M. Kitabatake, T. Imai, T. Shimaoka, S. Yonehara, S. Ishikawa, and K. Matsushima Intervention of MAdCAM-1 or fractalkine alleviates graft-versus-host reaction associated intestinal injury while preserving graft-versus-tumor effects J. Leukoc. Biol., January 1, 2007; 81(1): 176 - 185. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Lee, S. G. Kang, and C. H. Kim FoxP3+ T Cells Undergo Conventional First Switch to Lymphoid Tissue Homing Receptors in Thymus but Accelerated Second Switch to Nonlymphoid Tissue Homing Receptors in Secondary Lymphoid Tissues J. Immunol., January 1, 2007; 178(1): 301 - 311. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. N. Ajuebor, J. A. Carey, and M. G. Swain CCR5 in T Cell-Mediated Liver Diseases: What's Going On? J. Immunol., August 15, 2006; 177(4): 2039 - 2045. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. W. Lim, H. E. Broxmeyer, and C. H. Kim Regulation of Trafficking Receptor Expression in Human Forkhead Box P3+ Regulatory T Cells J. Immunol., July 15, 2006; 177(2): 840 - 851. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Welniak, D. V. Kuprash, A. V. Tumanov, A. Panoskaltsis-Mortari, B. R. Blazar, K. Sun, S. A. Nedospasov, and W. J. Murphy Peyer patches are not required for acute graft-versus-host disease after myeloablative conditioning and murine allogeneic bone marrow transplantation Blood, January 1, 2006; 107(1): 410 - 412. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Dutt, J. Ermann, D. Tseng, Y. P. Liu, T. I. George, C. G. Fathman, and S. Strober L-selectin and {beta}7 integrin on donor CD4 T cells are required for the early migration to host mesenteric lymph nodes and acute colitis of graft-versus-host disease Blood, December 1, 2005; 106(12): 4009 - 4015. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Wysocki, Q. Jiang, A. Panoskaltsis-Mortari, P. A. Taylor, K. P. McKinnon, L. Su, B. R. Blazar, and J. S. Serody Critical role for CCR5 in the function of donor CD4+CD25+ regulatory T cells during acute graft-versus-host disease Blood, November 1, 2005; 106(9): 3300 - 3307. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. R Blazar and W. J Murphy Bone marrow transplantation and approaches to avoid graft-versus-host disease (GVHD) Phil Trans R Soc B, September 29, 2005; 360(1461): 1747 - 1767. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. P. Moran, M. Collier, K. P. McKinnon, N. L. Davis, R. E. Johnston, and J. S. Serody A Novel Viral System for Generating Antigen-Specific T Cells J. Immunol., September 1, 2005; 175(5): 3431 - 3438. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Wysocki, A. Panoskaltsis-Mortari, B. R. Blazar, and J. S. Serody Leukocyte migration and graft-versus-host disease Blood, June 1, 2005; 105(11): 4191 - 4199. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. Hildebrandt, K. M. Olkiewicz, S. Choi, L. A. Corrion, S. G. Clouthier, C. Liu, J. S. Serody, and K. R. Cooke Donor T-cell production of RANTES significantly contributes to the development of idiopathic pneumonia syndrome after allogeneic stem cell transplantation Blood, March 15, 2005; 105(6): 2249 - 2257. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |