The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by O’Donnell, P. W.
Right arrow Articles by Blum, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O’Donnell, P. W.
Right arrow Articles by Blum, J. S.
The Journal of Immunology, 2004, 173: 731-735.
Copyright © 2004 by The American Association of Immunologists

CUTTING EDGE

Cutting Edge: Induction of the Antigen-Processing Enzyme IFN-{gamma}-Inducible Lysosomal Thiol Reductase in Melanoma Cells Is STAT1-Dependent but CIITA-Independent1

Patrick W. O’Donnell, Azizul Haque, Michael J. Klemsz, Mark H. Kaplan and Janice S. Blum2

Department of Microbiology and Immunology and Walther Oncology Center, Indiana University School of Medicine, Indianapolis, IN 46202; and Walther Cancer Institute, Indianapolis, IN 46208


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results and Discussion
 References
 
Presentation and CD4+ T cell responses to Ag in the context of MHC class II molecules require processing of native proteins into short peptide fragments. Within this pathway, IFN-{gamma}-inducible lysosomal thiol reductase (GILT) functions to catalyze thiol bond reduction, thus unfolding native protein Ag and facilitating further processing via cellular proteases. In contrast with professional APCs such as B cells, class II-positive human melanomas expressed relatively little to no GILT protein or mRNA. Tumor cell GILT expression was partially restored with IFN-{gamma} treatment but unlike other genes required for class II Ag presentation, GILT was not regulated by CIITA. Rather, studies revealed STAT1 plays a direct role in IFN-{gamma}-inducible GILT expression. These results define a molecular mechanism for the uncoupled regulation of MHC class II genes and the processing enzyme GILT in human melanomas.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results and Discussion
 References
 
Presentation of Ag in the context of MHC class II molecules requires processing of native proteins into short peptides for optimal MHC binding and TCR recognition (1, 2). Pathways for Ag processing have been best defined in professional APCs and involve Ag denaturation via unfolding coupled with proteolysis (3, 4, 5). Within this processing pathway, the reduction of disulfide bonds is a critical step (6, 7, 8, 9). A 30-kDa IFN-{gamma}-inducible thiol reductase, IFN-{gamma}-inducible lysosomal thiol reductase (GILT), 3 functions to catalyze thiol bond reduction, thus unfolding native protein Ag and facilitating further processing via cellular proteases. In professional APCs such as B cells and macrophages, GILT is optimally active at low pH and has been demonstrated to play a key role in Ag processing and the display of immunodominant epitopes by class II molecules (8, 10, 11, 12, 13, 14, 15).

GILT expression correlates with class II protein levels in professional APCs: constitutive in class II-positive B cells and inducible by IFN-{gamma} in macrophages (12). In contrast, studies with class II-positive tumors such as melanomas suggest the expression of MHC class II and GILT may not always be linked. GILT expression is absent or expressed at low levels in a majority of class II-positive human melanomas (12). This observation suggests that Ag-processing reactions may differ in melanomas and professional APCs, thus influencing tumor escape from immune surveillance.

The signaling mechanisms which regulate IFN-{gamma}-dependent gene transcription have been well characterized (16, 17). IFN-{gamma} stimulates a cell through a specific receptor followed by activation of Jak 1 and 2, which phosphorylate tyrosine residues on the intracellular domain of the receptor. These phosphotyrosine residues serve as docking sites for STAT1 monomers which are subsequently phosphorylated by Jak 1 and 2. Phospho-STAT1 dimerizes and transits to the nucleus to activate the transcription of numerous target genes (18, 19, 20). IFN-{gamma} treatment of macrophages and nonprofessional APCs including many tumors can induce class II Ag expression by activation of STAT1 and the induction of specific isoforms of the transcription factor CIITA. Yet, whether STAT1 or CIITA play a role in the expression of GILT has not been tested.

As melanomas represent the most lethal cancer of the skin, with resistance to many chemotherapeutic treatments, novel immunotherapeutic strategies to treat and prevent reoccurrence of these tumors are being explored (21, 22). CD4+ and CD8+ T cells specific for melanoma-derived Ag can be isolated from patients suggesting that immune defenses can be mobilized to recognize and attack these tumors (23). In addition, therapeutic delivery of large numbers of CD4+ and CD8+ T cells to patients correlates with tumor regression and disease remission (24). Thus, understanding the mechanisms which guide Ag processing reactions in melanomas and professional APCs may be important to enhancing these experimental therapies.

The goal here was to define at a molecular level the mechanisms that control GILT expression in melanomas. Studies confirmed very low or undetectable basal levels of GILT protein in human class II-positive melanomas. IFN-{gamma} treatment of these tumors enhanced the amount of intracellular GILT protein and mRNA, although the level of GILT protein and message in these cytokine-treated tumors was still less than that found in human B lymphoblasts. Although GILT secretion has been observed in certain B cells and stimulated macrophages (10, 11), cellular release of GILT was not observed in resting or cytokine-activated tumors. Rather, GILT produced by tumors was retained in cells and correlated with mRNA levels. CIITA, a master switch promoting constitutive class II expression in B cells and IFN-{gamma} induction in macrophages (25, 26, 27), was not responsible for basal or inducible GILT expression in melanomas. Studies using B cells lacking or expressing CIITA, as well as mutant B cells missing members of the RFX protein family (28, 29) demonstrated further that GILT was not regulated transcriptionally by those same factors that control MHC class II expression. Instead, studies indicated IFN-{gamma} induction of GILT expression in tumors was dependent on activation of STAT1.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results and Discussion
 References
 
Cells, IFN-{gamma} stimulation, and Western analysis

Cells were cultured as previously described (12, 30, 31), stimulated with human IFN-{gamma} (100–500 U/ml; R&D Systems, Minneapolis, MN), and whole cell protein extracts were prepared with the addition of phosphatase inhibitor mixtures 1 and 2 (Sigma-Aldrich, St. Louis, MO). Western analysis using whole cell lysate (25 µg protein) was performed as previously described (8). The following Abs were used: actin (Neomarkers, Fremont, CA), GILT (rabbit antiserum, Vishnu a gift from P. Cresswell, Yale University, New Haven, CT), total STAT1 (Upstate Biotechnology, Lake Placid, NY), and MHC class II {alpha} and {beta} (DA6.147 and XD5.A11).

Biotin-labeled DNA oligonucleotide pull-down, RNA isolation, and Northern analysis

Whole cell lysate (100 µg protein) was incubated with a biotin-labeled dsDNA oligonucleotide as previously described (32) using the following 5' biotin-linked oligonucleotides: no. 1: GCCACTGGGACTTCAGAGAAGCTCCGGCTC, no. 2: CCCATGGGCGTCCCTTGAAGGCCAGGTTGC, and complementary nonbiotin oligonucleotides. Oligonucleotide pull-down competition assays were performed as above with addition of 10-, 100-, 500-fold nonbiotinylated DNA oligonucleotide. Oligonucleotides with a p53 binding site: TCCGAACAAGTCCGGGCATATGT (33), or a STAT1 consensus binding site: TCGAGCCTGATTTCCCCGAAATGAGGC (34) and complementary oligonucleotides were used to generate double-stranded competitors. Total RNA was extracted from cells using Tri-Reagent (Molecular Research Center, Cincinnati, OH), and Northern analysis performed (35).


   Results and Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
References
 
GILT expression in melanomas is controlled at the level of gene transcription and not reductase secretion

Despite measurable levels of MHC class II protein expression, a majority of the human melanomas express only low levels of a thiol reductase GILT, an enzyme linked to efficient Ag processing (12). Two such melanomas, 1359mel and J3, were tested to determine mechanisms controlling IFN-{gamma} induction of GILT in these tumors. In the absence of IFN-{gamma} treatment, very low or no GILT protein was detectable in 1359mel or J3 (Fig. 1A). Upon cytokine treatment, both melanomas displayed increased GILT protein levels. Melanoma responses to IFN-{gamma} stimulation at multiple time points were also tested and GILT protein levels increased in stimulated tumors until at least 48 h (data not shown). Previous work has shown that reductase glycosylation can lead to changes in GILT protein migration during electrophoresis (12). Such differences were not noted here, suggesting that the intracellular GILT isoform detected was similar in each of the tumors and B-LCL lines tested. These studies demonstrate that in contrast to B cells, resting tumor cells display uncoupled expression of GILT and class II DR. However, the cytokine inducibility of GILT in DR-positive melanomas indicated that these tumors can synthesize low levels of full-length GILT mRNA and protein in response to IFN-{gamma}.



View larger version (57K):
[in this window]
[in a new window]
  		FIGURE 1. IFN-{gamma} activation of melanomas induces GILT mRNA synthesis and intracellular reductase accumulation. A, Western analysis of basal and IFN-{gamma}-stimulated GILT protein levels in cell lysates and c.m. from 1359, J3 melanomas, and Frev B cells. Melanomas were stimulated with 100 U/ml IFN-{gamma} for 48 h, media collected, cell lysates or c.m. (13 µl) were electrophoresed and immunoblotted for GILT and MHC class II Ags (DR{alpha} and {beta}). B, GILT expression in melanomas correlates with mRNA abundance. Northern analysis of GILT mRNA levels in Frev and human melanomas. Total RNA was prepared, and samples (12 µg) were electrophoresed and transferred to a membrane, followed by hybridization with a GILT oligonucleotide. The ethidium bromide stain of rRNA bands is shown for comparison. Representative of three independent experiments.

 
Macrophages and some B cells are able to express increased GILT levels in response to IFN-{gamma}, however, these monocytic and lymphoid B cell lines secrete measurable amounts of the reductase into their extracellular medium (10, 11). Melanomas have also been shown to secrete select lysosomal proteases, thus, protein secretion could account for reduced reductase levels observed in melanomas (36). Remarkably, neither resting nor cytokine-treated 1359mel secreted any detectable GILT protein (Fig. 1A). In addition, GILT secretion was not observed using J3 tumor cells including a subclone stably transfected to constitutively express GILT under the control of a viral promoter. In contrast, the human B cell line Pala secreted measurable levels of GILT in conditioned media (c.m.) (data not shown). Although either cytokine treatment or gene transfection could be used to increase GILT protein levels in tumors, GILT was not detectable in conditioned media from tumor cells. Therefore, the reduced expression of GILT in melanomas was not due to a defect in the sorting or retention of this lysosomal enzyme.

Differences in gene transcription were tested as a potential mechanism to explain the reduced GILT levels in melanomas. Northern analysis revealed an abundance of GILT mRNA in the B cell Frev and the GILT-transfected tumor J3.GILT (Fig. 1B). However, in multiple human melanoma lines: 1359mel, SLM2mel, J3, M21, 1102mel, and M1106, little to no basal GILT RNA was detected. A consistent increase in GILT RNA was seen when J3 cells were treated with IFN-{gamma}. These data suggest GILT protein levels in melanomas are the result of the low levels of GILT mRNA and not altered protein metabolism.

Neither basal nor inducible GILT expression is controlled by the transactivator CIITA

The ability of IFN-{gamma} to trigger both GILT and MHC class II protein synthesis in several human melanomas (Fig. 1A) raised the possibility that similar transcription factors may govern the inducible expression of these molecules in tumor cells. To further probe the mechanism(s) responsible for the low level of GILT expression in class II+ human melanomas, the relative importance of transcription factors known to influence MHC class II abundance in response to signaling via the IFN-{gamma} receptor was examined (16, 17). One transactivator, CIITA, necessary for the expression of genes within the MHC class II loci, as well as the invariant chain, is synthesized by professional and nonprofessional APCs in response to IFN-{gamma} (17, 25, 27). To directly test the requirements for CIITA, IFN-{gamma}-inducible GILT expression was analyzed by immunoblot in a small subset of melanomas that lack basal CIITA expression. These melanoma lines (mel 624, mel 888, and mel 1861) were transduced to ectopically express CIITA under the control of a retroviral promoter. mel 624 (Fig. 2A), mel 888, and mel 1861 (data not shown) all expressed low basal levels of GILT but no class II protein. Upon cytokine treatment, GILT expression increased in each of the parental tumors, but to a level below that observed for the professional APC Frev. RT-PCR demonstrated that all three melanoma lines lacked basal CIITA mRNA expression (data not shown). Only mel 888 expressed class II in response to IFN-{gamma} (data not shown). When CIITA was ectopically expressed in these three tumors, there was no significant increase in GILT protein compared with the parental lines. Ectopic expression of CIITA, even in the absence of IFN-{gamma}, did result in measurable class II DR levels in these tumor lines.



View larger version (74K):
[in this window]
[in a new window]
  		FIGURE 2. GILT expression is not dependent on the function of CIITA. A, Constitutive expression of CIITA does not up-regulate GILT protein in melanomas. Western analysis of basal and IFN-{gamma}-inducible expression of GILT in Frev, mel 624, and mel 624 CIITA. Cells were untreated or stimulated with 100 U/ml IFN-{gamma} for 48 h, cell lysates were electrophoresed and immunoblotted for GILT, MHC class II DR{alpha}, and actin. Representative densitometric analysis of GILT expression: mel624, 2.9 U; mel624 + IFN-{gamma}, 9.7 U; mel624.CIITA, 2.7 U; mel624.CIITA + IFN-{gamma}, 6.2 U; Frev, 47.3 U. B, CIITA does not regulate GILT expression in B cells. Western analysis of GILT expression in Raji, RJ2.2.5, 1315 no. 4, and 1315 no. 32. Cell lysates were electrophoresed and immunoblotted for GILT, MHC class II (DR{alpha} and {beta}), and actin. Representative of three independent experiments.

 
GILT expression was also examined in a B cell line lacking CIITA, RJ2.2.5 (Fig. 2B), as well as B cell lines (SJO, BLS-1, 6.1.6) lacking discrete RFX family members (data not shown). The loss of CIITA or RFX proteins in these cells results in a class II null phenotype known as bare lymphocyte syndrome (28, 29). GILT was detectable in all cell lines tested, regardless of the absence of CIITA or RFX family members. Furthermore, 1315 nos. 4 and 32, RJ2.2.5-derived subclones in which CIITA has been stably transfected to restore class II protein expression, showed no change in GILT levels. Thus, CIITA is neither sufficient nor required for basal or cytokine inducible expression of GILT in multiple cell types.

STAT1 is required for IFN-{gamma}-inducible, but not basal, GILT expression

IFN-{gamma} induction of CIITA is a downstream event, mediated by the STAT1 transcription factor which is activated by Jaks in response to cytokine engagement of the IFN-{gamma} receptor (16, 25, 27, 37). To determine whether GILT gene expression might be linked to early events in IFN-{gamma} signaling, the time course of GILT mRNA production was monitored in IFN-{gamma}-treated tumors. GILT mRNA was detectable between 2 and 4 h of IFN-{gamma} treatment and increased to a maximum level at 16 h poststimulation (Fig. 3A).



View larger version (62K):
[in this window]
[in a new window]
  		FIGURE 3. IFN-{gamma} induction of GILT in tumor cells is STAT1-dependent. A, Northern analysis of GILT mRNA in 1359mel following IFN-{gamma} treatment. Cells were untreated or stimulated with 100 U/ml IFN-{gamma} for increasing periods of time, total RNA was electrophoresed and analyzed by hybridization with a GILT oligonucleotide. The membrane was stripped and reprobed with a GAPDH oligonucleotide for comparison. B, STAT1 is required for IFN-{gamma}-inducible, but not basal, GILT expression in fibrosarcoma cells. Western analysis of basal and IFN-{gamma}-inducible expression of GILT protein in Frev and fibrosarcomas 2ftgh, U3A, and U3ASTAT1. Fibrosarcoma cells were untreated or stimulated with 300 U/ml IFN-{gamma} for 48 h, cell lysates were electrophoresed and immunoblotted for GILT, STAT1, and actin. C, STAT1{beta} decreases IFN-{gamma}-inducible GILT expression in melanoma cells. Western analysis of basal and IFN-{gamma}-inducible expression of GILT protein in 1359, 1359 plasmid control (p.c.), and 1359 STAT1{beta} (dominant negative). Cells were stimulated with 100 U/ml IFN-{gamma} for 24 h, cell lysates were electrophoresed and immunoblotted for GILT and actin. Representative of three independent experiments. Densitometric analysis of GILT in this experiment: Frev, 53.4 U; 1359, 0.3 U; 1359 + IFN-{gamma}, 11.2 U; 1359.p.c., 0.5 U; 1359.p.c. + IFN-{gamma}, 12.1 U; 1359.STAT1{beta}, 0.3 U; 1359.STAT1{beta} + IFN-{gamma}, 3.8 U.

 
As activated Stat1 was observed in the melanomas following IFN-{gamma} stimulation, two approaches were undertaken to determine whether STAT1 molecules function in regulating GILT gene expression. A panel of human fibrosarcoma tumors that expressed or lacked expression of STAT1 were tested for basal and IFN-{gamma}-inducible GILT expression (Fig. 3B) (30). 2ftgh (human fibrosarcoma cell line) had a low level of basal GILT expression that increased upon IFN-{gamma} stimulation. However, in the STAT1 null U3A (2ftgh-derived), treatment with IFN-{gamma} had no effect on the basal level of GILT expression. When STAT1 was reconstituted in this cell line yielding the U3ASTAT1 tumor, the IFN-{gamma} induction of GILT expression was restored. Therefore, STAT1 is required for IFN-{gamma}-inducible, but not basal, GILT gene expression in these human tumors.

To extend our results from the fibrosarcoma STAT1 null cell lines, a STAT1 dominant-negative expression plasmid was transfected into the melanoma line 1359mel (Fig. 3C). The dominant-negative STAT1{beta} is a naturally occurring splice variant of the STAT1 gene which lacks the transactivation domain and has been well characterized in interfering with transactivation by the full-length STAT1 (18, 38). GILT was detectable in the cytokine-treated parental 1359 and 1359.pc (plasmid control) transfected lines, but GILT protein induction was reduced in 1359.STAT1{beta} treated with IFN-{gamma}. A decrease in MHC class II expression was observed in 1359.STAT1{beta} cells treated with IFN-{gamma} (data not shown), as expected due to the requirement for STAT1 activation for the induction of CIITA. This further supports a requirement for STAT1 in IFN-{gamma}-inducible GILT expression in tumors.

Analysis of the human GILT promoter revealed at least two sequences which conform to minimal recognition sites for STAT1 (Fig. 4A). Oligonucleotides encoding these sequences were tested for their ability to bind STAT1 from cytokine-activated melanoma cells. Biotin-labeled oligonucleotides were incubated with whole cell protein lysates from IFN-{gamma}-treated melanoma cells in the presence or absence of nonbiotinylated competitor oligonucleotides. Precipitated complexes were then immunoblotted for STAT1 (Fig. 4B). As can be seen, STAT1 binds to biotin-labeled oligonucleotides from the GILT promoter. Binding is competed with a STAT1 consensus sequence but not a p53 binding site oligonucleotide, lacking a consensus sequence. These results support a model wherein STAT1 binds sequences in the GILT promoter to regulate gene expression.



View larger version (34K):
[in this window]
[in a new window]
  		FIGURE 4. STAT1 binds to biotin-labeled STAT consensus sequence oligonucleotides from the GILT promoter. A, Representation of the GILT promoter showing potential STAT binding site and sequences. B, STAT1 binding to two biotin-labeled STAT consensus sequence oligonucleotides from the GILT promoter. 1359 melanoma cells were stimulated with 500 U/ml IFN-{gamma} for 4 h, cell lysates were incubated with biotin-labeled DNA oligonucleotides from the GILT promoter, immunoprecipitated with streptavidin agarose beads, electrophoresed and immunoblotted for STAT1. Specificity was established by adding increasing amount of unlabeled oligonucleotides from a p53 binding site or a STAT consensus oligonucleotide. Representative of three independent experiments.

 
The ordered expression of subsets of genes involved in Ag processing and presentation may be a consequence of the temporal requirement for their function. During the generation of a pathogen-specific immune response, Ag reduction and proteolysis typically precede peptide loading and class II presentation. Therefore, in response to IFN-{gamma}, the rapid induction of GILT via STAT1 activation would be most logical. Furthermore, induction of class II gene expression via IFN-{gamma} is mediated by STAT1 activation through its induction of specific isoforms of the CIITA transcription factor. In the majority of melanomas, class II proteins are continuously synthesized and displayed on the cell surface due to the constitutive expression of CIITA via an enhancer element located in promoter III (39). Subverting class II function and tumor Ag presentation in these tumors may therefore be most easily accomplished by altering Ag processing and GILT expression.


   Acknowledgments
 
We thank Drs. C. H. Chang, P. Robbins, N. Restifo, G. Stark, P. Cresswell, S. Topalian, W. Storkus for provision of cells and reagents. We also thank N. Schmidt, D. Zhou, P. Li, and S. Jackson for their helpful discussions and technical assistance.


   Footnotes
 
1 This study was supported by National Institutes of Health Grants AI49589 and AI056097 and a pilot project award from Indiana University Cancer Center. P.W.O. was supported by National Institutes of Health Grant T32DK07519. A.H. was supported by the Leukemia and Lymphoma Society. Back

2 Address correspondence and reprint requests to Dr. Janice S. Blum, Medical Science Building, Room 420, 635 Barnhill Drive, Indianapolis, IN 46202-5120. E-mail address: jblum{at}iupui.edu Back

3 Abbreviations used in this paper: GILT, IFN-{gamma}-inducible lysosomal thiol reductase; c.m., conditioned medium. Back

Received for publication March 23, 2004. Accepted for publication April 29, 2004.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Pieters, J.. 2000. MHC class II-restricted antigen processing and presentation. Adv. Immunol. 75:159.[Medline]
  2. Watts, C.. 1997. Capture and processing of exogenous antigens for presentation on MHC molecules. Annu. Rev. Immunol. 15:821.[Medline]
  3. West, M. A., J. M. Lucocq, C. Watts. 1994. Antigen processing and class II MHC peptide-loading compartments in human B-lymphoblastoid cells. Nature 369:147.[Medline]
  4. Lennon-Dumenil, A. M., A. H. Bakker, P. Wolf-Bryant, H. L. Ploegh, C. Lagaudriere-Gesbert. 2002. A closer look at proteolysis and MHC-class-II-restricted antigen presentation. Curr. Opin. Immunol. 14:15.[Medline]
  5. Harding, C. V.. 1996. Class II antigen processing: analysis of compartments and functions. Crit. Rev. Immunol. 16:13.[Medline]
  6. Cresswell, P., B. Arunachalam, N. Bangia, T. Dick, G. Diedrich, E. Hughes, M. Maric. 1999. Thiol oxidation and reduction in MHC-restricted antigen processing and presentation. Immunol. Res. 19:191.[Medline]
  7. Collins, D., C. Harding. 1991. Reduction of disulfide bonds within lysosomes is a key step in antigen processing. J. Immunol. 147:4054.[Abstract]
  8. Li, P., M. A. Haque, J. S. Blum. 2002. Role of disulfide bonds in regulating antigen processing and epitope selection. J. Immunol. 169:2444.[Abstract/Free Full Text]
  9. Short, S., B. J. Merkel, R. Caffrey, K. L. McCoy. 1996. Defective antigen processing correlates with a low level of intracellular glutathione. Eur. J. Immunol. 26:3015.[Medline]
  10. Arunachalam, B., U. T. Phan, H. J. Geuze, P. Cresswell. 2000. Enzymatic reduction of disulfide bonds in lysosomes: characterization of {gamma}-interferon-inducible lysosomal thiol reductase (GILT). Proc. Natl. Acad. Sci. USA 97:745.[Abstract/Free Full Text]
  11. Luster, A. D., R. L. Weinshank, R. Feinman, J. V. Ravetch. 1988. Molecular and biochemical characterization of a novel {gamma}-interferon-inducible protein. J. Biol. Chem. 263:12036.[Abstract/Free Full Text]
  12. Haque, M. A., P. Li, S. K. Jackson, H. M. Zarour, J. W. Hawes, U. T. Phan, M. Maric, P. Cresswell, J. S. Blum. 2002. Absence of {gamma}-interferon-inducible lysosomal thiol reductase in melanomas disrupts T cell recognition of select immunodominant epitopes. J. Exp. Med. 195:1267.[Abstract/Free Full Text]
  13. Maric, M., B. Arunachalam, U. T. Phan, C. Dong, W. S. Garrett, K. S. Cannon, C. Alfonso, L. Karlsson, R. A. Flavell, P. Cresswell. 2001. Defective antigen processing in GILT-free mice. Science 294:1361.[Abstract/Free Full Text]
  14. Phan, U. T., B. Arunachalam, P. Cresswell. 2000. {gamma}-Interferon-inducible lysosomal thiol reductase (GILT): maturation, activity, and mechanism of action. J. Biol. Chem. 275:25907.[Abstract/Free Full Text]
  15. Blum, J. S., C. Ma, S. Kovats. 1997. Antigen-presenting cells and the selection of immunodominant epitopes. Crit. Rev. Immunol. 17:411.[Medline]
  16. Boehm, U., T. Klamp, M. Groot, J. C. Howard. 1997. Cellular responses to interferon-{gamma}. Annu. Rev. Immunol. 15:749.[Medline]
  17. Bach, E. A., M. Aguet, R. D. Schreiber. 1997. THE IFN{gamma} receptor: a paradigm for cytokine receptor signaling. Annu. Rev. Immunol. 15:563.[Medline]
  18. Shuai, K., G. R. Stark, I. M. Kerr, J. E. Darnell, Jr. 1993. A single phosphotyrosine residue of Stat91 required for gene activation by interferon-{gamma}. Science 261:1744.[Abstract/Free Full Text]
  19. Levy, D. E., J. E. Darnell. 2002. STATS: transcriptional control and biological impact. Nat. Rev. Mol. Cell Biol. 3:651.[Medline]
  20. Darnell, J. E., Jr, I. M. Kerr, G. R. Stark. 1994. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 264:1415.[Abstract/Free Full Text]
  21. Dillman, R. O., R. K. Oldham, N. M. Barth, R. Birch, J. Arnold, W. H. West. 1990. Recombinant interleukin-2 and adoptive immunotherapy alternated with dacarbazine therapy in melanoma: a National Biotherapy Study Group trial. J. Natl. Cancer Inst. 82:1345.[Abstract/Free Full Text]
  22. O’Rourke, M. G., C. W. Schmidt, T. R. O’Rourke, K. A. Ellem. 1997. Immunotherapy, including gene therapy, for metastatic melanoma. Aust. N. Z. J. Surg. 67:834.[Medline]
  23. Le Drean, E., N. Gervois, E. Diez, G. Semana, B. Dreno, F. Jotereau. 1995. HLA class II-restricted recognition of common tumor epitopes on human melanoma cells by CD4+ melanoma-infiltrating lymphocytes. Eur. J. Immunol. 25:2732.[Medline]
  24. Rosenberg, S.. 2001. Progress in human tumor immunology and immunotherapy. Nature 411:380.[Medline]
  25. Chang, C. H., T. S. Gourley, T. J. Sisk. 2002. Function and regulation of class II transactivator in the immune system. Immunol. Res. 25:131.[Medline]
  26. Rigaud, G., A. De Lerma Barbaro, M. Nicolis, T. Cestari, D. Ramarli, A. P. Riviera, R. S. Accolla. 1996. Induction of CIITA and modification of in vivo HLA-DR promoter occupancy in normal thymic epithelial cells treated with IFN-{gamma}: similarities and distinctions with respect to HLA-DR-constitutive B cells. J. Immunol. 156:4254.[Abstract]
  27. Ting, J. P., J. Trowsdale. 2002. Genetic control of MHC class II expression. Cell 109:(Suppl.):S21.
  28. Kovats, S., G. T. Nepom, M. Coleman, B. Nepom, W. W. Kwok, J. S. Blum. 1995. Deficient antigen-presenting cell function in multiple genetic complementation groups of type II bare lymphocyte syndrome. J. Clin. Invest. 96:217.
  29. Reith, W., B. Mach. 2001. The bare lymphocyte syndrome and the regulation of MHC expression. Annu. Rev. Immunol. 19:331.[Medline]
  30. McKendry, R., J. John, D. Flavell, M. Muller, I. M. Kerr, G. R. Stark. 1991. High-frequency mutagenesis of human cells and characterization of a mutant unresponsive to both {alpha} and {gamma} interferons. Proc. Natl. Acad. Sci. USA 88:11455.[Abstract/Free Full Text]
  31. Robbins, P. F., M. El-Gamil, Y. F. Li, G. Zeng, M. Dudley, S. A. Rosenberg. 2002. Multiple HLA class II-restricted melanocyte differentiation antigens are recognized by tumor-infiltrating lymphocytes from a patient with melanoma. J. Immunol. 169:6036.[Abstract/Free Full Text]
  32. Bruns, H. A., U. Schindler, M. H. Kaplan. 2003. Expression of a constitutively active Stat6 in vivo alters lymphocyte homeostasis with distinct effects in T and B cells. J. Immunol. 170:3478.[Abstract/Free Full Text]
  33. Morris, G. F., J. R. Bischoff, M. B. Mathews. 1996. Transcriptional activation of the human proliferating-cell nuclear antigen promoter by p53. Proc. Natl. Acad. Sci. USA 93:895.[Abstract/Free Full Text]
  34. Ohmori, Y., T. A. Hamilton. 2000. Interleukin-4/STAT6 represses STAT1 and NF-{kappa}B-dependent transcription through distinct mechanisms. J. Biol. Chem. 275:38095.[Abstract/Free Full Text]
  35. Cramer, L. A., S. L. Nelson, M. J. Klemsz. 2000. Synergistic induction of the Tap-1 gene by IFN-{gamma} and lipopolysaccharide in macrophages is regulated by STAT1. J. Immunol. 165:3190.[Abstract/Free Full Text]
  36. Linebaugh, B. E., M. Sameni, N. A. Day, B. F. Sloane, D. Keppler. 1999. Exocytosis of active cathepsin B enzyme activity at pH 7.0, inhibition and molecular mass. Eur. J. Biochem. 264:100.[Medline]
  37. Billiau, A., H. Heremans, K. Vermeire, P. Matthys. 1998. Immunomodulatory properties of interferon-{gamma}: an update. Ann. NY Acad. Sci. 856:22.[Medline]
  38. Schindler, C., X. Y. Fu, T. Improta, R. Aebersold, J. E. Darnell, Jr. 1992. Proteins of transcription factor ISGF-3: one gene encodes the 91- and 84-kDa ISGF-3 proteins that are activated by interferon {alpha}. Proc. Natl. Acad. Sci. USA 89:7836.[Abstract/Free Full Text]
  39. Deffrennes, V., J. Vedrenne, M. C. Stolzenberg, J. Piskurich, G. Barbieri, J. P. Ting, D. Charron, C. Alcaide-Loridan. 2001. Constitutive expression of MHC class II genes in melanoma cell lines results from the transcription of class II transactivator abnormally initiated from its B cell-specific promoter. J. Immunol. 167:98.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
R. L. Lackman and P. Cresswell
Exposure of the Promonocytic Cell Line THP-1 to Escherichia coli Induces IFN-{gamma}-Inducible Lysosomal Thiol Reductase Expression by Inflammatory Cytokines
J. Immunol., October 1, 2006; 177(7): 4833 - 4840.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by O’Donnell, P. W.
Right arrow Articles by Blum, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O’Donnell, P. W.
Right arrow Articles by Blum, J. S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS